Starting /dee2/code/volunteer_pipeline.sh SRR3473006 current disk space = 3089036812288 free memory = 1582291332 SRR3473006 SRAfilesize 1ec616da15a9e4f4d395ec293b414ce9 SRR3473006.sra SRR3473006.sra file validated SRR3473006 is single end SRR3473006 is conventional basespace SRR3473006 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473006_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9925 33.0 31.0 34.0 30.0 34.0 2 31.85275 34.0 31.0 34.0 30.0 34.0 3 30.732 34.0 31.0 34.0 25.0 34.0 4 34.4345 37.0 35.0 37.0 28.0 37.0 5 35.43625 37.0 35.0 37.0 33.0 37.0 6 35.8985 37.0 35.0 37.0 35.0 37.0 7 36.066 37.0 35.0 37.0 35.0 37.0 8 36.167 37.0 35.0 37.0 35.0 37.0 9 38.0465 39.0 38.0 39.0 35.0 39.0 10-11 38.0225 39.0 38.0 39.0 35.0 39.0 12-13 38.021 39.0 38.0 39.0 35.0 39.0 14-15 39.463125000000005 41.0 39.0 41.0 36.0 41.0 16-17 39.409625000000005 41.0 39.0 41.0 36.0 41.0 18-19 39.372125 41.0 39.0 41.0 36.0 41.0 20-21 39.217375000000004 40.5 39.0 41.0 36.0 41.0 22-23 39.251875 40.0 39.0 41.0 36.0 41.0 24-25 39.00475 40.0 39.0 41.0 35.5 41.0 26-27 39.03637500000001 40.0 39.0 41.0 35.5 41.0 28-29 38.883375 40.0 39.0 41.0 35.0 41.0 30-31 38.893125 40.0 38.0 41.0 35.0 41.0 32-33 38.81275 40.0 38.0 41.0 35.0 41.0 34-35 38.606125000000006 40.0 38.0 41.0 34.5 41.0 36-37 38.687375 40.0 38.0 41.0 35.0 41.0 38-39 38.814375 40.0 38.5 41.0 35.0 41.0 40-41 39.059749999999994 40.0 39.0 41.0 35.0 41.0 42-43 38.90537500000001 40.0 39.0 41.0 35.0 41.0 44-45 38.889624999999995 40.0 39.0 41.0 35.0 41.0 46-47 38.91625 40.0 38.5 41.0 35.0 41.0 48-49 38.777625 40.0 38.0 41.0 35.0 41.0 50-51 38.753 40.0 38.0 41.0 35.0 41.0 52-53 38.717875 40.0 38.0 41.0 35.0 41.0 54-55 38.514375 40.0 38.0 41.0 34.0 41.0 56-57 38.409375 40.0 38.0 41.0 34.0 41.0 58-59 38.192625 40.0 37.5 41.0 33.5 41.0 60-61 37.936 40.0 37.0 41.0 33.0 41.0 62-63 37.59525 39.5 36.5 41.0 32.5 41.0 64-65 37.456875 39.0 36.0 41.0 33.0 41.0 66-67 37.298875 39.0 36.0 41.0 32.5 41.0 68-69 37.025999999999996 39.0 35.5 40.5 32.5 41.0 70-71 36.601625 38.0 35.0 40.0 32.0 41.0 72-73 36.104875 37.0 35.0 39.5 31.5 41.0 74-75 35.66825 37.0 35.0 39.0 31.0 40.5 76-77 34.01975 35.0 33.0 37.5 28.5 39.0 78-79 34.733875 36.0 34.0 37.5 30.5 39.0 80-81 34.556875000000005 35.5 34.0 37.0 31.0 39.0 82-83 34.343625 35.0 34.0 37.0 31.0 39.0 84-85 33.98375 35.0 34.0 36.0 31.0 37.0 86-87 33.61024999999999 35.0 34.0 36.0 30.0 37.0 88-89 33.373999999999995 35.0 34.0 36.0 30.0 37.0 90-91 33.114875 35.0 34.0 35.0 30.0 36.0 92-93 32.865375 35.0 34.0 35.0 29.5 36.0 94-95 32.637625 35.0 34.0 35.0 29.0 36.0 96-97 32.4695 35.0 34.0 35.0 29.0 36.0 98-99 32.128375 35.0 34.0 35.0 29.0 36.0 100 31.70225 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.6598484659048296 1101 2 0.9822335025380724 1101 3 2.207284138931257 1101 4 1.8305743792353226 1101 5 0.8629941736890814 1101 6 0.5790177790002815 1101 7 0.47570703408267434 1101 8 0.1979320347078044 1101 9 0.12927908779474961 1101 10-11 0.182347278137577 1101 12-13 0.2258758220599617 1101 14-15 0.425883323747847 1101 16-17 0.2384536520717191 1101 18-19 0.20296441699382228 1101 20-21 0.12491560601135632 1101 22-23 0.2084218949263601 1101 24-25 0.30931959690930455 1101 26-27 0.39833962641593956 1101 28-29 0.32331649621164615 1101 30-31 0.38657447925783117 1101 32-33 0.3008927008576876 1101 34-35 0.22938286114376183 1101 36-37 0.2062026455952619 1101 38-39 0.2716173639068771 1101 40-41 0.3940261558850793 1101 42-43 0.3740341576854789 1101 44-45 0.28550173789102473 1101 46-47 0.1245905328698953 1101 48-49 0.26234027656222736 1101 50-51 