Starting /dee2/code/volunteer_pipeline.sh SRR3473014 current disk space = 3087979393024 free memory = 1581926872 SRR3473014 SRAfilesize 1d5f364d70edfd4e2eb2bed7a730e468 SRR3473014.sra SRR3473014.sra file validated SRR3473014 is single end SRR3473014 is conventional basespace SRR3473014 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3473014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7875 33.0 31.0 34.0 28.0 34.0 2 32.436 34.0 31.0 34.0 30.0 34.0 3 29.72625 33.0 30.0 34.0 16.0 34.0 4 34.725 37.0 35.0 37.0 30.0 37.0 5 35.686 37.0 35.0 37.0 33.0 37.0 6 35.98 37.0 35.0 37.0 35.0 37.0 7 36.0095 37.0 35.0 37.0 35.0 37.0 8 36.12275 37.0 36.0 37.0 35.0 37.0 9 38.09725 39.0 39.0 39.0 37.0 39.0 10-11 38.023624999999996 39.0 38.5 39.0 36.0 39.0 12-13 38.05975 39.0 38.5 39.0 35.0 39.0 14-15 39.413125 41.0 39.0 41.0 36.0 41.0 16-17 39.40325 41.0 39.0 41.0 36.0 41.0 18-19 39.478750000000005 41.0 39.0 41.0 36.5 41.0 20-21 39.278999999999996 41.0 39.0 41.0 36.0 41.0 22-23 39.365875 41.0 39.0 41.0 36.0 41.0 24-25 39.088625 41.0 39.0 41.0 35.5 41.0 26-27 39.116875 40.0 39.0 41.0 36.0 41.0 28-29 39.01575 40.0 39.0 41.0 35.5 41.0 30-31 38.728625 40.0 38.0 41.0 34.5 41.0 32-33 38.89875 40.0 38.5 41.0 35.0 41.0 34-35 38.687875 40.0 38.0 41.0 35.0 41.0 36-37 38.7415 40.0 38.0 41.0 34.5 41.0 38-39 38.734750000000005 40.0 38.5 41.0 34.5 41.0 40-41 38.803875 40.0 39.0 41.0 35.0 41.0 42-43 38.882125 41.0 39.0 41.0 35.0 41.0 44-45 38.8785 40.5 39.0 41.0 35.0 41.0 46-47 38.968999999999994 40.0 39.0 41.0 35.0 41.0 48-49 38.805375 40.0 38.0 41.0 35.0 41.0 50-51 38.80475 40.0 38.5 41.0 35.0 41.0 52-53 38.724875 40.0 38.0 41.0 35.0 41.0 54-55 38.69725 40.0 38.0 41.0 35.0 41.0 56-57 38.590125 40.0 38.0 41.0 34.0 41.0 58-59 38.41675 40.0 38.0 41.0 34.0 41.0 60-61 38.190375 40.0 37.5 41.0 34.0 41.0 62-63 37.79875 40.0 37.0 41.0 33.0 41.0 64-65 37.58475 39.5 36.5 41.0 32.5 41.0 66-67 37.447375 39.0 36.0 41.0 32.5 41.0 68-69 37.039625 39.0 36.0 40.5 32.0 41.0 70-71 36.778625 38.0 35.0 40.0 32.0 41.0 72-73 36.3625 37.0 35.0 39.5 32.0 41.0 74-75 35.789875 37.0 35.0 39.0 31.5 41.0 76-77 34.029875000000004 35.5 33.0 37.5 28.5 39.0 78-79 34.706625 36.0 34.0 37.5 30.0 39.0 80-81 34.756625 36.0 34.0 37.0 31.0 39.0 82-83 34.512125 35.0 34.0 37.0 31.0 39.0 84-85 34.148624999999996 35.0 34.0 36.0 31.0 37.5 86-87 33.83275 35.0 34.0 36.0 31.0 37.0 88-89 33.53725 35.0 34.0 36.0 30.0 37.0 90-91 33.32225 35.0 34.0 35.0 30.5 36.0 92-93 33.051 35.0 34.0 35.0 29.0 36.0 94-95 32.725 35.0 34.0 35.0 29.0 36.0 96-97 32.578374999999994 35.0 34.0 35.0 29.0 36.0 98-99 32.413375 35.0 34.0 35.0 29.0 36.0 100 32.06325 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.37449494949494877 1101 2 0.2964646464646421 1101 3 3.1103535353535356 1101 4 1.3141414141414103 1101 5 0.5522727272727224 1101 6 0.41060606060605664 1101 7 0.36843434343434467 1101 8 0.17474747474746977 1101 9 0.16237373737374128 1101 10-11 0.13838383838383805 1101 12-13 0.06994949494949765 1101 14-15 0.10113636363636402 1101 16-17 0.04292929292929415 1101 18-19 -0.022095959595965553 1101 20-21 -0.3257575757575708 1101 22-23 -0.06641414141413549 1101 24-25 -0.037878787878788955 1101 26-27 