Starting /dee2/code/volunteer_pipeline.sh SRR3473008 current disk space = 3089204330496 free memory = 1439543836 SRR3473008 SRAfilesize 6ae18493c1e0b1324b99d8a518151215 SRR3473008.sra SRR3473008.sra file validated SRR3473008 is single end SRR3473008 is conventional basespace SRR3473008 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473008_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4205 34.0 31.0 34.0 31.0 34.0 2 32.69375 34.0 31.0 34.0 31.0 34.0 3 32.02325 34.0 31.0 34.0 30.0 34.0 4 35.95575 37.0 35.0 37.0 35.0 37.0 5 36.0985 37.0 35.0 37.0 35.0 37.0 6 36.166 37.0 36.0 37.0 35.0 37.0 7 36.17525 37.0 36.0 37.0 35.0 37.0 8 36.1585 37.0 36.0 37.0 35.0 37.0 9 38.071 39.0 38.0 39.0 35.0 39.0 10-11 37.980375 39.0 38.0 39.0 36.0 39.0 12-13 37.97425 39.0 38.0 39.0 35.0 39.0 14-15 39.367875 41.0 39.0 41.0 36.0 41.0 16-17 39.314750000000004 41.0 39.0 41.0 36.0 41.0 18-19 39.187125 41.0 39.0 41.0 36.0 41.0 20-21 39.173500000000004 40.5 39.0 41.0 35.5 41.0 22-23 39.205124999999995 40.0 39.0 41.0 36.0 41.0 24-25 39.004125 40.0 39.0 41.0 35.0 41.0 26-27 38.95675 40.0 38.5 41.0 35.0 41.0 28-29 38.873625000000004 40.0 38.0 41.0 35.0 41.0 30-31 38.841875 40.0 38.0 41.0 35.0 41.0 32-33 38.74375 40.0 38.0 41.0 35.0 41.0 34-35 38.430875 40.0 38.0 41.0 34.0 41.0 36-37 38.613249999999994 40.0 38.0 41.0 34.5 41.0 38-39 38.75475 40.0 38.0 41.0 35.0 41.0 40-41 39.02525 40.0 39.0 41.0 35.0 41.0 42-43 38.999624999999995 40.0 39.0 41.0 35.0 41.0 44-45 38.73025 40.0 38.0 41.0 35.0 41.0 46-47 38.848875 40.0 38.0 41.0 35.0 41.0 48-49 38.63525 40.0 38.0 41.0 34.0 41.0 50-51 38.707125000000005 40.0 38.0 41.0 34.5 41.0 52-53 38.614000000000004 40.0 38.0 41.0 34.5 41.0 54-55 38.47 40.0 38.0 41.0 34.0 41.0 56-57 38.44 40.0 38.0 41.0 34.0 41.0 58-59 38.159375 40.0 37.5 41.0 33.5 41.0 60-61 37.941 40.0 37.0 41.0 33.0 41.0 62-63 37.55275 39.5 37.0 41.0 32.5 41.0 64-65 37.44225 39.0 36.0 41.0 32.5 41.0 66-67 37.332375 39.0 36.0 41.0 32.5 41.0 68-69 36.939625 39.0 35.5 40.0 32.0 41.0 70-71 36.601 38.0 35.0 40.0 32.0 41.0 72-73 36.153625 37.0 35.0 39.5 31.0 41.0 74-75 35.660875000000004 37.0 35.0 39.0 31.0 41.0 76-77 33.954375 35.0 33.0 37.5 28.5 39.0 78-79 34.691 36.0 34.0 37.5 30.0 39.0 80-81 34.610375 35.5 34.0 37.0 30.5 39.0 82-83 34.313375 35.0 34.0 37.0 31.0 39.0 84-85 34.019375 35.0 34.0 36.0 30.0 37.0 86-87 33.658874999999995 35.0 34.0 36.0 30.0 37.0 88-89 33.51875 35.0 34.0 36.0 30.0 37.0 90-91 33.340625 35.0 34.0 35.0 30.0 36.0 92-93 33.061875 35.0 34.0 35.0 29.5 36.0 94-95 32.81625 35.0 34.0 35.0 29.0 36.0 96-97 32.66 35.0 34.0 35.0 29.5 36.0 98-99 32.359125000000006 35.0 34.0 35.0 29.0 36.0 100 32.0135 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.3943012177740002 1101 2 0.22372533820109908 1101 3 1.0164161936435718 1101 4 0.37552199244829865 1101 5 0.29386611987697364 1101 6 0.1959315846065408 1101 7 0.19100547623214936 1101 8 0.2563951889175087 1101 9 0.28096321672376234 1101 10-11 0.0875634517766457 1101 12-13 0.1627616213648082 1101 14-15 0.08958265609761895 1101 16-17 0.15595383961391462 1101 18-19 0.3186154384736568 1101 20-21 -0.025461978945259034 1101 22-23 -0.012290265309694348 1101 24-25 -0.1401815408466902 1101 26-27 0.05924458003050859 1101 28-29 0.026062113975640955 1101 30-31 -0.15592258258108416 1101 32-33 0.23817233877622357 1101 34-35 0.07698607186616613 1101 36-37 -0.010171038483662187 1101 38-39 -0.0962841639368861 1101 40-41 0.25982721112250573 1101 42-43 0.254394738816238 1101 44-45 