Starting /dee2/code/volunteer_pipeline.sh SRR3473013 current disk space = 3088048967680 free memory = 1494367916 SRR3473013 SRAfilesize 83119c41338d9b8036c423831d8ab003 SRR3473013.sra SRR3473013.sra file validated SRR3473013 is single end SRR3473013 is conventional basespace SRR3473013 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.141 34.0 31.0 34.0 30.0 34.0 2 32.49325 34.0 31.0 34.0 31.0 34.0 3 30.68675 34.0 31.0 34.0 25.0 34.0 4 35.45875 37.0 35.0 37.0 33.0 37.0 5 35.86675 37.0 35.0 37.0 35.0 37.0 6 36.12975 37.0 35.0 37.0 35.0 37.0 7 36.15975 37.0 36.0 37.0 35.0 37.0 8 36.1955 37.0 37.0 37.0 35.0 37.0 9 38.099 39.0 39.0 39.0 37.0 39.0 10-11 38.073750000000004 39.0 38.0 39.0 37.0 39.0 12-13 38.040875 39.0 38.5 39.0 35.0 39.0 14-15 39.492000000000004 41.0 39.0 41.0 37.0 41.0 16-17 39.410375 41.0 39.0 41.0 36.0 41.0 18-19 39.338499999999996 41.0 39.0 41.0 36.0 41.0 20-21 39.232875 41.0 39.0 41.0 36.0 41.0 22-23 39.292125 41.0 39.0 41.0 36.0 41.0 24-25 39.191125 41.0 39.0 41.0 36.0 41.0 26-27 39.2555 41.0 39.0 41.0 36.0 41.0 28-29 39.063125 40.0 39.0 41.0 36.0 41.0 30-31 38.970749999999995 40.0 39.0 41.0 35.5 41.0 32-33 38.936125000000004 40.0 38.0 41.0 35.0 41.0 34-35 38.68325 40.0 38.0 41.0 35.0 41.0 36-37 38.819375 40.0 38.5 41.0 34.5 41.0 38-39 38.983374999999995 40.0 39.0 41.0 35.0 41.0 40-41 39.259 41.0 39.0 41.0 35.5 41.0 42-43 39.165 41.0 39.0 41.0 35.5 41.0 44-45 39.03675 40.5 39.0 41.0 35.0 41.0 46-47 39.020250000000004 40.0 39.0 41.0 35.0 41.0 48-49 38.84675 40.0 38.5 41.0 35.0 41.0 50-51 38.828 40.0 38.5 41.0 35.0 41.0 52-53 38.85625 40.0 38.0 41.0 35.0 41.0 54-55 38.62975 40.0 38.0 41.0 34.5 41.0 56-57 38.606375 40.0 38.0 41.0 34.0 41.0 58-59 38.400999999999996 40.0 38.0 41.0 34.0 41.0 60-61 38.166624999999996 40.0 37.5 41.0 34.0 41.0 62-63 37.786 40.0 37.0 41.0 33.0 41.0 64-65 37.57725 39.5 36.5 41.0 32.5 41.0 66-67 37.439125000000004 39.0 36.0 41.0 33.0 41.0 68-69 37.1475 39.0 36.0 41.0 32.5 41.0 70-71 36.942625 38.5 35.5 40.0 32.5 41.0 72-73 36.456625 37.0 35.0 39.5 32.0 41.0 74-75 35.887125 37.0 35.0 39.0 31.0 41.0 76-77 34.2255 35.5 33.0 37.5 29.5 39.0 78-79 34.995875 36.0 34.0 37.5 31.0 39.0 80-81 34.8735 36.0 34.5 37.0 31.0 39.0 82-83 34.513875 35.0 34.0 37.0 31.0 39.0 84-85 34.241875 35.0 34.0 36.5 31.0 37.5 86-87 33.896625 35.0 34.0 36.0 31.0 37.0 88-89 33.657624999999996 35.0 34.0 36.0 31.0 37.0 90-91 33.432 35.0 34.0 35.5 30.5 36.5 92-93 33.086875000000006 35.0 34.0 35.0 30.0 36.0 94-95 32.891625 35.0 34.0 35.0 30.0 36.0 96-97 32.601375 35.0 34.0 35.0 29.0 36.0 98-99 32.260125 35.0 34.0 35.0 29.0 36.0 100 31.9975 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.4262746783285749 1101 2 0.18026239288151658 1101 3 2.4494678834146484 1101 4 0.91249778811396 1101 5 0.4028286862660835 1101 6 0.16136656639449853 1101 7 0.053325412674738004 1101 8 0.04201319548017324 1101 9 -0.0585454637377083 1101 10-11 -0.29395965519857015 1101 12-13 -0.09498470638792611 1101 14-15 -0.36046790869334444 1101 16-17 -0.27537349275765166 1101 18-19 -0.0049230263656809825 1101 20-21 -0.0058141004575418265 1101 22-23 -0.015843423746808583 1101 24-25 -0.23624838848302687 1101 26-27 0.023180565737249026 1101 28-29 0.2782363052655512 1101 30-31 -0.06805657372532892 1101 32-33 0.16161303369650426 1101 34-35 -0.18103339315958777 1101 36-37 -0.18390252534189244 1101 38-39 -0.23229227230213212 1101 40-41 0.01214009454233178 1101 42-43 -0.2647817184458674 1101 44-45 -0.11273667180667246 1101 46-47 -0.08441189109937142 1101 48-49 -0.18933744533481445 1101 50-51 -0.08221896407896878 1101 52-53 0.050254050911298975 1101 54-55 -0.012576152076647418 1101 56-57 -0.21845850501782138 1101 58-59 -0.008348289896105143 1101 60-61 -0.22324881822088827 1101 62-63 -0.5553540281604725 1101 64-65 -0.1347733764756427 1101 66-67 -0.10436310321292552 1101 68-69 -0.047138451426981476 1101 70-71 -0.17157916024166298 1101 72-73 -0.2848403650243938 1101 74-75 -0.524678328572513 1101 76-77 -0.6842564271088776 1101 78-79 -0.37775221820571403 1101 80-81 -0.4657663237190022 1101 82-83 -0.39507444576455697 1101 84-85 -0.4716878586415234 1101 86-87 -0.3631411309689341 1101 88-89 -0.21229050279329442 1101 90-91 -0.4671124143684082 1101 92-93 -0.39578856897292525 1101 94-95 -0.61972623170454 1101 96-97 -0.630526555271878 1101 98-99 -0.43349174650522215 1101 100 -0.6176596981723499 1103 1 -0.42627467832857135 1103 2 -0.18026239288151658 1103 3 -2.449467883414645 1103 4 -0.9124977881139529 1103 5 -0.4028286862660835 1103 6 -0.16136656639450564 1103 7 -0.053325412674738004 1103 8 -0.04201319548016613 1103 9 0.0585454637377083 1103 10-11 0.29395965519856304 1103 12-13 0.09498470638792611 1103 14-15 0.36046790869334444 1103 16-17 0.27537349275765877 1103 18-19 0.0049230263656809825 1103 20-21 0.0058141004575418265 1103 22-23 0.015843423746808583 1103 24-25 0.23624838848302687 1103 26-27 -0.02318056573725613 1103 28-29 -0.2782363052655512 1103 30-31 0.06805657372532181 1103 32-33 -0.16161303369650426 1103 34-35 0.18103339315958777 1103 36-37 0.18390252534189244 1103 38-39 0.23229227230213212 1103 40-41 -0.01214009454233178 1103 42-43 0.2647817184458603 1103 44-45 0.11273667180666536 1103 46-47 0.08441189109937142 1103 48-49 0.18933744533482155 1103 50-51 0.08221896407896878 1103 52-53 -0.05025405091129187 1103 54-55 0.012576152076640312 1103 56-57 0.21845850501782138 1103 58-59 0.008348289896105143 1103 60-61 0.22324881822088827 1103 62-63 0.5553540281604654 1103 64-65 0.1347733764756427 1103 66-67 0.10436310321291842 1103 68-69 0.047138451426981476 1103 70-71 0.17157916024166298 1103 72-73 0.2848403650243867 1103 74-75 0.524678328572513 1103 76-77 0.6842564271088776 1103 78-79 0.37775221820571403 1103 80-81 0.4657663237190022 1103 82-83 0.39507444576455697 1103 84-85 0.4716878586415163 1103 86-87 0.3631411309689341 1103 88-89 0.21229050279329442 1103 90-91 0.4671124143684082 1103 92-93 0.39578856897292525 1103 94-95 0.6197262317045471 1103 96-97 0.6305265552718708 1103 98-99 0.43349174650522215 1103 100 0.6176596981723499 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 7.0 17 1.0 18 2.0 19 2.0 20 7.0 21 3.0 22 10.0 23 11.0 24 8.0 25 12.0 26 17.0 27 31.0 28 40.0 29 44.0 30 58.0 31 67.0 32 58.0 33 100.0 34 134.0 35 190.0 36 342.0 37 729.0 38 1563.0 39 563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.1386787695411 17.322239031770046 20.927887039838627 36.61119515885023 2 20.349999999999998 26.25 38.0 15.4 3 22.075 28.275 29.475 20.175 4 21.725 36.1 23.3 18.875 5 21.335667833916958 36.343171585792895 26.263131565782892 16.05802901450725 6 16.475 40.6 27.750000000000004 15.174999999999999 7 13.525 18.15 51.025 17.299999999999997 8 18.275 25.275 32.925 23.525 9 20.1 23.75 34.625 21.525 10-11 19.7625 36.3875 25.974999999999998 17.875 12-13 17.3875 30.1375 34.0 18.475 14-15 19.525000000000002 30.75 31.775 17.95 16-17 18.4 31.112499999999997 31.874999999999996 18.6125 18-19 19.85 30.112499999999997 31.225 18.8125 20-21 19.35 30.825000000000003 30.45 19.375 22-23 20.0125 30.2 31.125000000000004 