Starting /dee2/code/volunteer_pipeline.sh SRR3473010 current disk space = 3088920494080 free memory = 1572474204 SRR3473010 SRAfilesize e69dc6da20f3801d279d97794469045d SRR3473010.sra SRR3473010.sra file validated SRR3473010 is single end SRR3473010 is conventional basespace SRR3473010 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76875 33.0 31.0 34.0 30.0 34.0 2 32.36 34.0 31.0 34.0 30.0 34.0 3 29.9955 33.0 30.0 34.0 16.0 34.0 4 34.603 37.0 35.0 37.0 28.0 37.0 5 35.655 37.0 35.0 37.0 33.0 37.0 6 35.981 37.0 35.0 37.0 35.0 37.0 7 36.12775 37.0 35.0 37.0 35.0 37.0 8 36.232 37.0 37.0 37.0 35.0 37.0 9 38.09725 39.0 39.0 39.0 35.0 39.0 10-11 38.039375 39.0 38.5 39.0 35.0 39.0 12-13 38.10325 39.0 39.0 39.0 35.0 39.0 14-15 39.5645 41.0 40.0 41.0 37.0 41.0 16-17 39.413 41.0 39.0 41.0 36.5 41.0 18-19 39.38425 41.0 39.0 41.0 36.0 41.0 20-21 39.322125 41.0 39.0 41.0 36.0 41.0 22-23 39.356750000000005 41.0 39.0 41.0 36.0 41.0 24-25 39.105625 41.0 39.0 41.0 35.0 41.0 26-27 39.123875 40.0 39.0 41.0 36.0 41.0 28-29 39.035250000000005 40.0 39.0 41.0 35.0 41.0 30-31 38.939625 40.0 39.0 41.0 35.0 41.0 32-33 38.924 40.0 38.5 41.0 35.0 41.0 34-35 38.772999999999996 40.0 38.0 41.0 35.0 41.0 36-37 38.851 40.0 38.5 41.0 35.0 41.0 38-39 38.814625 40.0 38.5 41.0 35.0 41.0 40-41 39.129 41.0 39.0 41.0 35.0 41.0 42-43 39.1125 41.0 39.0 41.0 35.0 41.0 44-45 38.939750000000004 40.5 39.0 41.0 35.0 41.0 46-47 38.911375 40.0 38.5 41.0 35.0 41.0 48-49 38.785375 40.0 38.5 41.0 35.0 41.0 50-51 38.890625 40.0 38.5 41.0 35.0 41.0 52-53 38.811 40.0 38.0 41.0 35.0 41.0 54-55 38.631125 40.0 38.0 41.0 34.0 41.0 56-57 38.546125 40.0 38.0 41.0 34.5 41.0 58-59 38.302375 40.0 37.5 41.0 34.0 41.0 60-61 37.999875 40.0 37.0 41.0 33.5 41.0 62-63 37.582750000000004 40.0 36.0 41.0 33.0 41.0 64-65 37.547625 39.0 36.0 41.0 33.0 41.0 66-67 37.405249999999995 39.0 36.0 41.0 33.0 41.0 68-69 37.208625 39.0 35.5 40.5 33.0 41.0 70-71 36.863875 38.0 35.0 40.0 32.5 41.0 72-73 36.420875 37.0 35.0 39.5 32.0 41.0 74-75 35.974 37.0 35.0 39.0 31.5 41.0 76-77 34.3185 35.5 33.0 37.5 29.5 39.0 78-79 34.99825 36.0 34.5 37.5 31.0 39.0 80-81 34.896249999999995 35.5 35.0 37.0 31.5 39.0 82-83 34.557625 35.0 34.5 37.0 31.0 39.0 84-85 34.273875000000004 35.0 34.0 36.0 31.0 37.0 86-87 33.945125000000004 35.0 34.0 36.0 31.0 37.0 88-89 33.6755 35.0 34.0 36.0 31.0 37.0 90-91 33.4395 35.0 34.0 35.0 31.0 36.0 92-93 33.176625 35.0 34.0 35.0 30.0 36.0 94-95 32.988749999999996 35.0 34.0 35.0 30.0 36.0 96-97 32.804874999999996 35.0 34.0 35.0 30.0 36.0 98-99 32.502875 35.0 34.0 35.0 29.5 35.5 100 32.1225 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.8818220885260004 1101 2 0.49575317879622816 1101 3 3.215639930230793 1101 4 2.0525038550013903 1101 5 0.6958846280239612 1101 6 0.3578705225106802 1101 7 0.1186582067291937 1101 8 0.19493667686240457 1101 9 0.010781364544094174 1101 10-11 0.10088096261280555 1101 12-13 0.08717358881670378 1101 14-15 0.03970019464597385 1101 16-17 0.11177608129629135 1101 18-19 0.028356379079355065 1101 20-21 -0.14369043706867757 1101 22-23 0.1552807199373092 1101 24-25 0.06897924618923668 1101 26-27 0.3091647918299216 1101 28-29 0.14806997143507772 1101 30-31 0.14889784878283052 1101 32-33 0.15138148082610314 1101 34-35 0.0029386486008249335 1101 36-37 0.04960944412144386 1101 38-39 -0.13092469475972734 1101 40-41 0.06122500568770306 1101 42-43 0.276024419221919 1101 44-45 0.23205844434894374 1101 46-47 0.44008948658964897 1101 48-49 0.002395156601529891 1101 50-51 0.12455446295407313 1101 52-53 -0.05292727318688861 1101 54-55 -0.027939280568268998 1101 56-57 0.06926363153770154 1101 58-59 0.18851588766146676 1101 60-61 0.03741247250941626 1101 62-63 -0.028836674334534962 1101 64-65 -0.004727116458965952 1101 66-67 0.03779165297404319 1101 68-69 0.1459339214843709 1101 70-71 0.27611921433808106 1101 72-73 -0.09669101847872952 1101 74-75 -0.18223413129755528 1101 76-77 -0.12229833918956245 1101 78-79 -0.26173563538007016 1101 80-81 0.22071462878232495 1101 82-83 0.11446194292070544 1101 84-85 0.20854293586794626 1101 86-87 0.2138325033494226 1101 88-89 0.07215172274324289 1101 90-91 0.19492403751358722 1101 92-93 0.5092962410576618 1101 94-95 0.7107801006092132 1101 96-97 0.3758499962081956 1101 98-99 0.32453423999595543 1101 100 0.1454789049268186 1104 1 -0.8818220885259969 1104 2 -0.49575317879622816 1104 3 -3.2156399302307968 1104 4 -2.0525038550013903 1104 5 -0.6958846280239683 1104 6 -0.3578705225106802 1104 7 -0.11865820672918659 1104 8 -0.19493667686241167 1104 9 -0.01078136454410128 1104 10-11 -0.10088096261281265 1104 12-13 -0.08717358881670378 1104 14-15 -0.03970019464597385 1104 16-17 -0.11177608129629135 1104 18-19 -0.02835637907934796 1104 20-21 0.14369043706868467 1104 22-23 -0.1552807199373092 1104 24-25 -0.06897924618923668 1104 26-27 -0.30916479182992873 1104 28-29 -0.1480699714350706 1104 30-31 -0.14889784878283052 1104 32-33 -0.15138148082611025 1104 34-35 -0.0029386486008249335 1104 36-37 -0.04960944412143675 1104 38-39 0.13092469475972734 1104 40-41 -0.061225005687710166 1104 42-43 -0.276024419221919 1104 44-45 -0.23205844434894374 1104 46-47 -0.44008948658964897 1104 48-49 -0.002395156601529891 1104 50-51 -0.12455446295407313 1104 52-53 0.05292727318688861 1104 54-55 0.027939280568261893 1104 56-57 -0.06926363153770154 1104 58-59 -0.18851588766146676 1104 60-61 -0.03741247250941626 1104 62-63 0.028836674334542067 1104 64-65 0.004727116458958847 1104 66-67 -0.03779165297404319 1104 68-69 -0.1459339214843638 1104 70-71 -0.27611921433808106 1104 72-73 0.09669101847872241 1104 74-75 0.18223413129755528 1104 76-77 0.12229833918956956 1104 78-79 0.26173563538006306 1104 80-81 -0.22071462878232495 1104 82-83 -0.11446194292069833 1104 84-85 -0.20854293586794626 1104 86-87 -0.21383250334942971 1104 88-89 -0.07215172274324999 1104 90-91 -0.19492403751358012 1104 92-93 -0.5092962410576618 1104 94-95 -0.7107801006092203 1104 96-97 -0.3758499962081885 1104 98-99 -0.32453423999595543 1104 100 -0.1454789049268186 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 3.0 18 7.0 19 9.0 20 7.0 21 8.0 22 6.0 23 9.0 24 11.0 25 14.0 26 22.0 27 27.0 28 33.0 29 27.0 30 42.0 31 52.0 32 70.0 33 100.0 34 143.0 35 234.0 36 340.0 37 768.0 38 1568.0 39 498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.568004037345442 17.865253595760787 20.36336109008327 38.2033812768105 2 19.325 26.125 40.775 13.775 3 21.45 29.349999999999998 30.0 19.2 4 21.9 34.8 23.674999999999997 19.625 5 22.605651412853213 37.184296074018505 24.706176544136035 15.503875968992247 6 16.45 41.199999999999996 26.25 16.1 7 14.75 17.9 50.125 17.224999999999998 8 19.05 23.525 33.85 23.575 9 19.325 25.424999999999997 33.625 21.625 10-11 20.1375 37.75 25.4375 16.675 12-13 18.2375 28.675 35.0375 18.05 14-15 19.175 30.412499999999998 31.775 18.637500000000003 16-17 20.05 31.25 30.525000000000002 18.175 18-19 19.412499999999998 31.15 31.075000000000003 18.3625 20-21 19.7375 31.9625 29.45 18.85 22-23 19.35 32.0125 29.925 18.712500000000002 24-25 20.0375 32.1125 30.125 17.724999999999998 26-27 20.3375 32.587500000000006 28.8625 18.212500000000002 