Starting /dee2/code/volunteer_pipeline.sh SRR3473011 current disk space = 3088920014848 free memory = 1576454452 SRR3473011 SRAfilesize a8e3d0d8e9ed74b7fde52fb749b6b1fa SRR3473011.sra SRR3473011.sra file validated SRR3473011 is single end SRR3473011 is conventional basespace SRR3473011 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473011_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47725 34.0 31.0 34.0 31.0 34.0 2 32.786 34.0 31.0 34.0 31.0 34.0 3 32.0615 34.0 31.0 34.0 30.0 34.0 4 36.05025 37.0 35.0 37.0 35.0 37.0 5 36.12625 37.0 35.0 37.0 35.0 37.0 6 36.23075 37.0 37.0 37.0 35.0 37.0 7 36.18375 37.0 36.0 37.0 35.0 37.0 8 36.17725 37.0 37.0 37.0 35.0 37.0 9 37.96425 39.0 38.0 39.0 35.0 39.0 10-11 37.946749999999994 39.0 38.0 39.0 35.0 39.0 12-13 37.951750000000004 39.0 38.0 39.0 35.0 39.0 14-15 39.47025 41.0 39.5 41.0 37.0 41.0 16-17 39.388 41.0 39.0 41.0 36.0 41.0 18-19 39.35875 41.0 39.0 41.0 36.0 41.0 20-21 39.178 41.0 39.0 41.0 35.5 41.0 22-23 39.22 41.0 39.0 41.0 36.0 41.0 24-25 39.107 40.0 39.0 41.0 35.0 41.0 26-27 39.045 40.0 39.0 41.0 35.0 41.0 28-29 38.967 40.0 39.0 41.0 35.0 41.0 30-31 38.755375 40.0 38.0 41.0 35.0 41.0 32-33 38.795500000000004 40.0 38.0 41.0 35.0 41.0 34-35 38.569625 40.0 38.0 41.0 34.5 41.0 36-37 38.600125 40.0 38.0 41.0 34.5 41.0 38-39 38.87425 40.0 38.5 41.0 35.0 41.0 40-41 39.01649999999999 41.0 39.0 41.0 35.0 41.0 42-43 38.9255 40.0 38.5 41.0 35.0 41.0 44-45 38.840125 40.0 38.0 41.0 35.0 41.0 46-47 38.873374999999996 40.0 38.0 41.0 35.0 41.0 48-49 38.706625 40.0 38.0 41.0 34.5 41.0 50-51 38.718 40.0 38.0 41.0 35.0 41.0 52-53 38.59975 40.0 38.0 41.0 34.5 41.0 54-55 38.522375 40.0 38.0 41.0 34.0 41.0 56-57 38.39625 40.0 38.0 41.0 34.0 41.0 58-59 38.084625 40.0 37.0 41.0 34.0 41.0 60-61 37.901624999999996 40.0 37.0 41.0 33.0 41.0 62-63 37.47 39.5 36.0 41.0 32.5 41.0 64-65 37.43925 39.0 36.0 41.0 33.0 41.0 66-67 37.302375 39.0 35.5 41.0 33.0 41.0 68-69 36.979 38.5 35.0 40.0 32.5 41.0 70-71 36.627750000000006 37.5 35.0 40.0 32.0 41.0 72-73 36.163 37.0 35.0 39.5 31.5 41.0 74-75 35.576875 36.5 35.0 39.0 30.5 40.5 76-77 33.955875 35.0 33.0 37.5 29.0 39.0 78-79 34.753875 36.0 34.0 37.0 30.5 39.0 80-81 34.5725 35.0 34.0 37.0 31.0 39.0 82-83 34.235625 35.0 34.0 37.0 31.0 39.0 84-85 33.863375000000005 35.0 34.0 36.0 30.5 37.0 86-87 33.535250000000005 35.0 34.0 36.0 30.5 37.0 88-89 33.350750000000005 35.0 34.0 36.0 30.5 37.0 90-91 33.156 35.0 34.0 35.0 30.0 36.0 92-93 32.877250000000004 35.0 34.0 35.0 29.0 36.0 94-95 32.651375 35.0 34.0 35.0 29.0 36.0 96-97 32.585875 35.0 34.0 35.0 29.0 36.0 98-99 32.324375 35.0 34.0 35.0 29.0 35.5 100 31.98675 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.16223913700977732 1101 2 0.25 1101 3 1.217234600262124 1101 4 0.502217965520714 1101 5 0.2158735759653183 1101 6 0.13297711462848838 1101 7 0.2755570117955415 1101 8 0.25677991733037686 1101 9 0.15803004335113968 1101 10-11 0.15803004335113968 1101 12-13 0.17261064623449585 1101 14-15 0.13135144671841914 1101 16-17 0.0071957858655054 1101 18-19 0.3209244883556792 1101 20-21 0.22391370097791707 1101 22-23 0.23113469099708084 1101 24-25 -0.007964512551666303 1101 26-27 0.18721645327150327 1101 28-29 0.24808448432301589 1101 30-31 0.36800584736364783 1101 32-33 0.2284126424034696 1101 34-35 0.11799324528682575 1101 36-37 0.08292166549047408 1101 38-39 0.198898578485732 1101 40-41 0.4499571529388078 1101 42-43 0.36645579191451105 1101 44-45 0.26837382800685816 1101 46-47 0.2874029640084643 1101 48-49 -0.03329468696441751 1101 50-51 0.22008266962394885 1101 52-53 0.44558423228148314 1101 54-55 0.48272255267667674 1101 56-57 0.5915162818832513 