18.6625 24-25 19.2625 32.3625 29.299999999999997 19.075 26-27 19.375 31.6 30.349999999999998 18.675 28-29 19.4375 31.412499999999998 30.612499999999997 18.5375 30-31 19.7625 31.362499999999997 29.5 19.375 32-33 18.975 30.662499999999998 30.75 19.6125 34-35 19.675 31.85 30.2 18.275 36-37 19.412499999999998 31.2625 31.387500000000003 17.9375 38-39 19.5875 32.0125 29.425 18.975 40-41 18.875 31.125000000000004 30.337500000000002 19.662499999999998 42-43 19.05 31.837500000000002 30.3875 18.725 44-45 19.4625 30.975 30.412499999999998 19.15 46-47 19.85 31.775 29.975 18.4 48-49 19.025 31.112499999999997 30.275000000000002 19.5875 50-51 18.6875 31.6 30.599999999999998 19.112499999999997 52-53 19.1875 31.6875 30.012499999999996 19.112499999999997 54-55 19.4875 30.837500000000002 31.4375 18.2375 56-57 19.4375 31.15 29.7 19.7125 58-59 19.075 31.65 30.15 19.125 60-61 19.662499999999998 30.575000000000003 30.9875 18.775 62-63 19.1875 30.012499999999996 31.874999999999996 18.925 64-65 18.5 30.2 31.35 19.950000000000003 66-67 18.787499999999998 31.175000000000004 30.85 19.1875 68-69 19.3625 29.775000000000002 31.2625 19.6 70-71 18.387500000000003 32.0625 30.1875 19.3625 72-73 19.35 30.8 30.525000000000002 19.325 74-75 18.15 31.9875 31.0125 18.85 76-77 18.8125 31.5125 31.2625 18.4125 78-79 19.05 30.7625 30.525000000000002 19.662499999999998 80-81 19.1375 31.424999999999997 30.75 18.6875 82-83 19.6125 30.612499999999997 30.362499999999997 19.412499999999998 84-85 18.475 30.2125 31.8625 19.45 86-87 19.2 31.937500000000004 30.1875 18.675 88-89 19.025 31.937500000000004 30.125 18.912499999999998 90-91 19.2625 29.9 31.075000000000003 19.7625 92-93 18.725 31.8 29.325000000000003 20.150000000000002 94-95 19.225 31.7125 30.0875 18.975 96-97 18.55 30.725 31.05 19.675 98-99 18.6625 31.637500000000003 31.05 18.65 100 17.875 32.0 30.775000000000002 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 1.0 8 2.5 9 2.5 10 1.5 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 2.0 18 4.0 19 3.5 20 3.0 21 3.5 22 5.5 23 9.5 24 12.5 25 20.0 26 24.5 27 33.5 28 52.0 29 76.5 30 98.0 31 118.5 32 150.5 33 170.5 34 191.0 35 223.0 36 235.0 37 257.0 38 277.5 39 261.5 40 231.0 41 219.0 42 201.5 43 179.5 44 159.0 45 136.5 46 126.0 47 105.0 48 82.5 49 70.0 50 58.0 51 45.0 52 35.5 53 25.0 54 17.0 55 11.5 56 10.5 57 11.0 58 10.0 59 6.0 60 3.0 61 1.5 62 2.0 63 1.0 64 0.0 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09021986353298 98.02499999999999 2 0.7834217841799342 1.55 3 0.10108668182966893 0.3 4 0.0 0.0 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983211 spots for SRR3473013.sra Written 983211 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra Read 983210 spots for SRR3473013.sra Written 983210 spots for SRR3473013.sra SRR ids: ['SRR3473013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o9ptb2nc SRR3473013.sra spots: 19664201 blocks: [[1, 983210], [983211, 1966420], [1966421, 2949630], [2949631, 3932840], [3932841, 4916050], [4916051, 5899260], [5899261, 6882470], [6882471, 7865680], [7865681, 8848890], [8848891, 9832100], [9832101, 10815310], [10815311, 11798520], [11798521, 12781730], [12781731, 13764940], [13764941, 14748150], [14748151, 15731360], [15731361, 16714570], [16714571, 17697780], [17697781, 18680990], [18680991, 19664201]] SRR3473013 file size 5125842 SRR3473013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473013 SRR3473013_1.fastq Input file: SRR3473013_1.fastq trimmed: SRR3473013-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 01:58:32 2025 >> started Fri Feb 14 01:58:42 2025 >> done (9.630s) 19664201 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 19664201 (100.00%) reads available; of these: 1087726 ( 5.53%) trimmed reads available after processing 18576475 (94.