Starting /dee2/code/volunteer_pipeline.sh SRR3473004 current disk space = 3089116389376 free memory = 1547630136 SRR3473004 SRAfilesize 44a0b251f3495a872130ec8b5aad7790 SRR3473004.sra SRR3473004.sra file validated SRR3473004 is single end SRR3473004 is conventional basespace SRR3473004 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473004_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62625 34.0 31.0 34.0 30.0 34.0 2 32.182 34.0 31.0 34.0 30.0 34.0 3 32.58075 34.0 31.0 34.0 30.0 34.0 4 36.1515 37.0 35.0 37.0 35.0 37.0 5 36.14775 37.0 35.0 37.0 35.0 37.0 6 36.12125 37.0 36.0 37.0 35.0 37.0 7 36.086 37.0 36.0 37.0 35.0 37.0 8 36.0245 37.0 36.0 37.0 35.0 37.0 9 37.735 39.0 38.0 39.0 35.0 39.0 10-11 37.785125 39.0 38.0 39.0 35.0 39.0 12-13 37.629875 39.0 38.0 39.0 35.0 39.0 14-15 39.035125 41.0 39.0 41.0 36.0 41.0 16-17 39.099374999999995 41.0 39.0 41.0 36.0 41.0 18-19 39.089125 41.0 38.5 41.0 36.0 41.0 20-21 39.10025 41.0 39.0 41.0 35.5 41.0 22-23 39.082375 41.0 39.0 41.0 35.5 41.0 24-25 39.000625 41.0 39.0 41.0 35.5 41.0 26-27 38.76075 40.0 38.0 41.0 34.5 41.0 28-29 38.877 40.5 39.0 41.0 35.0 41.0 30-31 38.861999999999995 40.0 38.5 41.0 35.0 41.0 32-33 38.652875 40.0 38.0 41.0 34.0 41.0 34-35 38.733125 40.0 38.0 41.0 35.0 41.0 36-37 38.687375 40.0 38.0 41.0 34.0 41.0 38-39 38.522625000000005 40.0 38.0 41.0 34.0 41.0 40-41 38.567 40.0 38.0 41.0 34.0 41.0 42-43 38.462625 40.0 38.0 41.0 34.0 41.0 44-45 38.375125 40.0 38.0 41.0 33.5 41.0 46-47 38.298 40.0 38.0 41.0 34.0 41.0 48-49 38.19875 40.0 38.0 41.0 33.5 41.0 50-51 38.024875 40.0 38.0 41.0 33.0 41.0 52-53 37.93825 40.0 37.0 41.0 33.0 41.0 54-55 37.812125 40.0 37.0 41.0 33.0 41.0 56-57 37.55525 40.0 37.0 41.0 32.5 41.0 58-59 37.417 39.0 36.5 41.0 32.0 41.0 60-61 37.196125 39.0 36.0 41.0 32.0 41.0 62-63 36.926625 39.0 35.5 40.0 31.5 41.0 64-65 36.63525 38.0 35.0 40.0 31.0 41.0 66-67 36.563 38.0 35.0 40.0 31.0 41.0 68-69 36.399375 37.5 35.0 40.0 31.0 41.0 70-71 36.028125 37.0 35.0 39.0 31.0 41.0 72-73 35.584374999999994 37.0 35.0 39.0 31.0 41.0 74-75 35.070499999999996 36.0 34.5 39.0 30.0 40.0 76-77 34.758125 36.0 34.0 37.5 30.5 39.0 78-79 34.412375 35.0 34.0 37.0 30.0 39.0 80-81 34.128625 35.0 34.0 37.0 30.0 38.5 82-83 33.807375 35.0 34.0 36.0 30.0 37.0 84-85 33.570499999999996 35.0 34.0 36.0 30.0 37.0 86-87 33.338750000000005 35.0 34.0 35.5 30.0 36.5 88-89 33.135125 35.0 34.0 35.0 29.5 36.0 90-91 32.958749999999995 35.0 34.0 35.0 29.5 36.0 92-93 32.792625 35.0 34.0 35.0 29.0 36.0 94-95 32.752375 35.0 34.0 35.0 29.0 35.5 96-97 32.583625 35.0 34.0 35.0 29.0 35.0 98-99 32.456875 35.0 34.0 35.0 29.0 35.0 100 31.80825 35.0 32.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 0.0 10 1.0 11 5.0 12 4.0 13 4.0 14 4.0 15 4.0 16 1.0 17 5.0 18 4.0 19 4.0 20 5.0 21 11.0 22 7.0 23 10.0 24 8.0 25 21.0 26 27.0 27 23.0 28 48.0 29 52.0 30 55.0 31 61.0 32 83.0 33 97.0 34 165.0 35 226.0 36 409.0 37 887.0 38 1398.0 39 368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.390243902439025 13.145057766367138 17.68934531450578 44.775353016688065 2 18.05 23.225 36.325 22.400000000000002 3 20.674999999999997 24.55 27.224999999999998 27.55 4 22.8 32.525 20.9 23.775 5 25.124999999999996 33.650000000000006 23.325000000000003 17.9 6 19.475 36.35 24.5 19.675 7 16.2 18.675 44.5 20.625 8 18.6 24.224999999999998 29.625 27.55 9 19.5 22.875 31.825 25.8 10-11 22.4375 34.3125 22.537499999999998 20.7125 12-13 20.3625 26.2625 30.4 22.975 14-15 21.3875 27.8625 28.787499999999998 21.9625 16-17 21.95 27.8125 27.737499999999997 22.5 18-19 21.0125 28.1125 28.712500000000002 22.162499999999998 20-21 21.075 28.849999999999998 28.287499999999998 21.7875 22-23 20.8 29.912499999999998 27.3125 21.975 24-25 20.5 29.7125 27.775 22.0125 26-27 21.325 28.1875 27.625 22.8625 28-29 21.2875 28.175 28.249999999999996 22.287499999999998 30-31 20.45 28.0625 27.9375 23.549999999999997 