1101 58-59 0.3968646032866232 1101 60-61 0.3435326141748192 1101 62-63 0.3825360419397157 1101 64-65 0.26178294182881245 1101 66-67 0.28974695029740616 1101 68-69 0.23020213731223294 1101 70-71 0.27805222300634824 1101 72-73 0.09731323722149199 1101 74-75 0.25162566791007634 1101 76-77 0.12716755721343276 1101 78-79 0.1768071378163114 1101 80-81 0.3015298921262257 1101 82-83 0.3674639580602843 1101 84-85 0.3254360318580467 1101 86-87 0.2516508720637134 1101 88-89 0.215659340659343 1101 90-91 0.3008745841314706 1101 92-93 0.16008418187317375 1101 94-95 0.17015324125416242 1101 96-97 0.2622996269785318 1101 98-99 0.0885169875995544 1101 100 0.06086803105151617 1105 1 -0.16223913700977732 1105 2 -0.25 1105 3 -1.217234600262124 1105 4 -0.5022179655207211 1105 5 -0.2158735759653183 1105 6 -0.13297711462849549 1105 7 -0.2755570117955486 1105 8 -0.25677991733037686 1105 9 -0.1580300433511468 1105 10-11 -0.1580300433511468 1105 12-13 -0.17261064623450295 1105 14-15 -0.13135144671841914 1105 16-17 -0.007195785865512505 1105 18-19 -0.3209244883556792 1105 20-21 -0.22391370097792418 1105 22-23 -0.23113469099708084 1105 24-25 0.007964512551666303 1105 26-27 -0.18721645327149616 1105 28-29 -0.24808448432301589 1105 30-31 -0.3680058473636407 1105 32-33 -0.2284126424034696 1105 34-35 -0.11799324528682575 1105 36-37 -0.08292166549047408 1105 38-39 -0.198898578485732 1105 40-41 -0.4499571529388078 1105 42-43 -0.36645579191451105 1105 44-45 -0.26837382800685816 1105 46-47 -0.2874029640084643 1105 48-49 0.0332946869644104 1105 50-51 -0.22008266962395595 1105 52-53 -0.44558423228148314 1105 54-55 -0.48272255267668385 1105 56-57 -0.5915162818832513 1105 58-59 -0.3968646032866232 1105 60-61 -0.3435326141748192 1105 62-63 -0.3825360419397157 1105 64-65 -0.26178294182881245 1105 66-67 -0.28974695029741326 1105 68-69 -0.23020213731222583 1105 70-71 -0.27805222300634824 1105 72-73 -0.0973132372214991 1105 74-75 -0.25162566791006924 1105 76-77 -0.12716755721343276 1105 78-79 -0.1768071378163114 1105 80-81 -0.3015298921262186 1105 82-83 -0.3674639580602843 1105 84-85 -0.3254360318580538 1105 86-87 -0.2516508720637134 1105 88-89 -0.215659340659343 1105 90-91 -0.3008745841314635 1105 92-93 -0.16008418187316664 1105 94-95 -0.17015324125416242 1105 96-97 -0.2622996269785247 1105 98-99 -0.0885169875995544 1105 100 -0.06086803105151617 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 5.0 19 6.0 20 7.0 21 10.0 22 9.0 23 11.0 24 23.0 25 15.0 26 18.0 27 20.0 28 20.0 29 39.0 30 69.0 31 70.0 32 84.0 33 104.0 34 147.0 35 230.0 36 346.0 37 735.0 38 1506.0 39 523.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.34673366834171 18.517587939698494 18.618090452261306 38.517587939698494 2 18.224999999999998 27.6 39.15 15.024999999999999 3 19.900000000000002 31.424999999999997 27.975 20.7 4 21.475 37.1 22.275 19.15 5 21.435717858929465 39.04452226113057 24.337168584292147 15.182591295647823 6 16.825000000000003 39.975 27.125 16.075 7 14.674999999999999 18.6 49.2 17.525 8 18.85 24.975 32.800000000000004 23.375 9 17.549999999999997 24.65 35.925000000000004 21.875 10-11 19.2 38.2875 25.35 17.1625 12-13 17.5 30.375000000000004 33.324999999999996 18.8 14-15 18.4375 31.674999999999997 31.1875 18.7 16-17 18.775 31.7375 30.412499999999998 19.075 18-19 19.037499999999998 33.050000000000004 29.25 18.6625 20-21 19.1375 32.1375 30.2625 18.462500000000002 22-23 18.9 31.624999999999996 31.162499999999998 18.3125 24-25 19.625 32.65 29.9875 17.7375 26-27 19.8125 32.425 29.375 18.387500000000003 28-29 19.8375 31.2 30.7375 18.224999999999998 30-31 19.775000000000002 31.95 30.2375 18.0375 32-33 19.175 32.4625 29.875 