Starting /dee2/code/volunteer_pipeline.sh SRR3473012 current disk space = 3089118478336 free memory = 1410282012 SRR3473012 SRAfilesize 359872dbb0ab1b368dd2128e9a77e28b SRR3473012.sra SRR3473012.sra file validated SRR3473012 is single end SRR3473012 is conventional basespace SRR3473012 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48975 34.0 31.0 34.0 31.0 34.0 2 32.769 34.0 31.0 34.0 31.0 34.0 3 32.11425 34.0 31.0 34.0 30.0 34.0 4 35.98825 37.0 35.0 37.0 35.0 37.0 5 36.16 37.0 35.0 37.0 35.0 37.0 6 36.219 37.0 36.0 37.0 35.0 37.0 7 36.23175 37.0 37.0 37.0 35.0 37.0 8 36.25875 37.0 37.0 37.0 35.0 37.0 9 38.03875 39.0 39.0 39.0 35.0 39.0 10-11 38.043499999999995 39.0 38.5 39.0 36.0 39.0 12-13 38.0425 39.0 38.0 39.0 35.0 39.0 14-15 39.48375 41.0 39.0 41.0 36.5 41.0 16-17 39.403000000000006 41.0 39.0 41.0 36.0 41.0 18-19 39.35525 41.0 39.0 41.0 36.0 41.0 20-21 39.281625000000005 41.0 39.0 41.0 36.0 41.0 22-23 39.3625 41.0 39.0 41.0 36.0 41.0 24-25 39.149875 41.0 39.0 41.0 36.0 41.0 26-27 39.160125 40.0 39.0 41.0 36.0 41.0 28-29 39.164500000000004 40.0 39.0 41.0 36.0 41.0 30-31 39.028875 40.0 39.0 41.0 36.0 41.0 32-33 38.90875 40.0 38.5 41.0 35.0 41.0 34-35 38.652249999999995 40.0 38.0 41.0 35.0 41.0 36-37 38.7645 40.0 38.5 41.0 35.0 41.0 38-39 38.94025 40.0 39.0 41.0 35.0 41.0 40-41 39.172124999999994 41.0 39.0 41.0 35.5 41.0 42-43 39.06325 40.0 39.0 41.0 35.0 41.0 44-45 39.0035 40.0 39.0 41.0 35.0 41.0 46-47 38.951375 40.0 39.0 41.0 35.0 41.0 48-49 38.8665 40.0 39.0 41.0 35.0 41.0 50-51 38.907875 40.0 38.5 41.0 35.0 41.0 52-53 38.70975 40.0 38.0 41.0 35.0 41.0 54-55 38.682625 40.0 38.0 41.0 34.5 41.0 56-57 38.644375 40.0 38.0 41.0 34.5 41.0 58-59 38.333749999999995 40.0 38.0 41.0 34.0 41.0 60-61 38.1045 40.0 37.0 41.0 34.0 41.0 62-63 37.739875 40.0 37.0 41.0 32.5 41.0 64-65 37.60225 39.0 36.0 41.0 33.0 41.0 66-67 37.399 39.0 36.0 41.0 33.0 41.0 68-69 37.076375 39.0 35.5 40.5 32.5 41.0 70-71 36.691 38.0 35.0 40.0 32.0 41.0 72-73 36.245625000000004 37.0 35.0 39.5 31.5 41.0 74-75 35.799125000000004 37.0 35.0 39.0 31.5 40.5 76-77 34.098124999999996 35.0 33.0 37.5 29.0 39.0 78-79 34.757125 36.0 34.0 37.5 30.0 39.0 80-81 34.726625 35.5 34.0 37.0 31.0 39.0 82-83 34.49 35.0 34.0 37.0 31.0 39.0 84-85 34.14775 35.0 34.0 36.0 31.0 37.0 86-87 33.80675 35.0 34.0 36.0 31.0 37.0 88-89 33.60925 35.0 34.0 36.0 30.5 37.0 90-91 33.442 35.0 34.0 35.0 30.5 36.0 92-93 33.151375 35.0 34.0 35.0 29.5 36.0 94-95 32.91225 35.0 34.0 35.0 29.5 36.0 96-97 32.680125000000004 35.0 34.0 35.0 29.5 36.0 98-99 32.436 35.0 34.0 35.0 29.0 35.5 100 32.086 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.29420442044204265 1101 2 0.16064106410641443 1101 3 1.0919091909190897 1101 4 0.43756875687569163 1101 5 0.1166116611661181 1101 6 0.1322132213221323 1101 7 -0.051505150515048115 1101 8 0.011826182618264625 1101 9 0.001700170016995628 1101 10-11 0.09964746474647512 1101 12-13 -0.0035003500349972683 1101 14-15 0.05236773677367523 1101 16-17 0.25050005000500164 1101 18-19 0.14062656265627282 1101 20-21 0.08568356835683488 1101 22-23 0.361461146114614 1101 24-25 -0.16609160916091525 1101 26-27 0.15676567656765172 1101 28-29 0.18580608060806014 1101 30-31 0.1332633263326315 1101 32-33 0.24077407740773538 1101 34-35 0.17709270927093002 1101 36-37 0.1530528052805309 1101 38-39 0.013301330133010936 1101 40-41 0.12805030503050574 1101 42-43 0.4942119211921181 1101 44-45 0.19974497449744888 1101 46-47 0.36519901990199344 1101 48-49 0.2852410241024117 1101 50-51 0.3878762876287638 1101 52-53 0.45344534453445107 1101 54-55 