0.011868686868687917 1101 28-29 0.07500000000000284 1101 30-31 0.3463383838383862 1101 32-33 0.01136363636364024 1101 34-35 -0.23686868686868934 1101 36-37 -0.16237373737373417 1101 38-39 -0.2367424242424292 1101 40-41 0.4135101010101039 1101 42-43 0.25265151515151985 1101 44-45 -0.1398989898989882 1101 46-47 0.024116161616163367 1101 48-49 -0.1618686868686865 1101 50-51 0.28396464646464636 1101 52-53 -0.06994949494949765 1101 54-55 -0.07247474747475025 1101 56-57 0.02222222222221859 1101 58-59 0.25378787878787534 1101 60-61 -0.13800505050505052 1101 62-63 -0.26060606060606517 1101 64-65 -0.2559343434343404 1101 66-67 -0.06515151515151274 1101 68-69 0.2553030303030326 1101 70-71 0.2181818181818187 1101 72-73 -0.23320707070706703 1101 74-75 -0.05959595959595276 1101 76-77 -0.2604797979797908 1101 78-79 -0.09255050505050377 1101 80-81 0.08623737373737583 1101 82-83 0.033964646464646364 1101 84-85 -0.04671717171716949 1101 86-87 -0.08282828282828092 1101 88-89 -0.18813131313131493 1101 90-91 0.14494949494949338 1101 92-93 0.45000000000000284 1101 94-95 0.2092171717171709 1101 96-97 0.39570707070707556 1101 98-99 0.5281565656565661 1101 100 0.45984848484848584 1104 1 -0.37449494949494877 1104 2 -0.2964646464646492 1104 3 -3.1103535353535356 1104 4 -1.3141414141414174 1104 5 -0.5522727272727295 1104 6 -0.41060606060606375 1104 7 -0.36843434343434467 1104 8 -0.17474747474747687 1104 9 -0.16237373737373417 1104 10-11 -0.13838383838383805 1104 12-13 -0.06994949494949765 1104 14-15 -0.10113636363636402 1104 16-17 -0.04292929292929415 1104 18-19 0.022095959595958448 1104 20-21 0.3257575757575779 1104 22-23 0.06641414141414259 1104 24-25 0.037878787878788955 1104 26-27 -0.011868686868680811 1104 28-29 -0.07500000000000284 1104 30-31 -0.3463383838383862 1104 32-33 -0.01136363636364024 1104 34-35 0.23686868686868934 1104 36-37 0.16237373737373417 1104 38-39 0.2367424242424221 1104 40-41 -0.4135101010100968 1104 42-43 -0.25265151515151274 1104 44-45 0.1398989898989953 1104 46-47 -0.024116161616156262 1104 48-49 0.1618686868686865 1104 50-51 -0.28396464646464636 1104 52-53 0.06994949494949765 1104 54-55 0.07247474747475025 1104 56-57 -0.02222222222221859 1104 58-59 -0.25378787878787534 1104 60-61 0.13800505050505052 1104 62-63 0.26060606060606517 1104 64-65 0.2559343434343475 1104 66-67 0.06515151515151985 1104 68-69 -0.2553030303030326 1104 70-71 -0.2181818181818187 1104 72-73 0.23320707070706703 1104 74-75 0.05959595959595987 1104 76-77 0.2604797979797979 1104 78-79 0.09255050505050377 1104 80-81 -0.08623737373736873 1104 82-83 -0.033964646464646364 1104 84-85 0.04671717171716949 1104 86-87 0.08282828282828802 1104 88-89 0.18813131313131493 1104 90-91 -0.14494949494949338 1104 92-93 -0.44999999999999574 1104 94-95 -0.2092171717171709 1104 96-97 -0.39570707070706845 1104 98-99 -0.5281565656565625 1104 100 -0.45984848484848584 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 4.0 18 10.0 19 5.0 20 10.0 21 9.0 22 4.0 23 14.0 24 18.0 25 15.0 26 16.0 27 32.0 28 26.0 29 35.0 30 50.0 31 56.0 32 87.0 33 93.0 34 139.0 35 202.0 36 348.0 37 763.0 38 1526.0 39 535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.594907990925133 