Starting /dee2/code/volunteer_pipeline.sh SRR3473005 current disk space = 3089080713216 free memory = 1569428468 SRR3473005 SRAfilesize d4a7e1d3918f4c97bc54bb54283f0910 SRR3473005.sra SRR3473005.sra file validated SRR3473005 is single end SRR3473005 is conventional basespace SRR3473005 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473005_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9125 34.0 31.0 34.0 30.0 34.0 2 32.33125 34.0 31.0 34.0 31.0 34.0 3 32.70775 34.0 31.0 34.0 31.0 34.0 4 36.216 37.0 37.0 37.0 35.0 37.0 5 36.278 37.0 37.0 37.0 35.0 37.0 6 36.17575 37.0 37.0 37.0 35.0 37.0 7 36.09475 37.0 36.0 37.0 35.0 37.0 8 36.07275 37.0 36.0 37.0 35.0 37.0 9 37.88225 39.0 38.0 39.0 35.0 39.0 10-11 37.922625 39.0 38.0 39.0 35.0 39.0 12-13 37.7465 39.0 38.0 39.0 35.0 39.0 14-15 39.211124999999996 41.0 39.0 41.0 36.0 41.0 16-17 39.255624999999995 41.0 39.0 41.0 36.0 41.0 18-19 39.2535 41.0 39.0 41.0 36.0 41.0 20-21 39.18675 41.0 39.0 41.0 35.5 41.0 22-23 39.243875 41.0 39.0 41.0 36.0 41.0 24-25 39.213875 41.0 39.0 41.0 36.0 41.0 26-27 38.89575 40.0 38.5 41.0 35.0 41.0 28-29 39.071125 41.0 39.0 41.0 36.0 41.0 30-31 38.972375 40.5 39.0 41.0 35.0 41.0 32-33 38.833124999999995 40.0 38.0 41.0 35.0 41.0 34-35 38.917500000000004 40.0 38.0 41.0 35.0 41.0 36-37 38.858374999999995 40.0 38.0 41.0 34.5 41.0 38-39 38.66 40.0 38.0 41.0 34.5 41.0 40-41 38.679249999999996 40.0 38.0 41.0 34.5 41.0 42-43 38.628375 40.0 38.0 41.0 34.5 41.0 44-45 38.501625 40.0 38.0 41.0 34.0 41.0 46-47 38.49912500000001 40.0 38.0 41.0 34.0 41.0 48-49 38.343875 40.0 38.0 41.0 34.0 41.0 50-51 38.293 40.0 38.0 41.0 34.0 41.0 52-53 38.0805 40.0 38.0 41.0 33.0 41.0 54-55 38.034125 40.0 37.5 41.0 33.0 41.0 56-57 37.851 40.0 37.0 41.0 33.0 41.0 58-59 37.62425 39.5 37.0 41.0 33.0 41.0 60-61 37.34075 39.0 36.0 41.0 32.0 41.0 62-63 37.122375000000005 39.0 36.0 40.5 31.5 41.0 64-65 36.71325 38.5 35.0 40.0 31.0 41.0 66-67 36.631 38.5 35.0 40.0 31.5 41.0 68-69 36.533375 37.5 35.0 40.0 32.0 41.0 70-71 36.21025 37.0 35.0 39.0 32.0 41.0 72-73 35.833749999999995 37.0 35.0 39.0 31.5 41.0 74-75 35.319375 36.0 35.0 39.0 31.0 40.0 76-77 35.070499999999996 36.0 35.0 37.0 31.0 39.0 78-79 34.687625 35.0 35.0 37.0 31.0 39.0 80-81 34.38875 35.0 34.0 36.5 31.0 38.5 82-83 34.050250000000005 35.0 34.0 36.0 31.0 37.0 84-85 33.806250000000006 35.0 34.0 36.0 31.0 37.0 86-87 33.611374999999995 35.0 34.0 35.5 30.5 36.5 88-89 33.37625 35.0 34.0 35.0 30.0 36.0 90-91 33.37025 35.0 34.0 35.0 30.5 36.0 92-93 33.265874999999994 35.0 34.0 35.0 30.0 36.0 94-95 33.198125000000005 35.0 34.0 35.0 31.0 35.0 96-97 32.968625 35.0 34.0 35.0 30.5 35.0 98-99 32.738375000000005 35.0 34.0 35.0 30.0 35.0 100 31.984 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 3.0 12 4.0 13 1.0 14 1.0 15 4.0 16 6.0 17 6.0 18 2.0 19 8.0 20 7.0 21 4.0 22 7.0 23 6.0 24 8.0 25 10.0 26 21.0 27 21.0 28 24.0 29 37.0 30 54.0 31 60.0 32 79.0 33 108.0 34 157.0 35 206.0 36 429.0 37 870.0 38 1504.0 39 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.168797953964194 13.554987212276215 15.089514066496163 47.18670076726343 2 19.375 22.2 37.75 20.674999999999997 3 21.05 27.0 27.025 24.925 4 23.575 32.725 19.975 23.724999999999998 5 24.05 35.449999999999996 22.400000000000002 18.099999999999998 6 18.175 39.125 23.525 19.175 7 15.275 19.25 44.275 21.2 8 18.9 24.2 29.175 27.725 9 19.85 23.45 32.5 24.2 10-11 22.5625 33.7375 22.5875 21.1125 12-13 20.424999999999997 27.212500000000002 29.875 22.4875 14-15 20.8125 27.5625 29.2875 22.3375 16-17 21.575 28.525 26.737499999999997 23.1625 18-19 21.3875 28.7375 28.275 21.6 20-21 21.8625 28.15 28.125 21.8625 22-23 21.325 28.95 27.5125 22.2125 24-25 21.25 28.9125 28.525 21.3125 