0.26235123512351066 1101 56-57 0.2631638163816348 1101 58-59 0.40466546654666047 1101 60-61 0.4785728572857266 1101 62-63 0.058443344334428105 1101 64-65 0.319969496949696 1101 66-67 0.33237073707370257 1101 68-69 0.5610811081108125 1101 70-71 0.38595109510951175 1101 72-73 0.05031753175317988 1101 74-75 0.20549554955495353 1101 76-77 0.1915566556655719 1101 78-79 0.578207820782076 1101 80-81 0.4831733173317332 1101 82-83 0.27551505150514544 1101 84-85 -6.625662566293045E-4 1101 86-87 0.22859785978597813 1101 88-89 0.4267676767676747 1101 90-91 0.3619486948694899 1101 92-93 0.3264201420142072 1101 94-95 0.21392139213921268 1101 96-97 0.12503750375037725 1101 98-99 0.2160341034103368 1101 100 0.023602360236026243 1105 1 -0.29420442044204265 1105 2 -0.16064106410640733 1105 3 -1.0919091909190968 1105 4 -0.43756875687568453 1105 5 -0.1166116611661181 1105 6 -0.1322132213221323 1105 7 0.05150515051505522 1105 8 -0.01182618261825752 1105 9 -0.0017001700170027334 1105 10-11 -0.09964746474647512 1105 12-13 0.0035003500350043737 1105 14-15 -0.05236773677367523 1105 16-17 -0.25050005000500164 1105 18-19 -0.14062656265626572 1105 20-21 -0.08568356835683488 1105 22-23 -0.3614611461146069 1105 24-25 0.16609160916091525 1105 26-27 -0.15676567656765172 1105 28-29 -0.18580608060806014 1105 30-31 -0.1332633263326315 1105 32-33 -0.24077407740774248 1105 34-35 -0.17709270927093002 1105 36-37 -0.15305280528052378 1105 38-39 -0.013301330133010936 1105 40-41 -0.12805030503049863 1105 42-43 -0.4942119211921181 1105 44-45 -0.19974497449744888 1105 46-47 -0.36519901990198633 1105 48-49 -0.2852410241024117 1105 50-51 -0.3878762876287638 1105 52-53 -0.45344534453445107 1105 54-55 -0.26235123512351777 1105 56-57 -0.2631638163816419 1105 58-59 -0.40466546654665336 1105 60-61 -0.4785728572857266 1105 62-63 -0.05844334433443521 1105 64-65 -0.319969496949696 1105 66-67 -0.3323707370737097 1105 68-69 -0.5610811081108125 1105 70-71 -0.38595109510951175 1105 72-73 -0.05031753175317988 1105 74-75 -0.20549554955495353 1105 76-77 -0.1915566556655719 1105 78-79 -0.578207820782076 1105 80-81 -0.4831733173317332 1105 82-83 -0.27551505150515254 1105 84-85 6.625662566293045E-4 1105 86-87 -0.22859785978597813 1105 88-89 -0.4267676767676747 1105 90-91 -0.3619486948694899 1105 92-93 -0.3264201420142001 1105 94-95 -0.21392139213921268 1105 96-97 -0.12503750375037015 1105 98-99 -0.2160341034103439 1105 100 -0.023602360236019138 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 4.0 19 6.0 20 4.0 21 4.0 22 6.0 23 18.0 24 10.0 25 14.0 26 19.0 27 25.0 28 37.0 29 29.0 30 45.0 31 59.0 32 72.0 33 103.0 34 147.0 35 191.0 36 345.0 37 771.0 38 1596.0 39 490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.039186134137154 17.307209243908567 21.77844762622457 36.87515699572972 2 19.8 27.125 37.675 15.4 3 20.625 30.4 28.749999999999996 20.225 4 22.525000000000002 36.275 23.95 17.25 5 23.111555777888945 37.64382191095548 24.81240620310155 14.432216108054027 6 17.029257314328582 41.21030257564391 25.78144536134033 15.978994748687173 7 14.124999999999998 18.224999999999998 49.9 17.75 8 19.425 25.1 31.525 23.95 9 20.4 24.85 33.275 21.475 10-11 21.675 37.625 24.075 16.625 12-13 18.0375 29.575000000000003 33.7375 18.65 14-15 19.950000000000003 29.9375 31.874999999999996 18.2375 16-17 19.775000000000002 30.4625 31.162499999999998 18.6 18-19 19.787499999999998 31.587500000000002 29.862499999999997 18.7625 20-21 19.725 31.775 29.3875 19.112499999999997 22-23 19.162499999999998 31.6875 30.662499999999998 18.4875 24-25 19.5125 31.775 29.8875 