Starting /dee2/code/volunteer_pipeline.sh SRR3473007 current disk space = 3089100333056 free memory = 1531512424 SRR3473007 SRAfilesize 20480f0d4b02b365d2b4be227f0c9962 SRR3473007.sra SRR3473007.sra file validated SRR3473007 is single end SRR3473007 is conventional basespace SRR3473007 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473007_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1505 34.0 31.0 34.0 30.0 34.0 2 32.337 34.0 31.0 34.0 30.0 34.0 3 31.2755 34.0 31.0 34.0 27.0 34.0 4 34.768 37.0 35.0 37.0 30.0 37.0 5 35.7615 37.0 35.0 37.0 33.0 37.0 6 36.12925 37.0 35.0 37.0 35.0 37.0 7 36.26175 37.0 36.0 37.0 35.0 37.0 8 36.291 37.0 37.0 37.0 35.0 37.0 9 38.214 39.0 39.0 39.0 37.0 39.0 10-11 38.147499999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.15325 39.0 39.0 39.0 37.0 39.0 14-15 39.62975 41.0 40.0 41.0 37.0 41.0 16-17 39.59725 41.0 40.0 41.0 37.0 41.0 18-19 39.56125 41.0 40.0 41.0 37.0 41.0 20-21 39.44625 41.0 39.5 41.0 36.5 41.0 22-23 39.474500000000006 41.0 39.0 41.0 37.0 41.0 24-25 39.257374999999996 41.0 39.0 41.0 36.0 41.0 26-27 39.275875 41.0 39.0 41.0 36.0 41.0 28-29 39.2625 40.5 39.0 41.0 36.0 41.0 30-31 39.12425 40.0 39.0 41.0 36.0 41.0 32-33 39.0575 40.0 39.0 41.0 36.0 41.0 34-35 38.847125000000005 40.0 38.5 41.0 35.0 41.0 36-37 38.975750000000005 40.0 38.5 41.0 35.5 41.0 38-39 39.10125 40.5 39.0 41.0 35.5 41.0 40-41 39.303875000000005 41.0 39.0 41.0 36.0 41.0 42-43 39.296875 41.0 39.0 41.0 36.0 41.0 44-45 39.230125 41.0 39.0 41.0 36.0 41.0 46-47 39.055 40.5 39.0 41.0 35.0 41.0 48-49 39.1225 40.5 39.0 41.0 35.0 41.0 50-51 39.114875 40.0 39.0 41.0 35.0 41.0 52-53 38.972 40.0 39.0 41.0 35.0 41.0 54-55 38.882000000000005 40.0 39.0 41.0 35.0 41.0 56-57 38.7575 40.0 38.0 41.0 35.0 41.0 58-59 38.537875 40.0 38.0 41.0 34.5 41.0 60-61 38.390375000000006 40.0 37.5 41.0 34.0 41.0 62-63 38.049375 40.0 37.0 41.0 34.0 41.0 64-65 37.91525 39.5 37.0 41.0 34.0 41.0 66-67 37.693875000000006 39.0 36.0 41.0 34.0 41.0 68-69 37.416624999999996 39.0 36.0 40.5 33.5 41.0 70-71 37.09025 38.5 35.5 40.0 33.0 41.0 72-73 36.55775 37.5 35.0 39.5 32.5 41.0 74-75 36.0835 37.0 35.0 39.0 32.0 40.5 76-77 34.49425 35.5 33.5 37.5 29.5 39.0 78-79 35.12975 36.0 34.5 37.5 31.5 39.0 80-81 34.949875000000006 36.0 35.0 37.0 32.0 39.0 82-83 34.598749999999995 35.0 35.0 37.0 32.0 39.0 84-85 34.355875 35.0 34.5 36.0 32.0 37.0 86-87 34.022375 35.0 34.0 36.0 31.0 37.0 88-89 33.718500000000006 35.0 34.0 36.0 31.0 37.0 90-91 33.482875 35.0 34.0 35.5 31.0 36.0 92-93 33.202625 35.0 34.0 35.0 30.5 36.0 94-95 32.9975 35.0 34.0 35.0 30.5 36.0 96-97 32.819125 35.0 34.0 35.0 30.0 36.0 98-99 32.609375 35.0 34.0 35.0 30.0 36.0 100 32.19775 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.7577777777777825 1101 2 0.5499999999999972 1101 3 1.8977777777777796 1101 4 2.107777777777777 1101 5 0.6077777777777769 1101 6 0.19777777777778027 1101 7 0.16444444444444883 1101 8 0.08222222222222086 1101 9 -0.026666666666670835 1101 10-11 0.030000000000008242 1101 12-13 0.09111111111111114 1101 14-15 -0.07666666666666799 1101 16-17 -0.19000000000000483 1101 18-19 -0.21055555555555117 1101 20-21 -0.20611111111111313 1101 