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 2387 0.01% 52 3496 0.02% 53 4207 0.02% 54 4833 0.02% 55 5832 0.03% 56 6483 0.03% 57 6923 0.04% 58 7421 0.04% 59 8011 0.04% 60 8488 0.04% 61 8659 0.04% 62 8828 0.04% 63 9287 0.05% 64 9681 0.05% 65 10235 0.05% 66 10399 0.05% 67 10663 0.05% 68 10550 0.05% 69 11241 0.06% 70 11386 0.06% 71 12142 0.06% 72 12564 0.06% 73 13544 0.07% 74 13678 0.07% 75 14219 0.07% 76 9766 0.05% 77 10723 0.05% 78 11844 0.06% 79 12608 0.06% 80 13735 0.07% 81 14808 0.08% 82 15855 0.08% 83 16391 0.08% 84 17673 0.09% 85 19055 0.10% 86 20504 0.10% 87 22244 0.11% 88 24574 0.12% 89 27028 0.14% 90 29978 0.15% 91 33773 0.17% 92 37813 0.19% 93 43708 0.22% 94 49845 0.25% 95 58055 0.30% 96 69826 0.36% 97 81893 0.42% 98 98967 0.50% 99 121902 0.62% 100 18576475 94.47% 19664201 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=35 prefix-density=0.47 prefix-fanout=1.2 sequence=ATTGATTGATTTATTTTGTTCTACATAAGTTGTACATCATCCATGAAATAGACTAGTTCCATAATCAGCCATTTTATTTTTAACTCGATCTATCACGATCAGCTTGGCTTTGAAACAGCTTTTTCCCACAATGAAGTCTTCAAACCTGGTCGTATTGAATTACGACTTTGCCAGCATTAGGATCAGCGATCCGGGAGAAAGCATCTTTCGAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=140.26 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=11.0 sequence=TTTTCTTTTCTTTT Started job on | Feb 14 01:58:59 Started mapping on | Feb 14 01:58:59 Finished on | Feb 14 01:59:19 Mapping speed, Million of reads per hour | 3539.56 Number of input reads | 19664201 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18745138 Uniquely mapped reads % | 95.33% Average mapped length | 98.37 Number of splices: Total | 1512654 Number of splices: Annotated (sjdb) | 1355293 Number of splices: GT/AG | 1390216 Number of splices: GC/AG | 19187 Number of splices: AT/AC | 1766 Number of splices: Non-canonical | 101485 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.05% Deletion average length | 1.87 Insertion rate per base | 0.05% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485630 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 58108 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 433433 433433 433433 N_multimapping 485630 485630 485630 N_noFeature 1089895 9599111 10015022 N_ambiguous 300992 42175 38729 UnstrandedReadsAssigned:17354251 PositiveStrandReadsAssigned:9103852 NegativeStrandReadsAssigned:8691387 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473013 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473013-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,664,201 reads, 17,968,324 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR3473013.ke.tsv 34699 SRR3473013.se.tsv 87100 total ==> SRR3473013.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2049 68.9783 Potri.005G024800.1.v4.1 1035 936 785 54.1801 Potri.004G059700.1.v4.1 961 862 13 0.974275 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 371.191 8.43166 Potri.016G087400.1.v4.1 270 171 178 67.2465 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14 0.540279 Potri.012G127500.1.v4.1 977 878 318 23.398 ==> SRR3473013.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 155 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 843 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473013 completed mapping pipeline successfully