0.2815696031607118 1101 52-53 0.31594608786977574 1101 54-55 0.4522830136780769 1101 56-57 0.3354317221374856 1101 58-59 0.2951539096296685 1101 60-61 0.11590732914905999 1101 62-63 0.017703983396266665 1101 64-65 0.2517253882123498 1101 66-67 0.3865057137856027 1101 68-69 0.46789277587457434 1101 70-71 0.4896414193193479 1101 72-73 0.4902853141956953 1101 74-75 0.2439173814108173 1101 76-77 0.06656497711984599 1101 78-79 0.4173501537846036 1101 80-81 0.5771173514040626 1101 82-83 0.46572353779600917 1101 84-85 0.3687767247630731 1101 86-87 0.2933472531319552 1101 88-89 0.2923470280813234 1101 90-91 0.20304568527919287 1101 92-93 0.08728213848115729 1101 94-95 0.24810582381035573 1101 96-97 0.28746467955290456 1101 98-99 0.2260946212897892 1101 100 0.15883573804105566 1106 1 -0.659848465904826 1106 2 -0.9822335025380688 1106 3 -2.2072841389312607 1106 4 -1.8305743792353297 1106 5 -0.8629941736890814 1106 6 -0.5790177790002744 1106 7 -0.47570703408266723 1106 8 -0.1979320347078115 1106 9 -0.12927908779475672 1106 10-11 -0.1823472781375841 1106 12-13 -0.2258758220599688 1106 14-15 -0.425883323747847 1106 16-17 -0.23845365207171199 1106 18-19 -0.20296441699382228 1106 20-21 -0.12491560601134921 1106 22-23 -0.2084218949263601 1106 24-25 -0.30931959690930455 1106 26-27 -0.39833962641593956 1106 28-29 -0.32331649621164615 1106 30-31 -0.3865744792578383 1106 32-33 -0.3008927008576947 1106 34-35 -0.22938286114376183 1106 36-37 -0.2062026455952619 1106 38-39 -0.2716173639068771 1106 40-41 -0.39402615588507217 1106 42-43 -0.3740341576854789 1106 44-45 -0.28550173789102473 1106 46-47 -0.1245905328698953 1106 48-49 -0.26234027656222736 1106 50-51 -0.2815696031607189 1106 52-53 -0.31594608786977574 1106 54-55 -0.4522830136780698 1106 56-57 -0.3354317221374856 1106 58-59 -0.2951539096296685 1106 60-61 -0.11590732914905288 1106 62-63 -0.017703983396266665 1106 64-65 -0.2517253882123498 1106 66-67 -0.3865057137856027 1106 68-69 -0.46789277587457434 1106 70-71 -0.4896414193193479 1106 72-73 -0.4902853141956953 1106 74-75 -0.2439173814108173 1106 76-77 -0.0665649771198531 1106 78-79 -0.4173501537846036 1106 80-81 -0.5771173514040697 1106 82-83 -0.46572353779600206 1106 84-85 -0.3687767247630731 1106 86-87 -0.2933472531319552 1106 88-89 -0.2923470280813163 1106 90-91 -0.20304568527918576 1106 92-93 -0.08728213848115729 1106 94-95 -0.24810582381036284 1106 96-97 -0.28746467955289745 1106 98-99 -0.2260946212897963 1106 100 -0.15883573804105922 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 5.0 18 3.0 19 9.0 20 6.0 21 5.0 22 16.0 23 15.0 24 19.0 25 13.0 26 14.0 27 29.0 28 25.0 29 39.0 30 58.0 31 61.0 32 88.0 33 101.0 34 164.0 35 222.0 36 352.0 37 765.0 38 1493.0 39 494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.384731290808638 17.67955801104972 21.320944249121045 36.61476644902059 2 18.875 26.35 40.075 14.7 3 20.575 29.875 29.425 20.125 4 23.075000000000003 34.2 23.7 19.025 5 20.9 37.724999999999994 26.150000000000002 15.225 6 16.35 39.375 28.475 15.8 7 14.149999999999999 17.224999999999998 50.375 18.25 8 17.299999999999997 26.200000000000003 32.574999999999996 23.925 9 18.875 24.725 34.275 22.125 10-11 19.650000000000002 37.75 25.45 17.150000000000002 12-13 17.3375 29.849999999999998 34.387499999999996 18.425 14-15 18.387500000000003 30.049999999999997 32.587500000000006 18.975 16-17 19.037499999999998 31.362499999999997 31.324999999999996 18.275 18-19 18.912499999999998 31.95 31.175000000000004 17.962500000000002 20-21 19.625 31.65 30.45 18.275 22-23 18.912499999999998 32.1625 30.15 18.775 