22-23 -0.020555555555560545 1101 24-25 -0.3838888888888903 1101 26-27 0.19388888888888545 1101 28-29 -0.10166666666666657 1101 30-31 -0.1538888888888863 1101 32-33 -0.09000000000000341 1101 34-35 -0.44388888888889255 1101 36-37 -0.2861111111111114 1101 38-39 -0.6266666666666652 1101 40-41 -0.16777777777777914 1101 42-43 0.2816666666666734 1101 44-45 -0.2505555555555503 1101 46-47 -0.3261111111111106 1101 48-49 -0.3077777777777797 1101 50-51 -0.1411111111111083 1101 52-53 -0.08444444444445054 1101 54-55 -0.20666666666667055 1101 56-57 -0.04555555555555202 1101 58-59 -0.10722222222222655 1101 60-61 -0.2305555555555543 1101 62-63 -0.4611111111111086 1101 64-65 -0.301111111111112 1101 66-67 -0.18111111111111455 1101 68-69 -0.04777777777777459 1101 70-71 -0.061666666666667425 1101 72-73 0.05277777777778425 1101 74-75 0.42166666666667396 1101 76-77 -0.07833333333333314 1101 78-79 -0.16111111111111143 1101 80-81 0.43777777777778226 1101 82-83 0.5700000000000074 1101 84-85 0.20611111111111313 1101 86-87 0.3427777777777692 1101 88-89 0.15277777777777857 1101 90-91 0.05611111111110745 1101 92-93 -0.2305555555555472 1101 94-95 0.12222222222222001 1101 96-97 0.0322222222222166 1101 98-99 -0.13555555555555543 1101 100 -0.14000000000000057 1105 1 -0.06222222222221774 1105 2 -0.10500000000000398 1105 3 -1.1422222222222196 1105 4 -0.467222222222226 1105 5 0.03277777777777402 1105 6 0.10777777777777686 1105 7 0.07444444444445253 1105 8 0.17222222222221717 1105 9 0.14333333333332376 1105 10-11 0.240000000000002 1105 12-13 0.06611111111110546 1105 14-15 0.33833333333333115 1105 16-17 0.22999999999999687 1105 18-19 0.391944444444448 1105 20-21 0.07138888888888317 1105 22-23 -0.13805555555556026 1105 24-25 0.25361111111111256 1105 26-27 -0.05361111111111683 1105 28-29 0.20583333333333798 1105 30-31 0.20861111111111086 1105 32-33 0.03999999999999915 1105 34-35 0.4886111111111049 1105 36-37 0.481388888888894 1105 38-39 0.6083333333333343 1105 40-41 0.34722222222222143 1105 42-43 -0.13583333333333059 1105 44-45 0.2069444444444528 1105 46-47 0.42638888888888715 1105 48-49 0.21222222222222342 1105 50-51 0.07888888888889056 1105 52-53 0.1255555555555503 1105 54-55 0.27333333333333343 1105 56-57 0.059444444444444855 1105 58-59 -0.23472222222222427 1105 60-61 0.05694444444444002 1105 62-63 0.0038888888888877204 1105 64-65 0.0738888888888809 1105 66-67 0.2538888888888877 1105 68-69 -0.137777777777778 1105 70-71 -0.06416666666666515 1105 72-73 0.030277777777776294 1105 74-75 -0.17083333333332718 1105 76-77 0.06416666666666515 1105 78-79 0.34388888888889113 1105 80-81 -0.41222222222222626 1105 82-83 -0.49499999999999744 1105 84-85 -0.07638888888888573 1105 86-87 -0.4347222222222271 1105 88-89 -0.4797222222222217 1105 90-91 -0.4663888888888934 1105 92-93 -0.223055555555554 1105 94-95 -0.4327777777777726 1105 96-97 -0.3627777777777865 1105 98-99 -0.32555555555556026 1105 100 -0.23000000000000043 1106 1 -0.6955555555555506 1106 2 -0.4450000000000003 1106 3 -0.7555555555555529 1106 4 -1.640555555555558 1106 5 -0.640555555555558 1106 6 -0.30555555555555713 1106 7 -0.23888888888888005 1106 8 -0.25444444444444514 1106 9 -0.11666666666667425 1106 10-11 -0.269999999999996 1106 12-13 -0.1572222222222237 1106 14-15 -0.26166666666667027 1106 16-17 -0.03999999999999915 1106 18-19 -0.1813888888888826 1106 20-21 0.13472222222222285 1106 22-23 0.1586111111111066 1106 24-25 0.13027777777778482 1106 26-27 -0.14027777777778283 1106 28-29 -0.1041666666666643 1106 30-31 -0.05472222222222456 1106 32-33 0.04999999999999005 1106 34-35 -0.04472222222222655 1106 36-37 -0.19527777777777544 1106 38-39 0.018333333333337976 1106 40-41 -0.1794444444444423 1106 42-43 -0.1458333333333286 1106 44-45 0.04361111111111171 1106 46-47 -0.10027777777778368 1106 48-49 0.09555555555555628 1106 50-51 0.06222222222222484 1106 52-53 -0.041111111111113985 1106 54-55 -0.06666666666666998 1106 56-57 -0.013888888888885731 1106 58-59 0.3419444444444366 1106 60-61 0.17361111111111427 1106 62-63 0.45722222222222086 1106 64-65 0.22722222222221689 1106 66-67 -0.07277777777778027 1106 68-69 0.1855555555555597 1106 70-71 0.12583333333333258 1106 72-73 -0.08305555555555344 1106 74-75 -0.2508333333333326 1106 76-77 0.014166666666667993 1106 78-79 -0.1827777777777726 1106 80-81 -0.025555555555555998 1106 82-83 -0.07499999999999574 1106 84-85 -0.1297222222222203 1106 86-87 0.09194444444443661 1106 88-89 0.32694444444445026 1106 90-91 0.41027777777777175 1106 92-93 0.4536111111111154 1106 94-95 0.3105555555555526 1106 96-97 0.3305555555555557 1106 98-99 0.4611111111111086 1106 100 0.36999999999999744 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 3.0 18 6.0 19 5.0 20 4.0 21 7.0 22 8.0 23 7.0 24 8.0 25 17.0 26 15.0 27 17.0 28 35.0 29 25.0 30 45.0 31 53.0 32 67.0 33 83.0 34 119.0 35 184.0 36 340.0 37 763.0 38 1698.0 39 488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.765120967741936 16.885080645161292 21.09375 38.256048387096776 2 18.85 26.474999999999998 39.425 15.25 3 21.099999999999998 29.65 28.95 20.3 4 21.75 35.4 23.724999999999998 19.125 5 20.849999999999998 37.85 26.25 15.049999999999999 6 15.625 39.5 28.725 16.150000000000002 7 12.75 18.325 51.275000000000006 17.65 8 18.175 25.650000000000002 32.800000000000004 23.375 9 18.35 24.25 35.8 21.6 10-11 19.8375 38.25 24.224999999999998 17.6875 12-13 17.474999999999998 29.812499999999996 34.3125 18.4 14-15 18.5 30.049999999999997 32.7 18.75 16-17 19.6875 30.049999999999997 31.25 19.0125 18-19 19.400000000000002 30.9375 30.3875 19.275000000000002 20-21 20.125 31.662499999999998 29.6375 18.575 22-23 19.05 31.0375 31.337500000000002 18.575 24-25 19.4375 31.662499999999998 29.862499999999997 19.037499999999998 26-27 19.075 33.125 30.312499999999996 17.4875 28-29 19.0875 31.6875 30.412499999999998 18.8125 30-31 19.425 31.9875 30.7875 17.8 32-33 19.975 31.137500000000003 29.5 19.3875 34-35 18.575 31.25 30.7625 19.412499999999998 36-37 19.2625 31.912499999999998 30.425 18.4 38-39 19.9875 31.7875 29.2375 18.987499999999997 40-41 19.3375 31.574999999999996 29.612500000000004 19.475 42-43 19.375 31.6875 30.525000000000002 18.4125 44-45 18.825 30.7875 31.125000000000004 19.2625 46-47 18.6875 30.837500000000002 31.374999999999996 19.1 48-49 18.775 32.0 30.1375 19.0875 50-51 18.925 30.662499999999998 30.85 19.5625 