26-27 21.5 28.775000000000002 27.975 21.75 28-29 21.462500000000002 28.5875 27.725 22.225 30-31 20.6875 29.575000000000003 27.3125 22.425 32-33 20.8 28.975 28.075 22.15 34-35 21.625 28.237499999999997 27.825 22.3125 36-37 21.7375 28.1375 27.737499999999997 22.3875 38-39 21.6 28.787499999999998 27.4125 22.2 40-41 21.15 28.849999999999998 27.925 22.075 42-43 22.175 28.249999999999996 27.9125 21.6625 44-45 21.925 28.762500000000003 27.787499999999998 21.525 46-47 21.987499999999997 29.975 27.187499999999996 20.849999999999998 48-49 21.837500000000002 28.975 27.3125 21.875 50-51 21.462500000000002 28.625 28.875 21.0375 52-53 21.7875 28.525 28.037499999999998 21.65 54-55 20.925 28.0625 28.1375 22.875 56-57 21.2875 29.1125 27.900000000000002 21.7 58-59 22.35 29.325000000000003 27.5125 20.8125 60-61 21.762500000000003 27.900000000000002 28.125 22.2125 62-63 21.637500000000003 28.512500000000003 28.15 21.7 64-65 22.0625 28.7375 27.1625 22.037499999999998 66-67 21.975 28.6125 27.85 21.5625 68-69 21.5 29.462500000000002 27.474999999999998 21.5625 70-71 22.525000000000002 27.8125 27.474999999999998 22.1875 72-73 22.037499999999998 28.675 27.825 21.462500000000002 74-75 21.475 28.487499999999997 28.037499999999998 22.0 76-77 21.65 29.1125 27.6625 21.575 78-79 20.974999999999998 28.95 27.287499999999998 22.787499999999998 80-81 21.912499999999998 28.287499999999998 27.675 22.125 82-83 21.5625 28.625 27.8375 21.975 84-85 21.587500000000002 28.475 28.3875 21.55 86-87 21.245467050143805 28.348130548955858 28.785794673002375 21.620607727897962 88-89 22.680670167541887 28.33208302075519 27.719429857464366 21.267816954238562 90-91 22.1375 27.8625 27.5125 22.4875 92-93 22.5125 28.749999999999996 27.3 21.4375 94-95 21.8125 29.5375 26.950000000000003 21.7 96-97 21.9 29.4125 26.8125 21.875 98-99 22.9375 27.537499999999998 28.050000000000004 21.475 100 23.025000000000002 27.35 27.400000000000002 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 6.5 27 8.5 28 9.5 29 14.0 30 24.5 31 36.5 32 45.0 33 53.0 34 67.0 35 83.0 36 101.5 37 115.5 38 133.5 39 158.0 40 189.0 41 221.0 42 244.0 43 265.5 44 266.5 45 265.5 46 270.0 47 243.0 48 211.0 49 194.0 50 157.5 51 132.0 52 120.5 53 101.0 54 71.0 55 41.0 56 37.5 57 30.0 58 20.5 59 15.0 60 7.5 61 5.5 62 6.0 63 6.0 64 3.5 65 1.5 66 2.0 67 2.0 68 0.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0375 88-89 0.025 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.8625 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.475 0.0 0.0 0.0 0.0 88 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636542 spots for SRR3473005.sra Written 636542 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra Read 636523 spots for SRR3473005.sra Written 636523 spots for SRR3473005.sra SRR ids: ['SRR3473005.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3d0arm31 SRR3473005.sra spots: 12730479 blocks: [[1, 636523], [636524, 1273046], [1273047, 1909569], [1909570, 2546092], [2546093, 3182615], [3182616, 3819138], [3819139, 4455661], [4455662, 5092184], [5092185, 5728707], [5728708, 6365230], [6365231, 7001753], [7001754, 7638276], [7638277, 8274799], [8274800, 8911322], [8911323, 9547845], [9547846, 10184368], [10184369, 10820891], [10820892, 11457414], [11457415, 12093937], [12093938, 12730479]] SRR3473005 file size 3476360 SRR3473005 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473005 SRR3473005_1.fastq Input file: SRR3473005_1.fastq trimmed: SRR3473005-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 00:59:46 2025 >> started Fri Feb 14 00:59:53 2025 >> done (6.505s) 12730479 reads processed; of these: 4037 ( 0.03%) short reads filtered out after trimming by size control 27204 ( 0.21%) empty reads filtered out after trimming by size control 12699238 (99.75%) reads available; of these: 687387 ( 5.41%) trimmed reads available after processing 12011851 (94.