18.825 26-27 19.5875 31.5125 29.549999999999997 19.35 28-29 20.525 31.4625 30.1375 17.875 30-31 19.925 31.65 29.1125 19.3125 32-33 21.0125 30.575000000000003 30.1375 18.275 34-35 19.25 31.5375 30.275000000000002 18.9375 36-37 19.3375 30.862499999999997 29.975 19.825 38-39 19.325 31.45 30.112499999999997 19.112499999999997 40-41 19.8875 30.8 30.425 18.8875 42-43 20.1125 30.4375 30.049999999999997 19.400000000000002 44-45 19.175 31.2375 30.675 18.912499999999998 46-47 19.45 30.925000000000004 30.1375 19.4875 48-49 19.3125 31.15 30.587500000000002 18.95 50-51 20.5375 30.325000000000003 30.9875 18.15 52-53 19.7625 30.2125 30.049999999999997 19.975 54-55 19.525000000000002 30.875000000000004 30.475 19.125 56-57 19.6875 30.1875 30.2875 19.8375 58-59 20.0125 31.175000000000004 30.125 18.6875 60-61 19.35 31.4375 29.7125 19.5 62-63 19.900000000000002 30.85 30.2625 18.987499999999997 64-65 19.825 30.575000000000003 30.7625 18.8375 66-67 19.5125 30.9875 30.525000000000002 18.975 68-69 19.175 30.425 30.925000000000004 19.475 70-71 20.575 30.162499999999998 30.012499999999996 19.25 72-73 20.0375 30.099999999999998 30.562499999999996 19.3 74-75 19.525000000000002 30.9875 30.099999999999998 19.3875 76-77 19.725 31.3 30.1875 18.787499999999998 78-79 19.8625 30.6875 30.225 19.225 80-81 18.987499999999997 31.225 30.175 19.6125 82-83 19.3 30.362499999999997 30.6375 19.7 84-85 19.675 31.937500000000004 29.7375 18.65 86-87 19.0125 31.387500000000003 30.975 18.625 88-89 19.5875 30.25 30.95 19.2125 90-91 18.512500000000003 32.45 30.0875 18.95 92-93 19.525000000000002 31.25 29.9 19.325 94-95 18.575 31.5625 30.5125 19.35 96-97 18.7375 31.125000000000004 31.087500000000002 19.05 98-99 19.275000000000002 31.5 30.412499999999998 18.8125 100 19.950000000000003 30.4 30.575000000000003 19.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.5 2 1.5 3 0.0 4 0.5 5 1.5 6 1.0 7 1.0 8 1.5 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 1.5 15 2.5 16 2.5 17 1.0 18 2.5 19 3.0 20 2.5 21 6.0 22 7.0 23 8.5 24 10.5 25 13.5 26 20.5 27 30.0 28 42.5 29 66.5 30 101.0 31 123.0 32 144.5 33 185.0 34 199.0 35 196.5 36 222.5 37 242.5 38 238.5 39 243.0 40 246.0 41 224.0 42 190.5 43 165.0 44 163.5 45 153.0 46 135.0 47 120.0 48 106.5 49 87.0 50 63.5 51 51.0 52 40.0 53 33.5 54 23.5 55 15.5 56 12.0 57 9.0 58 6.5 59 4.0 60 2.5 61 4.0 62 4.0 63 1.5 64 2.0 65 2.5 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.05 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06518443658413 98.02499999999999 2 0.833754421424962 1.6500000000000001 3 0.07579585649317837 0.22499999999999998 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593409 spots for SRR3473012.sra Written 593409 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra Read 593396 spots for SRR3473012.sra Written 593396 spots for SRR3473012.sra SRR ids: ['SRR3473012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tcb3rv5r SRR3473012.sra spots: 11867933 blocks: [[1, 593396], [593397, 1186792], [1186793, 1780188], [1780189, 2373584], [2373585, 2966980], [2966981, 3560376], [3560377, 4153772], [4153773, 4747168], [4747169, 5340564], [5340565, 5933960], [5933961, 6527356], [6527357, 7120752], [7120753, 7714148], [7714149, 8307544], [8307545, 8900940], [8900941, 9494336], [9494337, 10087732], [10087733, 10681128], [10681129, 11274524], [11274525, 11867933]] SRR3473012 file size 3089291 SRR3473012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473012 SRR3473012_1.fastq Input file: SRR3473012_1.fastq trimmed: SRR3473012-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 00:46:33 2025 >> started Fri Feb 14 00:46:39 2025 >> done (6.093s) 11867933 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 11867933 (100.00%) reads available; of these: 670631 ( 5.65%) trimmed reads available after processing 11197302 (94.