Starting /dee2/code/volunteer_pipeline.sh SRR3473003 current disk space = 3089110642688 free memory = 1582317604 SRR3473003 SRAfilesize d7c69e934cb3a9dd8691d96c402d21ad SRR3473003.sra SRR3473003.sra file validated SRR3473003 is single end SRR3473003 is conventional basespace SRR3473003 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473003_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51225 34.0 31.0 34.0 30.0 34.0 2 32.1715 34.0 31.0 34.0 30.0 34.0 3 32.63875 34.0 31.0 34.0 31.0 34.0 4 36.17925 37.0 35.0 37.0 35.0 37.0 5 36.2065 37.0 37.0 37.0 35.0 37.0 6 36.19575 37.0 37.0 37.0 35.0 37.0 7 36.08025 37.0 37.0 37.0 35.0 37.0 8 36.05975 37.0 36.0 37.0 35.0 37.0 9 37.812 39.0 38.0 39.0 35.0 39.0 10-11 37.94525 39.0 38.5 39.0 35.0 39.0 12-13 37.781375 39.0 38.0 39.0 35.0 39.0 14-15 39.227125 41.0 39.0 41.0 36.0 41.0 16-17 39.2485 41.0 39.0 41.0 36.0 41.0 18-19 39.162125 41.0 39.0 41.0 36.0 41.0 20-21 39.113 41.0 39.0 41.0 35.5 41.0 22-23 39.136875 41.0 39.0 41.0 36.0 41.0 24-25 39.144375 41.0 39.0 41.0 35.5 41.0 26-27 38.844 40.5 38.5 41.0 34.5 41.0 28-29 38.9795 40.5 39.0 41.0 35.5 41.0 30-31 38.950625 40.0 39.0 41.0 35.0 41.0 32-33 38.837875 40.0 38.5 41.0 35.0 41.0 34-35 38.875125 40.0 38.0 41.0 35.0 41.0 36-37 38.757625000000004 40.0 38.0 41.0 35.0 41.0 38-39 38.603625 40.0 38.0 41.0 34.5 41.0 40-41 38.66325 40.0 38.0 41.0 34.5 41.0 42-43 38.584875 40.0 38.0 41.0 34.0 41.0 44-45 38.4135 40.0 38.0 41.0 33.5 41.0 46-47 38.473875 40.0 38.0 41.0 34.0 41.0 48-49 38.356750000000005 40.0 38.0 41.0 34.0 41.0 50-51 38.2595 40.0 38.0 41.0 33.5 41.0 52-53 38.125375 40.0 38.0 41.0 33.0 41.0 54-55 38.01525 40.0 37.0 41.0 33.0 41.0 56-57 37.737625 40.0 37.0 41.0 33.0 41.0 58-59 37.605625 39.5 37.0 41.0 33.0 41.0 60-61 37.336625 39.0 36.0 41.0 32.0 41.0 62-63 37.00875 39.0 35.5 40.5 31.5 41.0 64-65 36.68025 38.0 35.0 40.0 31.0 41.0 66-67 36.69525 38.0 35.0 40.0 32.0 41.0 68-69 36.5565 37.5 35.0 40.0 32.0 41.0 70-71 36.194 37.0 35.0 39.0 31.0 41.0 72-73 35.742875 36.5 35.0 39.0 31.0 41.0 74-75 35.295875 36.0 35.0 39.0 31.0 39.5 76-77 35.06825 36.0 35.0 37.5 31.0 39.0 78-79 34.6505 35.0 35.0 37.0 31.0 39.0 80-81 34.3475 35.0 34.0 36.5 31.0 38.0 82-83 34.037375 35.0 34.0 36.0 31.0 37.0 84-85 33.81275 35.0 34.0 36.0 31.0 37.0 86-87 33.629125 35.0 34.0 35.0 30.5 36.5 88-89 33.420500000000004 35.0 34.0 35.0 30.0 36.0 90-91 33.335125 35.0 34.0 35.0 30.0 36.0 92-93 33.249375 35.0 34.0 35.0 30.0 36.0 94-95 33.079375 35.0 34.0 35.0 30.0 35.0 96-97 32.967125 35.0 34.0 35.0 30.0 35.0 98-99 32.698750000000004 35.0 34.0 35.0 29.5 35.0 100 32.00025 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 3.0 10 0.0 11 4.0 12 1.0 13 2.0 14 2.0 15 5.0 16 4.0 17 4.0 18 4.0 19 3.0 20 5.0 21 6.0 22 7.0 23 4.0 24 15.0 25 19.0 26 16.0 27 25.0 28 33.0 29 37.0 30 37.0 31 70.0 32 92.0 33 103.0 34 139.0 35 222.0 36 396.0 37 930.0 38 1496.0 39 313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.651162790697676 13.850129198966407 15.658914728682172 45.83979328165375 2 18.925 23.1 37.075 20.9 3 21.075 26.6 26.424999999999997 25.900000000000002 4 23.05 31.874999999999996 21.6 23.474999999999998 5 23.45 36.5 21.95 18.099999999999998 6 19.900000000000002 37.3 23.325000000000003 19.475 7 16.05 17.875 43.925 22.15 8 19.55 23.625 30.175 26.650000000000002 9 20.349999999999998 22.7 32.1 24.85 10-11 21.3875 33.7625 23.275000000000002 21.575 12-13 20.1 26.900000000000002 29.65 23.35 14-15 20.7875 27.950000000000003 28.825 22.4375 16-17 21.55 27.8625 27.9125 22.675 18-19 21.337500000000002 28.549999999999997 28.037499999999998 22.075 20-21 21.675 28.5875 27.0 22.7375 22-23 21.0625 28.975 27.55 22.412499999999998 24-25 21.0125 27.8375 28.3625 22.787499999999998 26-27 20.7875 29.4875 27.975 21.75 28-29 21.3875 