52-53 18.9375 31.724999999999998 30.75 18.587500000000002 54-55 19.662499999999998 31.412499999999998 30.4625 18.462500000000002 56-57 18.925 31.924999999999997 30.3875 18.7625 58-59 19.3 30.7625 30.95 18.987499999999997 60-61 19.5625 31.474999999999998 30.3 18.6625 62-63 19.075 30.7625 31.35 18.8125 64-65 19.037499999999998 30.825000000000003 30.4875 19.650000000000002 66-67 18.6625 32.025 31.137500000000003 18.175 68-69 19.6125 30.85 31.2 18.337500000000002 70-71 18.45 32.074999999999996 30.362499999999997 19.112499999999997 72-73 19.787499999999998 30.45 31.337500000000002 18.425 74-75 19.037499999999998 30.95 31.175000000000004 18.8375 76-77 18.275 31.65 30.7625 19.3125 78-79 18.75 31.724999999999998 29.875 19.650000000000002 80-81 18.7625 31.674999999999997 30.825000000000003 18.7375 82-83 19.0125 31.225 30.55 19.2125 84-85 19.3625 31.95 29.575000000000003 19.112499999999997 86-87 17.6375 33.3125 30.3 18.75 88-89 19.525000000000002 30.975 31.225 18.275 90-91 19.025 31.4625 30.9625 18.55 92-93 19.425 31.387500000000003 31.087500000000002 18.099999999999998 94-95 18.65 31.0 31.5 18.85 96-97 18.275 32.5 29.95 19.275000000000002 98-99 19.3 32.300000000000004 30.312499999999996 18.087500000000002 100 18.575 32.525 30.25 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 3.0 2 3.5 3 2.0 4 1.0 5 1.5 6 4.5 7 4.0 8 1.5 9 0.5 10 0.0 11 0.5 12 0.5 13 2.0 14 3.0 15 3.0 16 2.5 17 1.5 18 4.5 19 5.5 20 4.0 21 4.0 22 7.5 23 12.0 24 10.5 25 13.0 26 25.5 27 40.0 28 54.5 29 68.0 30 98.5 31 133.0 32 164.5 33 190.5 34 204.5 35 211.0 36 234.0 37 243.0 38 246.0 39 246.5 40 248.0 41 234.5 42 200.5 43 172.5 44 152.0 45 137.0 46 112.5 47 104.5 48 87.5 49 66.5 50 49.5 51 44.0 52 40.0 53 30.0 54 19.5 55 11.5 56 8.0 57 6.0 58 5.5 59 4.5 60 2.0 61 2.0 62 2.0 63 1.5 64 1.5 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.7313997477931904 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025220680958385876 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558343 spots for SRR3473007.sra Written 558343 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra Read 558338 spots for SRR3473007.sra Written 558338 spots for SRR3473007.sra SRR ids: ['SRR3473007.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oyqqtf4w SRR3473007.sra spots: 11166765 blocks: [[1, 558338], [558339, 1116676], [1116677, 1675014], [1675015, 2233352], [2233353, 2791690], [2791691, 3350028], [3350029, 3908366], [3908367, 4466704], [4466705, 5025042], [5025043, 5583380], [5583381, 6141718], [6141719, 6700056], [6700057, 7258394], [7258395, 7816732], [7816733, 8375070], [8375071, 8933408], [8933409, 9491746], [9491747, 10050084], [10050085, 10608422], [10608423, 11166765]] SRR3473007 file size 2906134 SRR3473007 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473007 SRR3473007_1.fastq Input file: SRR3473007_1.fastq trimmed: SRR3473007-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 00:48:57 2025 >> started Fri Feb 14 00:49:02 2025 >> done (5.588s) 11166765 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 11166765 (100.00%) reads available; of these: 634091 ( 5.68%) trimmed reads available after processing 10532674 (94.