18.4875 34-35 19.075 31.637500000000003 31.25 18.0375 36-37 18.4375 32.1875 30.662499999999998 18.712500000000002 38-39 19.037499999999998 31.6875 30.525000000000002 18.75 40-41 18.8125 31.900000000000002 30.8125 18.475 42-43 20.0 31.5 29.925 18.575 44-45 18.825 31.0625 32.0 18.1125 46-47 18.987499999999997 31.937500000000004 30.887500000000003 18.1875 48-49 19.287499999999998 32.1375 31.75 16.825000000000003 50-51 18.2 31.5 32.7125 17.5875 52-53 19.037499999999998 31.7125 31.162499999999998 18.087500000000002 54-55 18.7 31.662499999999998 31.6875 17.95 56-57 18.4125 32.324999999999996 31.874999999999996 17.3875 58-59 18.3 31.7625 32.4 17.5375 60-61 18.5 31.2125 31.587500000000002 18.7 62-63 18.175 31.337500000000002 32.6375 17.849999999999998 64-65 18.2375 30.725 32.7625 18.275 66-67 18.15 31.474999999999998 32.175 18.2 68-69 18.525 31.05 32.0 18.425 70-71 18.0 31.3 32.300000000000004 18.4 72-73 18.5 30.575000000000003 32.2625 18.6625 74-75 18.1125 30.975 32.4375 18.475 76-77 17.974999999999998 31.55 31.55 18.925 78-79 18.9 31.525 32.175 17.4 80-81 18.55 31.025000000000002 31.9875 18.4375 82-83 18.65 30.837500000000002 32.2625 18.25 84-85 18.862499999999997 30.225 32.4625 18.45 86-87 18.0125 30.7625 32.7875 18.4375 88-89 17.6375 31.125000000000004 32.337500000000006 18.9 90-91 18.15 31.624999999999996 31.624999999999996 18.6 92-93 18.65 30.425 32.475 18.45 94-95 18.6625 30.875000000000004 32.2625 18.2 96-97 18.462500000000002 31.7875 31.525 18.224999999999998 98-99 17.95 31.112499999999997 32.5 18.4375 100 18.05 32.324999999999996 31.175000000000004 18.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 6.0 2 10.0 3 5.5 4 2.5 5 7.0 6 10.5 7 10.5 8 8.0 9 4.5 10 5.0 11 4.5 12 3.5 13 4.0 14 4.0 15 14.5 16 18.5 17 11.5 18 21.5 19 20.0 20 7.0 21 5.0 22 7.0 23 15.5 24 18.0 25 17.0 26 26.0 27 37.5 28 48.0 29 69.0 30 93.5 31 115.0 32 155.0 33 189.5 34 200.5 35 202.0 36 210.0 37 236.0 38 253.5 39 241.5 40 219.5 41 212.5 42 202.5 43 175.0 44 147.0 45 120.5 46 107.0 47 104.0 48 85.5 49 71.5 50 56.5 51 43.5 52 33.0 53 22.5 54 18.5 55 13.5 56 13.0 57 10.5 58 7.0 59 4.5 60 3.0 61 2.5 62 2.5 63 1.5 64 2.0 65 1.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78395860284606 95.45 2 0.6985769728331177 1.35 3 0.1034928848641656 0.3 4 0.15523932729624837 0.6 5 0.1034928848641656 0.5 6 0.0517464424320828 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.1034928848641656 1.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTT 23 0.575 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 17 0.42500000000000004 No Hit GCCGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit ATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTTTTTTTTTTTT 10 0.25 No Hit CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 6 0.15 No Hit GAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTTTT 6 0.15 No Hit GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit GGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTT 5 0.125 No Hit CTGGCCGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610344 spots for SRR3473011.sra Written 610344 spots for SRR3473011.sra Read 610347 spots for SRR3473011.sra Written 610347 spots for SRR3473011.sra SRR ids: ['SRR3473011.