28-29 19.2 32.875 29.762499999999996 18.1625 30-31 19.475 31.9625 30.2125 18.35 32-33 19.5875 32.475 29.875 18.0625 34-35 18.8875 31.6875 30.425 19.0 36-37 19.7625 31.612499999999997 30.337500000000002 18.2875 38-39 20.1125 31.05 30.4375 18.4 40-41 18.8125 32.074999999999996 30.85 18.2625 42-43 18.65 32.4375 31.025000000000002 17.8875 44-45 19.2375 31.75 31.15 17.8625 46-47 18.825 31.474999999999998 30.65 19.05 48-49 18.65 32.0125 30.349999999999998 18.987499999999997 50-51 18.4125 32.2625 30.4625 18.862499999999997 52-53 18.9625 31.7875 31.112499999999997 18.1375 54-55 18.575 31.637500000000003 31.825 17.962500000000002 56-57 18.8375 31.0625 31.574999999999996 18.525 58-59 19.025 31.374999999999996 30.55 19.05 60-61 18.625 31.2875 31.7 18.387500000000003 62-63 18.212500000000002 31.2125 31.825 18.75 64-65 18.512500000000003 32.300000000000004 30.562499999999996 18.625 66-67 19.3625 31.9875 30.95 17.7 68-69 18.9375 30.9 30.9875 19.175 70-71 18.987499999999997 31.1 31.05 18.862499999999997 72-73 18.8375 31.974999999999998 30.875000000000004 18.3125 74-75 19.162499999999998 30.8 31.087500000000002 18.95 76-77 18.912499999999998 31.337500000000002 31.637500000000003 18.1125 78-79 18.85 32.0 30.85 18.3 80-81 19.1875 31.2625 31.05 18.5 82-83 19.125 31.5375 30.599999999999998 18.7375 84-85 19.45 31.25 31.05 18.25 86-87 18.575 31.05 31.900000000000002 18.475 88-89 18.9375 31.75 30.675 18.637500000000003 90-91 18.675 31.2 31.624999999999996 18.5 92-93 18.425 30.4625 32.475 18.637500000000003 94-95 18.6625 32.375 30.9375 18.025 96-97 19.5875 31.8125 31.7625 16.8375 98-99 19.125 31.05 31.0125 18.8125 100 19.475 29.799999999999997 32.775 17.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 5.5 2 8.0 3 6.5 4 4.5 5 4.5 6 5.5 7 7.5 8 5.0 9 1.0 10 2.5 11 2.5 12 1.5 13 2.5 14 2.0 15 6.0 16 9.0 17 7.5 18 6.0 19 3.0 20 5.5 21 8.5 22 8.0 23 14.0 24 19.0 25 14.5 26 15.0 27 29.0 28 55.5 29 80.0 30 98.5 31 126.0 32 148.0 33 173.0 34 209.0 35 225.0 36 232.5 37 243.5 38 239.0 39 235.0 40 232.5 41 221.5 42 192.0 43 183.0 44 172.5 45 130.0 46 114.5 47 98.0 48 78.0 49 66.0 50 54.5 51 43.0 52 29.5 53 26.5 54 22.0 55 12.5 56 12.5 57 11.0 58 7.5 59 7.0 60 4.0 61 2.0 62 3.0 63 3.0 64 0.5 65 0.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.66905554133606 96.375 2 0.8446378295367288 1.6500000000000001 3 0.2303557716918352 0.675 4 0.12797542871768622 0.5 5 0.05119017148707448 0.25 6 0.0 0.0 7 0.05119017148707448 0.35000000000000003 8 0.02559508574353724 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit ATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit CTGGGATTCAATTCTTTGTTCCTTCGCTTTGTACATGCAAGAAGCACAAA 5 0.125 No Hit GTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra Read 757650 spots for SRR3473010.sra Written 757650 spots for SRR3473010.sra Read 757645 spots for SRR3473010.sra Written 757645 spots for SRR3473010.sra SRR ids: ['SRR3473010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__oinmuma SRR3473010.sra spots: 15152905 blocks: [[1, 757645], [757646, 1515290], [1515291, 2272935], [2272936, 3030580], [3030581, 3788225], [3788226, 4545870], [4545871, 5303515], [5303516, 6061160], [6061161, 6818805], [6818806, 7576450], [7576451, 8334095], [8334096, 9091740], [9091741, 9849385], [9849386, 10607030], [10607031, 11364675], [11364676, 12122320], [12122321, 12879965], [12879966, 13637610], [13637611, 14395255], [14395256, 15152905]] SRR3473010 file size 3947390 SRR3473010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473010 SRR3473010_1.fastq Input file: SRR3473010_1.fastq trimmed: SRR3473010-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 01:47:19 2025 >> started Fri Feb 14 01:47:27 2025 >> done (7.723s) 15152905 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15152905 (100.00%) reads available; of these: 873803 ( 5.77%) trimmed reads available after processing 14279102 (94.