0.1390875446975528 1101 46-47 0.37998549673676507 1101 48-49 0.1522592583331246 1101 50-51 0.19740066514965804 1101 52-53 0.3993648570928485 1101 54-55 0.04717311395064172 1101 56-57 0.17398914755820272 1101 58-59 0.261308794478758 1101 60-61 0.1788464904603515 1101 62-63 -0.055618764221947004 1101 64-65 -0.2047023080193071 1101 66-67 -0.07970543372258732 1101 68-69 0.06697131854667049 1101 70-71 0.11866419944487205 1101 72-73 0.18980520617138552 1101 74-75 0.18309119551899045 1101 76-77 -0.1276787277137359 1101 78-79 -0.08578805231177 1101 80-81 0.09630291815658865 1101 82-83 0.14080043009677468 1101 84-85 0.1626678502663097 1101 86-87 0.16973819109299626 1101 88-89 0.10839938986271846 1101 90-91 0.02563076692256061 1101 92-93 0.09649046035357856 1101 94-95 -0.25207546698007377 1101 96-97 0.08608186842039345 1101 98-99 0.10808681953439248 1101 100 -0.07899277337401145 1105 1 -0.3943012177740002 1105 2 -0.22372533820109197 1105 3 -1.0164161936435683 1105 4 -0.37552199244829865 1105 5 -0.29386611987697364 1105 6 -0.1959315846065337 1105 7 -0.19100547623215647 1105 8 -0.25639518891750157 1105 9 -0.28096321672376234 1105 10-11 -0.08756345177665281 1105 12-13 -0.1627616213648082 1105 14-15 -0.08958265609762606 1105 16-17 -0.15595383961391462 1105 18-19 -0.3186154384736568 1105 20-21 0.02546197894526614 1105 22-23 0.012290265309694348 1105 24-25 0.1401815408466902 1105 26-27 -0.05924458003050859 1105 28-29 -0.026062113975640955 1105 30-31 0.15592258258107705 1105 32-33 -0.23817233877622357 1105 34-35 -0.07698607186616613 1105 36-37 0.010171038483655082 1105 38-39 0.0962841639368861 1105 40-41 -0.2598272111224986 1105 42-43 -0.254394738816238 1105 44-45 -0.1390875446975528 1105 46-47 -0.37998549673676507 1105 48-49 -0.1522592583331246 1105 50-51 -0.19740066514965804 1105 52-53 -0.3993648570928485 1105 54-55 -0.04717311395064172 1105 56-57 -0.1739891475581956 1105 58-59 -0.261308794478758 1105 60-61 -0.1788464904603515 1105 62-63 0.055618764221947004 1105 64-65 0.2047023080193071 1105 66-67 0.07970543372258021 1105 68-69 -0.06697131854667049 1105 70-71 -0.11866419944487916 1105 72-73 -0.18980520617139263 1105 74-75 -0.18309119551899045 1105 76-77 0.1276787277137359 1105 78-79 0.0857880523117629 1105 80-81 -0.09630291815658154 1105 82-83 -0.14080043009677468 1105 84-85 -0.1626678502663097 1105 86-87 -0.16973819109299626 1105 88-89 -0.10839938986271846 1105 90-91 -0.025630766922553505 1105 92-93 -0.09649046035357856 1105 94-95 0.25207546698007377 1105 96-97 -0.08608186842039345 1105 98-99 -0.10808681953439958 1105 100 0.07899277337401145 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 3.0 18 5.0 19 7.0 20 5.0 21 9.0 22 13.0 23 8.0 24 13.0 25 11.0 26 17.0 27 16.0 28 37.0 29 47.0 30 69.0 31 71.0 32 90.0 33 106.0 34 142.0 35 192.0 36 311.0 37 807.0 38 1531.0 39 487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.729240060392552 17.639657775541018 20.105686965274284 38.52541519879215 2 19.15 25.7 40.475 14.674999999999999 3 20.0 30.075000000000003 30.775000000000002 19.15 4 20.674999999999997 37.0 23.925 18.4 5 21.26594946209657 37.17788341255942 25.31898924193145 16.23717788341256 6 17.1 39.25 27.55 16.1 7 13.475000000000001 17.525 50.475 18.525 8 18.325 24.6 33.35 23.724999999999998 9 17.325 24.175 36.55 21.95 10-11 19.8 37.6125 24.875 17.712500000000002 12-13 18.5625 28.775000000000002 33.625 19.037499999999998 14-15 18.75 29.6375 33.287499999999994 18.325 16-17 18.8875 31.112499999999997 31.45 18.55 18-19 20.0125 