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x04c2guz SRR3473011.sra spots: 12206883 blocks: [[1, 610344], [610345, 1220688], [1220689, 1831032], [1831033, 2441376], [2441377, 3051720], [3051721, 3662064], [3662065, 4272408], [4272409, 4882752], [4882753, 5493096], [5493097, 6103440], [6103441, 6713784], [6713785, 7324128], [7324129, 7934472], [7934473, 8544816], [8544817, 9155160], [9155161, 9765504], [9765505, 10375848], [10375849, 10986192], [10986193, 11596536], [11596537, 12206883]] SRR3473011 file size 3177830 SRR3473011 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473011 SRR3473011_1.fastq Input file: SRR3473011_1.fastq trimmed: SRR3473011-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 01:37:54 2025 >> started Fri Feb 14 01:38:02 2025 >> done (7.838s) 12206883 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 12206883 (100.00%) reads available; of these: 783644 ( 6.42%) trimmed reads available after processing 11423239 (93.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 2262 0.02% 52 3222 0.03% 53 3830 0.03% 54 4431 0.04% 55 4902 0.04% 56 5474 0.04% 57 5963 0.05% 58 6256 0.05% 59 6776 0.06% 60 7437 0.06% 61 7600 0.06% 62 7722 0.06% 63 7906 0.06% 64 8181 0.07% 65 8736 0.07% 66 8753 0.07% 67 9077 0.07% 68 9106 0.07% 69 9603 0.08% 70 9816 0.08% 71 10148 0.08% 72 10534 0.09% 73 10960 0.09% 74 11423 0.09% 75 11648 0.10% 76 8372 0.07% 77 9318 0.08% 78 10303 0.08% 79 10887 0.09% 80 11500 0.09% 81 12161 0.10% 82 13066 0.11% 83 13274 0.11% 84 13366 0.11% 85 15124 0.12% 86 16060 0.13% 87 16784 0.14% 88 18320 0.15% 89 19657 0.16% 90 21552 0.18% 91 23626 0.19% 92 26188 0.21% 93 29618 0.24% 94 33660 0.28% 95 37770 0.31% 96 44339 0.36% 97 51625 0.42% 98 61072 0.50% 99 74235 0.61% 100 11423239 93.58% 12206883 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=124.22 fanout-score-rank=6 prefix-density=0.64 prefix-fanout=21.8 sequence=TTTTATTTTTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=591.12 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=29.3 sequence=TTTTTTTTTGACGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGG Started job on | Feb 14 01:38:18 Started mapping on | Feb 14 01:38:19 Finished on | Feb 14 01:38:56 Mapping speed, Million of reads per hour | 1187.70 Number of input reads | 12206883 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11079133 Uniquely mapped reads % | 90.76% Average mapped length | 98.21 Number of splices: Total | 839682 Number of splices: Annotated (sjdb) | 744847 Number of splices: GT/AG | 767823 Number of splices: GC/AG | 11264 Number of splices: AT/AC | 1262 Number of splices: Non-canonical | 59333 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.05% Deletion average length | 1.89 Insertion rate per base | 0.05% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351172 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 129509 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 776578 776578 776578 N_multimapping 351172 351172 351172 N_noFeature 810672 5770771 6004782 N_ambiguous 156667 22771 20611 UnstrandedReadsAssigned:10111794 PositiveStrandReadsAssigned:5285591 NegativeStrandReadsAssigned:5053740 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473011 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473011-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,206,883 reads, 10,937,414 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR3473011.ke.tsv 34699 SRR3473011.se.tsv 87100 total ==> SRR3473011.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 212 11.0835 Potri.005G024800.1.v4.1 1035 936 3 0.321558 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 390.148 13.763 Potri.016G087400.1.v4.1 270 171 628 368.45 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 226 13.5446 Potri.012G127500.1.v4.1 977 878 1905 217.678 ==> SRR3473011.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 607 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 733 Potri.001G212900.v4.1 373 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473011 completed mapping pipeline successfully