24-25 19.5125 32.0 30.7375 17.75 26-27 19.5 31.4375 30.45 18.6125 28-29 19.7125 32.2 29.849999999999998 18.2375 30-31 19.55 31.35 30.5 18.6 32-33 20.0 32.0625 30.0 17.9375 34-35 19.25 31.2875 30.5 18.9625 36-37 18.8125 32.025 30.412499999999998 18.75 38-39 18.4875 31.587500000000002 30.5 19.425 40-41 19.3 31.8125 30.862499999999997 18.025 42-43 18.875 32.2 30.862499999999997 18.0625 44-45 19.3875 30.587500000000002 31.9625 18.0625 46-47 18.987499999999997 31.2875 31.5375 18.1875 48-49 18.575 31.75 30.562499999999996 19.112499999999997 50-51 18.637500000000003 31.35 31.924999999999997 18.087500000000002 52-53 18.099999999999998 30.775000000000002 31.825 19.3 54-55 18.712500000000002 31.2125 32.1 17.974999999999998 56-57 18.5625 31.362499999999997 31.9625 18.1125 58-59 18.787499999999998 31.1875 32.3875 17.6375 60-61 18.5 31.337500000000002 31.474999999999998 18.6875 62-63 18.1125 31.387500000000003 31.887500000000003 18.6125 64-65 17.599999999999998 31.7375 32.2875 18.375 66-67 18.712500000000002 31.2625 32.1375 17.8875 68-69 18.1125 31.525 30.887500000000003 19.475 70-71 18.6 31.0375 32.05 18.3125 72-73 18.587500000000002 31.0625 31.8125 18.5375 74-75 18.625 31.0125 32.775 17.5875 76-77 17.9125 31.087500000000002 31.7875 19.2125 78-79 17.7375 31.412499999999998 32.525 18.325 80-81 18.825 31.45 31.7125 18.0125 82-83 18.075 31.5125 31.7625 18.65 84-85 18.375 31.825 31.662499999999998 18.1375 86-87 18.0125 31.887500000000003 31.837500000000002 18.2625 88-89 18.125 32.7625 30.5375 18.575 90-91 18.15 32.7875 30.625000000000004 18.4375 92-93 18.575 31.912499999999998 31.5125 18.0 94-95 18.45 31.387500000000003 32.2125 17.95 96-97 17.2375 32.2125 32.375 18.175 98-99 18.4125 31.387500000000003 31.9875 18.212500000000002 100 18.825 32.05 30.575000000000003 18.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 2.0 2 5.0 3 5.5 4 4.5 5 5.5 6 6.5 7 5.0 8 2.0 9 2.0 10 3.5 11 3.0 12 2.0 13 3.5 14 5.0 15 5.5 16 10.5 17 14.5 18 13.0 19 7.0 20 3.0 21 5.5 22 6.0 23 11.5 24 18.5 25 22.0 26 26.0 27 40.5 28 63.5 29 86.5 30 114.0 31 130.0 32 164.5 33 197.0 34 205.0 35 227.0 36 246.0 37 256.0 38 237.5 39 228.0 40 226.5 41 209.5 42 182.0 43 156.5 44 146.0 45 121.0 46 114.5 47 105.5 48 76.0 49 52.5 50 44.0 51 37.0 52 34.0 53 33.0 54 20.0 55 11.5 56 6.5 57 4.5 58 3.5 59 3.0 60 2.5 61 2.0 62 2.5 63 1.5 64 1.5 65 1.0 66 1.5 67 1.5 68 2.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.69765066394281 96.625 2 0.9703779366700716 1.9 3 0.20429009193054137 0.6 4 0.02553626149131767 0.1 5 0.0 0.0 6 0.05107252298263534 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02553626149131767 0.22499999999999998 >10 0.02553626149131767 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTT 10 0.25 No Hit CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 9 0.22499999999999998 No Hit GAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTTTT 6 0.15 No Hit TTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495450 spots for SRR3473006.sra Written 495450 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra Read 495446 spots for SRR3473006.sra Written 495446 spots for SRR3473006.sra SRR ids: ['SRR3473006.