28.799999999999997 27.775 22.037499999999998 30-31 21.7 27.925 27.6125 22.7625 32-33 21.7375 28.6375 27.474999999999998 22.15 34-35 21.512500000000003 27.9375 27.8125 22.7375 36-37 21.475 28.3875 27.750000000000004 22.3875 38-39 20.7875 27.750000000000004 28.475 22.9875 40-41 21.275 27.925 28.787499999999998 22.0125 42-43 21.475 27.525 28.0625 22.9375 44-45 21.4125 28.775000000000002 27.325 22.4875 46-47 21.212500000000002 27.737499999999997 28.5875 22.4625 48-49 21.8625 27.962500000000002 27.037499999999998 23.1375 50-51 21.2875 29.4 27.237499999999997 22.075 52-53 20.837500000000002 28.9 27.487499999999997 22.775000000000002 54-55 21.9 28.3375 27.487499999999997 22.275 56-57 21.65 28.775000000000002 27.3875 22.1875 58-59 22.375 28.525 27.3375 21.762500000000003 60-61 21.2375 28.375 27.787499999999998 22.6 62-63 22.112499999999997 28.449999999999996 27.900000000000002 21.5375 64-65 21.925 28.575 27.625 21.875 66-67 20.4125 29.325000000000003 28.487499999999997 21.775 68-69 22.900000000000002 28.212500000000002 26.924999999999997 21.9625 70-71 20.8625 28.9125 28.199999999999996 22.025 72-73 21.587500000000002 28.712500000000002 27.3375 22.3625 74-75 21.212500000000002 28.712500000000002 27.8625 22.2125 76-77 21.515189398674835 28.353544193024128 28.066008251031377 22.06525815726966 78-79 22.3625 28.299999999999997 27.375 21.9625 80-81 21.7375 29.062500000000004 27.3375 21.8625 82-83 22.8125 28.475 27.3625 21.349999999999998 84-85 21.90273784223028 29.178647330916363 26.978372296537067 21.94024253031629 86-87 21.630407601900476 28.369592398099524 28.157039259814955 21.842960740185045 88-89 21.94024253031629 27.390923865483185 28.478559819977495 22.190273784223027 90-91 21.602700337542196 28.60357544693087 28.253531691461433 21.540192524065507 92-93 22.85 28.65 27.05 21.45 94-95 22.2125 28.7375 27.212500000000002 21.837500000000002 96-97 21.7 28.3125 28.287499999999998 21.7 98-99 22.605651412853213 28.26956739184796 27.66941735433858 21.45536384096024 100 23.65 27.975 27.125 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 2.0 24 3.5 25 1.5 26 0.5 27 3.5 28 7.5 29 11.5 30 17.5 31 21.0 32 34.0 33 56.5 34 69.0 35 73.0 36 82.0 37 114.0 38 155.0 39 177.0 40 195.0 41 218.0 42 238.0 43 262.0 44 281.0 45 279.0 46 270.5 47 238.0 48 204.0 49 190.0 50 162.0 51 134.0 52 111.0 53 92.0 54 76.0 55 56.5 56 40.0 57 30.0 58 20.0 59 12.5 60 12.0 61 9.5 62 8.5 63 8.5 64 6.5 65 4.0 66 2.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.025 88-89 0.0125 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8747808665164 99.7 2 0.10017530678687703 0.2 3 0.0 0.0 4 0.025043826696719257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000567 spots for SRR3473003.sra Written 1000567 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra Read 1000553 spots for SRR3473003.sra Written 1000553 spots for SRR3473003.sra SRR ids: ['SRR3473003.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3m5d96w SRR3473003.sra spots: 20011074 blocks: [[1, 1000553], [1000554, 2001106], [2001107, 3001659], [3001660, 4002212], [4002213, 5002765], [5002766, 6003318], [6003319, 7003871], [7003872, 8004424], [8004425, 9004977], [9004978, 10005530], [10005531, 11006083], [11006084, 12006636], [12006637, 13007189], [13007190, 14007742], [14007743, 15008295], [15008296, 16008848], [16008849, 17009401], [17009402, 18009954], [18009955, 19010507], [19010508, 20011074]] SRR3473003 file size 5470716 SRR3473003 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473003 SRR3473003_1.fastq Input file: SRR3473003_1.fastq trimmed: SRR3473003-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 00:42:46 2025 >> started Fri Feb 14 00:42:57 2025 >> done (10.455s) 20011074 reads processed; of these: 7432 ( 0.04%) short reads filtered out after trimming by size control 36693 ( 0.18%) empty reads filtered out after trimming by size control 19966949 (99.78%) reads available; of these: 1123635 ( 5.63%) trimmed reads available after processing 18843314 (94.