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 49 1 0.00% 50 0 0.00% 51 2126 0.01% 52 3016 0.02% 53 3728 0.02% 54 4479 0.03% 55 4949 0.03% 56 5535 0.04% 57 5994 0.04% 58 6274 0.04% 59 6798 0.04% 60 7186 0.05% 61 7526 0.05% 62 7622 0.05% 63 7999 0.05% 64 8467 0.06% 65 8822 0.06% 66 8734 0.06% 67 9130 0.06% 68 9152 0.06% 69 9613 0.06% 70 9827 0.06% 71 10303 0.07% 72 10766 0.07% 73 11467 0.08% 74 11560 0.08% 75 12180 0.08% 76 8076 0.05% 77 9387 0.06% 78 10332 0.07% 79 10921 0.07% 80 11604 0.08% 81 12457 0.08% 82 13047 0.09% 83 13776 0.09% 84 14390 0.09% 85 16094 0.11% 86 16774 0.11% 87 18119 0.12% 88 19795 0.13% 89 22073 0.15% 90 24140 0.16% 91 26711 0.18% 92 29813 0.20% 93 34605 0.23% 94 39255 0.26% 95 45290 0.30% 96 53821 0.36% 97 62637 0.41% 98 75233 0.50% 99 92199 0.61% 100 14279102 94.23% 15152905 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=1.3 sequence=ATTGATTGATTTATTTTGTTCTACATAAGTTGTACATCATCCATGAAATAGACTAGTTCCATAATCAGCCATTTTATTTTTAACTCGATCTATCACGATCAGCTTGGCTTTGAAACAGCTTTTTCCCACAATGAAGTCTTCAAACCTGGTCGTATTGAATTACGACTTTGCCAGCATTAGGATCAGCGATCCGGGAGAAAGCATCTTTCGAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=663.39 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=28.6 sequence=TTTTTTTTTGACGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTT Started job on | Feb 14 01:47:58 Started mapping on | Feb 14 01:47:58 Finished on | Feb 14 01:48:15 Mapping speed, Million of reads per hour | 3208.85 Number of input reads | 15152905 Average input read length | 95 UNIQUE READS: Uniquely mapped reads number | 14235849 Uniquely mapped reads % | 93.95% Average mapped length | 94.50 Number of splices: Total | 1054163 Number of splices: Annotated (sjdb) | 949743 Number of splices: GT/AG | 974768 Number of splices: GC/AG | 13048 Number of splices: AT/AC | 1517 Number of splices: Non-canonical | 64830 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.05% Deletion average length | 1.86 Insertion rate per base | 0.05% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409873 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 88247 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 507183 507183 507183 N_multimapping 409873 409873 409873 N_noFeature 988562 7354301 7716344 N_ambiguous 212649 30954 28283 UnstrandedReadsAssigned:13034638 PositiveStrandReadsAssigned:6850594 NegativeStrandReadsAssigned:6491222 Dataset is classified unstranded MeadianReadLen=96 20thPercentileLength=96 echo kmer=91 SRR3473010 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473010-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,152,905 reads, 13,683,442 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52401 SRR3473010.ke.tsv 34699 SRR3473010.se.tsv 87100 total ==> SRR3473010.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 808 33.3283 Potri.005G024800.1.v4.1 1035 936 381 32.22 Potri.004G059700.1.v4.1 961 862 1 0.0918267 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 283 7.8765 Potri.016G087400.1.v4.1 270 171 129 59.7131 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 845 76.1796 ==> SRR3473010.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 392 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473010 completed mapping pipeline successfully