32-33 20.849999999999998 29.5875 26.625 22.9375 34-35 22.1375 29.025000000000002 27.075 21.762500000000003 36-37 20.825 29.25 27.537499999999998 22.3875 38-39 20.7 29.2875 27.3125 22.7 40-41 21.2875 28.5875 28.349999999999998 21.775 42-43 20.925 28.249999999999996 28.8875 21.9375 44-45 21.925 27.987499999999997 27.5875 22.5 46-47 21.4375 27.737499999999997 28.849999999999998 21.975 48-49 21.6625 28.525 28.1125 21.7 50-51 21.4375 27.9125 28.175 22.475 52-53 21.637500000000003 28.3625 28.6125 21.3875 54-55 21.325 28.549999999999997 27.8125 22.3125 56-57 21.4 28.1625 28.4 22.037499999999998 58-59 21.175 27.825 28.212500000000002 22.787499999999998 60-61 21.5 27.5875 28.262500000000003 22.650000000000002 62-63 20.974999999999998 27.875 28.6125 22.537499999999998 64-65 21.4125 29.025000000000002 28.375 21.1875 66-67 22.3125 29.45 28.275 19.9625 68-69 22.0625 29.062500000000004 27.6625 21.212500000000002 70-71 21.775 28.4375 28.199999999999996 21.587500000000002 72-73 21.7875 28.575 27.925 21.712500000000002 74-75 21.325 28.9875 27.800000000000004 21.8875 76-77 22.237499999999997 28.125 27.6875 21.95 78-79 22.787499999999998 28.1375 27.237499999999997 21.837500000000002 80-81 21.587500000000002 28.537499999999998 27.6875 22.1875 82-83 22.25 28.1625 27.375 22.2125 84-85 20.902612826603324 28.853606700837602 27.86598324790599 22.377797224653083 86-87 21.7983991995998 28.976988494247124 27.03851925962982 22.18609304652326 88-89 22.255563890972745 28.419604901225306 27.344336084021002 21.980495123780948 90-91 21.552694086760845 28.753594199274907 27.415926990873857 22.277784723090384 92-93 22.2125 27.625 28.0875 22.075 94-95 22.5625 28.050000000000004 27.3875 22.0 96-97 21.0 29.012500000000003 28.0875 21.9 98-99 22.22777847230904 28.94111763970496 27.015876984623077 21.81522690336292 100 21.224999999999998 28.249999999999996 27.125 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 3.0 24 4.5 25 4.0 26 7.5 27 8.0 28 10.5 29 14.5 30 16.5 31 23.0 32 39.0 33 49.5 34 59.0 35 77.5 36 96.0 37 122.0 38 139.5 39 166.0 40 208.0 41 235.0 42 246.0 43 241.0 44 254.5 45 278.0 46 263.5 47 243.5 48 223.5 49 193.5 50 167.5 51 137.0 52 112.0 53 92.5 54 69.0 55 50.0 56 30.0 57 24.5 58 25.5 59 15.5 60 7.5 61 7.0 62 8.5 63 6.0 64 3.5 65 3.5 66 4.5 67 3.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.05 88-89 0.025 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77335683706875 99.05000000000001 2 0.17627801561319567 0.35000000000000003 3 0.0 0.0 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02518257365902795 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 20 0.5 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.75 0.0 0.0 0.0 0.0 80-81 0.8625 0.0 0.0 0.0 0.0 82-83 1.05 0.0 0.0 0.0 0.0 84-85 1.3375 0.0 0.0 0.0 0.0 86-87 1.6124999999999998 0.0 0.0 0.0 0.0 88 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723272 spots for SRR3473004.sra Written 723272 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra Read 723253 spots for SRR3473004.sra Written 723253 spots for SRR3473004.sra SRR ids: ['SRR3473004.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5zgeu2i7 SRR3473004.sra spots: 14465079 blocks: [[1, 723253], [723254, 1446506], [1446507, 2169759], [2169760, 2893012], [2893013, 3616265], [3616266, 4339518], [4339519, 5062771], [5062772, 5786024], [5786025, 6509277], [6509278, 7232530], [7232531, 7955783], [7955784, 8679036], [8679037, 9402289], [9402290, 10125542], [10125543, 10848795], [10848796, 11572048], [11572049, 12295301], [12295302, 13018554], [13018555, 13741807], [13741808, 14465079]] SRR3473004 file size 3951493 SRR3473004 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473004 SRR3473004_1.fastq Input file: SRR3473004_1.fastq trimmed: SRR3473004-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 00:38:11 2025 >> started Fri Feb 14 00:38:18 2025 >> done (7.276s) 14465079 reads processed; of these: 6557 ( 0.05%) short reads filtered out after trimming by size control 111363 ( 0.77%) empty reads filtered out after trimming by size control 14347159 (99.18%) reads available; of these: 853292 ( 5.95%) trimmed reads available after processing 13493867 (94.