31.2375 30.425 18.325 20-21 19.112499999999997 31.5625 30.349999999999998 18.975 22-23 19.6875 31.137500000000003 30.587500000000002 18.587500000000002 24-25 19.2375 30.75 30.8 19.2125 26-27 19.6 31.912499999999998 30.3 18.1875 28-29 19.7375 32.2125 29.812499999999996 18.2375 30-31 19.287499999999998 31.2625 30.4625 18.987499999999997 32-33 19.725 31.4375 30.062499999999996 18.775 34-35 19.287499999999998 32.15 30.1375 18.425 36-37 18.637500000000003 31.362499999999997 31.2125 18.787499999999998 38-39 19.525000000000002 31.1875 30.575000000000003 18.712500000000002 40-41 18.475 31.2375 30.55 19.7375 42-43 20.0125 31.2375 30.1875 18.5625 44-45 19.787499999999998 31.4375 29.7875 18.987499999999997 46-47 20.05 30.575000000000003 30.112499999999997 19.2625 48-49 18.512500000000003 31.4 31.162499999999998 18.925 50-51 19.175 31.4875 30.6875 18.65 52-53 19.2375 31.2 30.837500000000002 18.725 54-55 19.2 31.175000000000004 30.6875 18.9375 56-57 19.375 30.3875 31.374999999999996 18.862499999999997 58-59 19.8875 30.95 30.8 18.3625 60-61 18.85 31.0125 31.525 18.6125 62-63 18.712500000000002 31.175000000000004 31.424999999999997 18.6875 64-65 19.112499999999997 30.5125 30.975 19.400000000000002 66-67 18.925 31.837500000000002 30.7625 18.475 68-69 19.2125 31.2875 30.975 18.525 70-71 19.1 30.2 31.112499999999997 19.5875 72-73 18.575 31.887500000000003 30.9875 18.55 74-75 18.5375 32.6625 30.775000000000002 18.025 76-77 18.9375 30.125 31.7125 19.225 78-79 19.575 30.525000000000002 31.45 18.45 80-81 19.3125 31.162499999999998 31.125000000000004 18.4 82-83 18.775 31.374999999999996 30.5375 19.3125 84-85 18.5375 31.924999999999997 30.362499999999997 19.175 86-87 18.6125 31.624999999999996 31.674999999999997 18.087500000000002 88-89 18.925 30.85 32.074999999999996 18.15 90-91 19.2125 31.275 30.8125 18.7 92-93 18.175 31.137500000000003 31.3 19.3875 94-95 17.875 33.1625 30.5 18.462500000000002 96-97 19.05 31.825 30.412499999999998 18.712500000000002 98-99 18.1375 31.525 31.2125 19.125 100 18.975 30.55 32.574999999999996 17.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 4.0 2 4.0 3 1.5 4 1.0 5 1.5 6 1.5 7 3.0 8 2.5 9 1.0 10 2.0 11 1.5 12 0.5 13 2.0 14 3.0 15 3.0 16 4.5 17 5.0 18 7.5 19 7.0 20 3.0 21 3.0 22 9.0 23 12.5 24 17.0 25 19.0 26 24.5 27 38.0 28 47.5 29 75.5 30 100.5 31 116.0 32 140.5 33 180.0 34 220.0 35 233.5 36 248.5 37 261.5 38 236.5 39 217.5 40 215.0 41 202.5 42 195.5 43 196.5 44 172.0 45 136.5 46 127.5 47 113.0 48 88.0 49 67.5 50 59.0 51 49.0 52 29.0 53 22.0 54 20.0 55 11.0 56 9.0 57 9.0 58 4.5 59 4.0 60 4.0 61 1.0 62 0.5 63 0.5 64 0.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06471183013144 97.975 2 0.8341759352881698 1.6500000000000001 3 0.02527805864509606 0.075 4 0.07583417593528817 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra Read 601092 spots for SRR3473008.sra Written 601092 spots for SRR3473008.sra SRR ids: ['SRR3473008.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ef7e6x4f SRR3473008.sra spots: 12021840 blocks: [[1, 601092], [601093, 1202184], [1202185, 1803276], [1803277, 2404368], [2404369, 3005460], [3005461, 3606552], [3606553, 4207644], [4207645, 4808736], [4808737, 5409828], [5409829, 6010920], [6010921, 6612012], [6612013, 7213104], [7213105, 7814196], [7814197, 8415288], [8415289, 9016380], [9016381, 9617472], [9617473, 10218564], [10218565, 10819656], [10819657, 11420748], [11420749, 12021840]] SRR3473008 file size 3129502 SRR3473008 