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1592 0.01% 52 2228 0.02% 53 2697 0.02% 54 3165 0.03% 55 3597 0.03% 56 4134 0.04% 57 4301 0.04% 58 4607 0.04% 59 5141 0.05% 60 5250 0.05% 61 5584 0.05% 62 5523 0.05% 63 5834 0.05% 64 6116 0.05% 65 6350 0.06% 66 6459 0.06% 67 6638 0.06% 68 6687 0.06% 69 7083 0.06% 70 7154 0.06% 71 7383 0.07% 72 7847 0.07% 73 7928 0.07% 74 8568 0.08% 75 8628 0.08% 76 5891 0.05% 77 6585 0.06% 78 7411 0.07% 79 7914 0.07% 80 8282 0.07% 81 8760 0.08% 82 9368 0.08% 83 9843 0.09% 84 10574 0.09% 85 11395 0.10% 86 12023 0.11% 87 13120 0.12% 88 14455 0.13% 89 15691 0.14% 90 17079 0.15% 91 19178 0.17% 92 21551 0.19% 93 24626 0.22% 94 28210 0.25% 95 32717 0.29% 96 39363 0.35% 97 45987 0.41% 98 54949 0.49% 99 68625 0.61% 100 10532674 94.32% 11166765 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=8.04 fanout-score-rank=16 prefix-density=0.46 prefix-fanout=4.9 sequence=AACATCAAAACCAGACCAAACCCCACCAAATTTCATCTCAAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=205.01 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=19.0 sequence=AAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCTTTGTTGGTTCCATTCCATGGAA Started job on | Feb 14 00:49:20 Started mapping on | Feb 14 00:49:20 Finished on | Feb 14 00:49:36 Mapping speed, Million of reads per hour | 2512.52 Number of input reads | 11166765 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10564510 Uniquely mapped reads % | 94.61% Average mapped length | 98.30 Number of splices: Total | 771095 Number of splices: Annotated (sjdb) | 655945 Number of splices: GT/AG | 683959 Number of splices: GC/AG | 11692 Number of splices: AT/AC | 1183 Number of splices: Non-canonical | 74261 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.06% Deletion average length | 1.86 Insertion rate per base | 0.05% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231104 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 56730 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 371151 371151 371151 N_multimapping 231104 231104 231104 N_noFeature 604792 5385570 5592733 N_ambiguous 233868 22220 21130 UnstrandedReadsAssigned:9725850 PositiveStrandReadsAssigned:5156720 NegativeStrandReadsAssigned:4950647 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473007 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473007-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,166,765 reads, 10,230,945 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR3473007.ke.tsv 34699 SRR3473007.se.tsv 87100 total ==> SRR3473007.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 773 50.9977 Potri.005G024800.1.v4.1 1035 936 182 24.6174 Potri.004G059700.1.v4.1 961 862 54 7.93109 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 82 3.65032 Potri.016G087400.1.v4.1 270 171 98 72.5565 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 122 17.5919 ==> SRR3473007.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 139 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 482 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 47 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473007 completed mapping pipeline successfully