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 494 0.00% 19 555 0.00% 20 641 0.01% 21 736 0.01% 22 874 0.01% 23 1017 0.01% 24 1173 0.01% 25 1428 0.01% 26 1373 0.01% 27 1468 0.01% 28 1464 0.01% 29 1865 0.01% 30 1811 0.01% 31 1689 0.01% 32 1765 0.01% 33 1826 0.01% 34 1909 0.02% 35 1959 0.02% 36 2068 0.02% 37 2116 0.02% 38 2246 0.02% 39 2318 0.02% 40 2526 0.02% 41 2595 0.02% 42 2865 0.02% 43 2813 0.02% 44 3114 0.02% 45 3159 0.02% 46 3450 0.03% 47 3591 0.03% 48 3694 0.03% 49 3911 0.03% 50 3961 0.03% 51 4236 0.03% 52 4265 0.03% 53 4460 0.04% 54 4318 0.03% 55 4520 0.04% 56 4431 0.03% 57 4654 0.04% 58 4977 0.04% 59 5023 0.04% 60 5416 0.04% 61 5480 0.04% 62 5767 0.05% 63 5853 0.05% 64 6007 0.05% 65 6128 0.05% 66 6271 0.05% 67 6764 0.05% 68 7218 0.06% 69 5410 0.04% 70 5785 0.05% 71 5947 0.05% 72 6262 0.05% 73 6260 0.05% 74 6421 0.05% 75 6363 0.05% 76 6773 0.05% 77 7143 0.06% 78 7584 0.06% 79 7946 0.06% 80 8481 0.07% 81 9095 0.07% 82 9281 0.07% 83 10069 0.08% 84 10763 0.08% 85 11643 0.09% 86 12343 0.10% 87 13621 0.11% 88 14840 0.12% 89 16062 0.13% 90 17740 0.14% 91 20413 0.16% 92 23526 0.19% 93 27192 0.21% 94 32053 0.25% 95 37946 0.30% 96 42619 0.34% 97 46564 0.37% 98 46272 0.36% 99 40708 0.32% 100 12011851 94.59% 12699238 reads passed initial QC criterion=sequence-density sequence-density=1.46 sequence-density-rank=1 fanout-score=57.59 fanout-score-rank=4 prefix-density=2.03 prefix-fanout=41.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=143.78 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=20.9 sequence=AAAAGAAAAGAAAA Started job on | Feb 14 01:00:09 Started mapping on | Feb 14 01:00:10 Finished on | Feb 14 01:00:27 Mapping speed, Million of reads per hour | 2689.25 Number of input reads | 12699238 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 12199089 Uniquely mapped reads % | 96.06% Average mapped length | 98.36 Number of splices: Total | 3465780 Number of splices: Annotated (sjdb) | 3403732 Number of splices: GT/AG | 3411148 Number of splices: GC/AG | 42563 Number of splices: AT/AC | 3913 Number of splices: Non-canonical | 8156 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 1.59 Insertion rate per base | 0.02% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276244 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 122861 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.79% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 223905 223905 223905 N_multimapping 276244 276244 276244 N_noFeature 425578 6361880 6178691 N_ambiguous 123879 19591 20382 UnstrandedReadsAssigned:11649632 PositiveStrandReadsAssigned:5817618 NegativeStrandReadsAssigned:6000016 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473005 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473005-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,699,238 reads, 11,932,880 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR3473005.ke.tsv 34699 SRR3473005.se.tsv 87100 total ==> SRR3473005.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 379 21.2037 Potri.005G024800.1.v4.1 1035 936 64 7.34095 Potri.004G059700.1.v4.1 961 862 18 2.24188 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 189.13 7.13967 Potri.016G087400.1.v4.1 270 171 855 536.807 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 54.639 3.50425 Potri.012G127500.1.v4.1 977 878 2856 349.23 ==> SRR3473005.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1464 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473005 completed mapping pipeline successfully