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 1564 0.01% 52 2321 0.02% 53 2786 0.02% 54 3335 0.03% 55 3851 0.03% 56 4370 0.04% 57 4662 0.04% 58 4946 0.04% 59 5264 0.04% 60 5638 0.05% 61 5757 0.05% 62 5810 0.05% 63 6142 0.05% 64 6360 0.05% 65 6600 0.06% 66 6700 0.06% 67 6836 0.06% 68 6980 0.06% 69 7397 0.06% 70 7441 0.06% 71 7538 0.06% 72 8186 0.07% 73 8303 0.07% 74 8641 0.07% 75 8941 0.08% 76 6061 0.05% 77 6798 0.06% 78 7573 0.06% 79 8035 0.07% 80 8529 0.07% 81 9036 0.08% 82 9768 0.08% 83 10383 0.09% 84 10700 0.09% 85 12175 0.10% 86 12790 0.11% 87 13758 0.12% 88 14881 0.13% 89 16381 0.14% 90 18389 0.15% 91 20216 0.17% 92 22979 0.19% 93 26339 0.22% 94 30256 0.25% 95 34839 0.29% 96 41918 0.35% 97 49078 0.41% 98 59621 0.50% 99 73757 0.62% 100 11197302 94.35% 11867933 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=13.35 fanout-score-rank=19 prefix-density=0.20 prefix-fanout=6.9 sequence=TTTTTTCTCTCTCAAGACTCACAGTAACAATACACGAAACAAAACAAAAGGGAAGCAAGAAATGAAACTAAAAGGACCTTGGCTTTGCAACAATGGTGGAGTGTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=350.15 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=23.3 sequence=TTTTTTTTCTAGTGATAATCAGCAACACTGGTAGACAGGACCTCGACCTCCTCCACACCTAATGCATGGAAGCAGTGCAAGATTTTTAGTCGCTGTCACTGCTGCTGCTATGGCCATCTTCATTCTTCTTCTTGTCCTTTTTCTTC Started job on | Feb 14 00:47:09 Started mapping on | Feb 14 00:47:10 Finished on | Feb 14 00:47:21 Mapping speed, Million of reads per hour | 3884.05 Number of input reads | 11867933 Average input read length | 91 UNIQUE READS: Uniquely mapped reads number | 11354833 Uniquely mapped reads % | 95.68% Average mapped length | 90.64 Number of splices: Total | 859344 Number of splices: Annotated (sjdb) | 777379 Number of splices: GT/AG | 797055 Number of splices: GC/AG | 11494 Number of splices: AT/AC | 1101 Number of splices: Non-canonical | 49694 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.05% Deletion average length | 1.85 Insertion rate per base | 0.05% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255397 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 38637 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 257703 257703 257703 N_multimapping 255397 255397 255397 N_noFeature 639834 5792054 6062086 N_ambiguous 182069 21883 20077 UnstrandedReadsAssigned:10532930 PositiveStrandReadsAssigned:5540896 NegativeStrandReadsAssigned:5272670 Dataset is classified unstranded MeadianReadLen=92 20thPercentileLength=92 echo kmer=87 SRR3473012 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473012-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,867,933 reads, 10,851,745 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR3473012.ke.tsv 34699 SRR3473012.se.tsv 87100 total ==> SRR3473012.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 452 26.9201 Potri.005G024800.1.v4.1 1035 936 189 23.078 Potri.004G059700.1.v4.1 961 862 13 1.72365 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 184.123 7.39931 Potri.016G087400.1.v4.1 270 171 110 73.5207 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 136 17.7034 ==> SRR3473012.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 169 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 485 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473012 completed mapping pipeline successfully