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 830 0.00% 19 1006 0.01% 20 1044 0.01% 21 1277 0.01% 22 1472 0.01% 23 1729 0.01% 24 2027 0.01% 25 2501 0.01% 26 2362 0.01% 27 2601 0.01% 28 2630 0.01% 29 2953 0.01% 30 3056 0.02% 31 2915 0.01% 32 2987 0.01% 33 2845 0.01% 34 3202 0.02% 35 3256 0.02% 36 3476 0.02% 37 3702 0.02% 38 3838 0.02% 39 3932 0.02% 40 4297 0.02% 41 4477 0.02% 42 4792 0.02% 43 4807 0.02% 44 5242 0.03% 45 5401 0.03% 46 5656 0.03% 47 5990 0.03% 48 6137 0.03% 49 6415 0.03% 50 6736 0.03% 51 6761 0.03% 52 7107 0.04% 53 7243 0.04% 54 7296 0.04% 55 7268 0.04% 56 7551 0.04% 57 7770 0.04% 58 7944 0.04% 59 8303 0.04% 60 8411 0.04% 61 8703 0.04% 62 8976 0.04% 63 9114 0.05% 64 9267 0.05% 65 9624 0.05% 66 9574 0.05% 67 10107 0.05% 68 10787 0.05% 69 9321 0.05% 70 9684 0.05% 71 9745 0.05% 72 10346 0.05% 73 10442 0.05% 74 10757 0.05% 75 10591 0.05% 76 11207 0.06% 77 12080 0.06% 78 12522 0.06% 79 13115 0.07% 80 14015 0.07% 81 14816 0.07% 82 15619 0.08% 83 16371 0.08% 84 17679 0.09% 85 19066 0.10% 86 20068 0.10% 87 22115 0.11% 88 24637 0.12% 89 26360 0.13% 90 29449 0.15% 91 33349 0.17% 92 38556 0.19% 93 44989 0.23% 94 52616 0.26% 95 60822 0.30% 96 69640 0.35% 97 75838 0.38% 98 74636 0.37% 99 65787 0.33% 100 18843314 94.37% 19966949 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=58.96 fanout-score-rank=3 prefix-density=1.62 prefix-fanout=41.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=125.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=11.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC Started job on | Feb 14 00:43:15 Started mapping on | Feb 14 00:43:15 Finished on | Feb 14 00:43:36 Mapping speed, Million of reads per hour | 3422.91 Number of input reads | 19966949 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19191657 Uniquely mapped reads % | 96.12% Average mapped length | 98.42 Number of splices: Total | 5378495 Number of splices: Annotated (sjdb) | 5283527 Number of splices: GT/AG | 5296177 Number of splices: GC/AG | 64657 Number of splices: AT/AC | 6053 Number of splices: Non-canonical | 11608 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 1.66 Insertion rate per base | 0.02% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450074 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 173844 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 325218 325218 325218 N_multimapping 450074 450074 450074 N_noFeature 709601 10042599 9727650 N_ambiguous 196681 31750 34214 UnstrandedReadsAssigned:18285375 PositiveStrandReadsAssigned:9117308 NegativeStrandReadsAssigned:9429793 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473003 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473003-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,966,949 reads, 18,740,500 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR3473003.ke.tsv 34699 SRR3473003.se.tsv 87100 total ==> SRR3473003.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 666 25.6494 Potri.005G024800.1.v4.1 1035 936 62.0053 4.89588 Potri.004G059700.1.v4.1 961 862 23 1.97196 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 284.581 7.39527 Potri.016G087400.1.v4.1 270 171 1158 500.484 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 122 5.38619 Potri.012G127500.1.v4.1 977 878 3112 261.952 ==> SRR3473003.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2966 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 469 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3473003 completed mapping pipeline successfully