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_79ppyyk7 SRR3473006.sra spots: 9908924 blocks: [[1, 495446], [495447, 990892], [990893, 1486338], [1486339, 1981784], [1981785, 2477230], [2477231, 2972676], [2972677, 3468122], [3468123, 3963568], [3963569, 4459014], [4459015, 4954460], [4954461, 5449906], [5449907, 5945352], [5945353, 6440798], [6440799, 6936244], [6936245, 7431690], [7431691, 7927136], [7927137, 8422582], [8422583, 8918028], [8918029, 9413474], [9413475, 9908924]] SRR3473006 file size 2577649 SRR3473006 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473006 SRR3473006_1.fastq Input file: SRR3473006_1.fastq trimmed: SRR3473006-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 01:08:40 2025 >> started Fri Feb 14 01:08:46 2025 >> done (5.681s) 9908924 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 9908924 (100.00%) reads available; of these: 632838 ( 6.39%) trimmed reads available after processing 9276086 (93.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 49 1 0.00% 50 0 0.00% 51 1744 0.02% 52 2430 0.02% 53 3001 0.03% 54 3450 0.03% 55 3906 0.04% 56 4396 0.04% 57 4812 0.05% 58 4978 0.05% 59 5309 0.05% 60 5920 0.06% 61 5966 0.06% 62 6335 0.06% 63 6461 0.07% 64 6652 0.07% 65 7107 0.07% 66 7170 0.07% 67 7408 0.07% 68 7316 0.07% 69 7679 0.08% 70 7789 0.08% 71 8184 0.08% 72 8314 0.08% 73 8634 0.09% 74 8993 0.09% 75 9153 0.09% 76 6506 0.07% 77 7291 0.07% 78 8076 0.08% 79 8490 0.09% 80 9091 0.09% 81 9447 0.10% 82 10070 0.10% 83 10437 0.11% 84 10949 0.11% 85 12042 0.12% 86 12498 0.13% 87 13270 0.13% 88 14553 0.15% 89 15967 0.16% 90 17124 0.17% 91 18961 0.19% 92 21173 0.21% 93 24102 0.24% 94 27164 0.27% 95 31250 0.32% 96 36656 0.37% 97 42515 0.43% 98 50754 0.51% 99 61344 0.62% 100 9276086 93.61% 9908924 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.3 sequence=AGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=734.06 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=28.5 sequence=TTTTTTTTTGACGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTT Started job on | Feb 14 01:09:04 Started mapping on | Feb 14 01:09:05 Finished on | Feb 14 01:09:20 Mapping speed, Million of reads per hour | 2378.14 Number of input reads | 9908924 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 9268517 Uniquely mapped reads % | 93.54% Average mapped length | 98.17 Number of splices: Total | 532543 Number of splices: Annotated (sjdb) | 456619 Number of splices: GT/AG | 476599 Number of splices: GC/AG | 7729 Number of splices: AT/AC | 713 Number of splices: Non-canonical | 47502 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.06% Deletion average length | 1.87 Insertion rate per base | 0.05% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213638 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 59188 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 426769 426769 426769 N_multimapping 213638 213638 213638 N_noFeature 558601 4687350 4966673 N_ambiguous 209018 18788 17588 UnstrandedReadsAssigned:8500898 PositiveStrandReadsAssigned:4562379 NegativeStrandReadsAssigned:4284256 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473006 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473006-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,908,924 reads, 9,058,678 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR3473006.ke.tsv 34699 SRR3473006.se.tsv 87100 total ==> SRR3473006.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 601 43.4149 Potri.005G024800.1.v4.1 1035 936 85 12.5887 Potri.004G059700.1.v4.1 961 862 57 9.16656 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 178.161 8.68402 Potri.016G087400.1.v4.1 270 171 115 93.2268 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 13 2.05252 ==> SRR3473006.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 213 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 530 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473006 completed mapping pipeline successfully