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 750 0.01% 19 896 0.01% 20 4431 0.03% 21 1243 0.01% 22 1190 0.01% 23 1656 0.01% 24 1815 0.01% 25 2115 0.01% 26 2212 0.02% 27 2054 0.01% 28 2146 0.01% 29 2974 0.02% 30 2426 0.02% 31 2417 0.02% 32 2452 0.02% 33 2346 0.02% 34 2605 0.02% 35 2677 0.02% 36 2801 0.02% 37 3029 0.02% 38 3197 0.02% 39 3295 0.02% 40 3428 0.02% 41 3715 0.03% 42 3906 0.03% 43 3910 0.03% 44 4217 0.03% 45 4351 0.03% 46 4588 0.03% 47 4803 0.03% 48 4944 0.03% 49 5288 0.04% 50 5519 0.04% 51 5520 0.04% 52 5639 0.04% 53 5853 0.04% 54 5845 0.04% 55 5898 0.04% 56 6146 0.04% 57 6187 0.04% 58 6600 0.05% 59 6703 0.05% 60 7033 0.05% 61 7382 0.05% 62 8010 0.06% 63 8747 0.06% 64 8061 0.06% 65 8162 0.06% 66 8380 0.06% 67 8905 0.06% 68 9549 0.07% 69 6915 0.05% 70 7456 0.05% 71 7632 0.05% 72 7970 0.06% 73 8013 0.06% 74 8253 0.06% 75 7981 0.06% 76 8406 0.06% 77 8808 0.06% 78 9477 0.07% 79 9833 0.07% 80 10588 0.07% 81 11159 0.08% 82 11502 0.08% 83 12051 0.08% 84 13054 0.09% 85 14409 0.10% 86 15226 0.11% 87 16619 0.12% 88 18137 0.13% 89 19415 0.14% 90 21590 0.15% 91 24166 0.17% 92 28177 0.20% 93 32251 0.22% 94 38028 0.27% 95 43943 0.31% 96 50276 0.35% 97 54162 0.38% 98 53423 0.37% 99 46356 0.32% 100 13493867 94.05% 14347159 reads passed initial QC criterion=sequence-density sequence-density=1.48 sequence-density-rank=1 fanout-score=58.55 fanout-score-rank=7 prefix-density=2.05 prefix-fanout=42.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAGAGCACACG criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=193.00 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=24.6 sequence=AAGAAGAAGAAA Started job on | Feb 14 00:38:36 Started mapping on | Feb 14 00:38:36 Finished on | Feb 14 00:38:52 Mapping speed, Million of reads per hour | 3228.11 Number of input reads | 14347159 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13768925 Uniquely mapped reads % | 95.97% Average mapped length | 98.26 Number of splices: Total | 3831020 Number of splices: Annotated (sjdb) | 3757255 Number of splices: GT/AG | 3771887 Number of splices: GC/AG | 46168 Number of splices: AT/AC | 4480 Number of splices: Non-canonical | 8485 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 1.66 Insertion rate per base | 0.02% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315200 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 125191 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 263034 263034 263034 N_multimapping 315200 315200 315200 N_noFeature 559724 7221431 6996366 N_ambiguous 162195 25095 26525 UnstrandedReadsAssigned:13047006 PositiveStrandReadsAssigned:6522399 NegativeStrandReadsAssigned:6746034 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473004 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473004-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,347,159 reads, 13,360,947 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR3473004.ke.tsv 34699 SRR3473004.se.tsv 87100 total ==> SRR3473004.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 631 32.5847 Potri.005G024800.1.v4.1 1035 936 66 6.98759 Potri.004G059700.1.v4.1 961 862 38 4.36853 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 165.537 5.76798 Potri.016G087400.1.v4.1 270 171 570 330.323 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 2.72309 Potri.012G127500.1.v4.1 977 878 3794 428.215 ==> SRR3473004.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1549 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 35 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3473004 completed mapping pipeline successfully