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473008 SRR3473008_1.fastq Input file: SRR3473008_1.fastq trimmed: SRR3473008-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 00:05:49 2025 >> started Fri Feb 14 00:05:56 2025 >> done (7.009s) 12021840 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 12021840 (100.00%) reads available; of these: 716284 ( 5.96%) trimmed reads available after processing 11305556 (94.04%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 51 1832 0.02% 52 2533 0.02% 53 3103 0.03% 54 3598 0.03% 55 4053 0.03% 56 4687 0.04% 57 4818 0.04% 58 5384 0.04% 59 5441 0.05% 60 6024 0.05% 61 6089 0.05% 62 6450 0.05% 63 6638 0.06% 64 6866 0.06% 65 7226 0.06% 66 7102 0.06% 67 7523 0.06% 68 7524 0.06% 69 7742 0.06% 70 8186 0.07% 71 8413 0.07% 72 8697 0.07% 73 8959 0.07% 74 9519 0.08% 75 9779 0.08% 76 6547 0.05% 77 7594 0.06% 78 8296 0.07% 79 8959 0.07% 80 9575 0.08% 81 10092 0.08% 82 10760 0.09% 83 11325 0.09% 84 11658 0.10% 85 13099 0.11% 86 13784 0.11% 87 14825 0.12% 88 15923 0.13% 89 17685 0.15% 90 19485 0.16% 91 21730 0.18% 92 24250 0.20% 93 28030 0.23% 94 32155 0.27% 95 36933 0.31% 96 44447 0.37% 97 52215 0.43% 98 62486 0.52% 99 76245 0.63% 100 11305556 94.04% 12021840 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=7.39 fanout-score-rank=9 prefix-density=0.46 prefix-fanout=4.6 sequence=AACATCAAAACCAGACCAAACCCCACCAAATTTCATCTCAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=128.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.1 sequence=TTTTTTTTGACGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTT Started job on | Feb 14 00:06:14 Started mapping on | Feb 14 00:06:15 Finished on | Feb 14 00:06:31 Mapping speed, Million of reads per hour | 2704.91 Number of input reads | 12021840 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11404928 Uniquely mapped reads % | 94.87% Average mapped length | 98.31 Number of splices: Total | 852643 Number of splices: Annotated (sjdb) | 781009 Number of splices: GT/AG | 805712 Number of splices: GC/AG | 11457 Number of splices: AT/AC | 1135 Number of splices: Non-canonical | 34339 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.06% Deletion average length | 1.80 Insertion rate per base | 0.05% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246980 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 47816 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369932 369932 369932 N_multimapping 246980 246980 246980 N_noFeature 643303 5800526 6017399 N_ambiguous 280283 25259 25036 UnstrandedReadsAssigned:10481342 PositiveStrandReadsAssigned:5579143 NegativeStrandReadsAssigned:5362493 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473008 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473008-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,021,840 reads, 11,035,178 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR3473008.ke.tsv 34699 SRR3473008.se.tsv 87100 total ==> SRR3473008.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 507 31.251 Potri.005G024800.1.v4.1 1035 936 24 3.03296 Potri.004G059700.1.v4.1 961 862 2 0.274444 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 172 7.15369 Potri.016G087400.1.v4.1 270 171 253 175.007 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 0 0 ==> SRR3473008.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 139 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 773 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473008 completed mapping pipeline successfully