19.35971767078397 16.13309805898664 43.91227627930426 2 18.275 25.6 42.15 13.975000000000001 3 20.325 29.4 30.95 19.325 4 21.375 35.5 24.099999999999998 19.025 5 23.50587646911728 37.33433358339585 24.90622655663916 14.253563390847713 6 17.5 39.324999999999996 27.975 15.2 7 14.875 18.625 49.525000000000006 16.975 8 16.425 25.174999999999997 34.975 23.425 9 17.825 24.725 36.65 20.8 10-11 19.4875 36.5375 26.1125 17.8625 12-13 17.8875 29.3875 34.525 18.2 14-15 18.7625 30.562499999999996 33.1125 17.5625 16-17 19.875 30.8 30.862499999999997 18.462500000000002 18-19 21.099999999999998 29.612500000000004 30.9875 18.3 20-21 19.7125 31.0625 30.325000000000003 18.9 22-23 19.85 31.874999999999996 29.4375 18.8375 24-25 20.150000000000002 32.7 29.312500000000004 17.837500000000002 26-27 19.5875 31.612499999999997 30.5375 18.2625 28-29 19.4875 30.7375 30.575000000000003 19.2 30-31 18.775 31.8125 30.599999999999998 18.8125 32-33 18.8125 32.8125 30.1375 18.2375 34-35 20.0125 32.1 29.4 18.4875 36-37 19.9625 31.0 30.425 18.6125 38-39 19.775000000000002 31.5 29.775000000000002 18.95 40-41 19.6125 31.2375 29.3375 19.8125 42-43 20.200000000000003 30.825000000000003 30.375000000000004 18.6 44-45 19.650000000000002 30.7625 30.375000000000004 19.2125 46-47 19.175 31.05 30.225 19.55 48-49 19.725 31.324999999999996 29.912499999999998 19.037499999999998 50-51 19.7 31.05 30.012499999999996 19.2375 52-53 18.775 30.575000000000003 30.2625 20.3875 54-55 19.775000000000002 31.025000000000002 30.025000000000002 19.175 56-57 19.05 31.0375 30.587500000000002 19.325 58-59 19.162499999999998 30.15 30.925000000000004 19.7625 60-61 19.662499999999998 30.7125 31.5375 18.087500000000002 62-63 18.7625 31.275 30.925000000000004 19.037499999999998 64-65 18.3625 31.25 30.4875 19.900000000000002 66-67 19.6375 31.4375 30.5125 18.4125 68-69 19.400000000000002 30.7125 30.7875 19.1 70-71 19.1875 31.900000000000002 30.312499999999996 18.6 72-73 19.125 31.162499999999998 30.887500000000003 18.825 74-75 19.025 31.35 31.137500000000003 18.4875 76-77 19.287499999999998 31.175000000000004 30.25 19.287499999999998 78-79 18.475 30.6875 31.175000000000004 19.662499999999998 80-81 18.875 31.75 30.525000000000002 18.85 82-83 18.875 32.1625 30.2625 18.7 84-85 18.75 31.275 30.375000000000004 19.6 86-87 19.3 31.0125 29.762499999999996 19.925 88-89 18.775 32.475 29.9875 18.7625 90-91 19.45 31.5375 30.25 18.7625 92-93 17.599999999999998 31.2375 31.612499999999997 19.55 94-95 18.725 30.7125 30.837500000000002 19.725 96-97 19.175 30.725 30.887500000000003 19.2125 98-99 19.0875 32.074999999999996 30.65 18.1875 100 19.575 31.075000000000003 30.75 18.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.0 3 3.0 4 2.0 5 1.0 6 1.5 7 1.5 8 2.5 9 2.0 10 0.5 11 0.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.5 17 1.5 18 3.0 19 4.0 20 5.0 21 6.0 22 8.5 23 13.5 24 13.5 25 13.5 26 23.0 27 31.5 28 52.5 29 77.0 30 97.5 31 125.0 32 146.5 33 167.5 34 179.0 35 202.5 36 241.0 37 260.5 38 254.0 39 255.0 40 263.0 41 236.0 42 195.5 43 179.0 44 163.5 45 136.5 46 118.0 47 102.5 48 86.0 49 76.0 50 63.0 51 40.5 52 29.5 53 26.5 54 22.0 55 17.0 56 8.5 57 4.5 58 6.0 59 4.0 60 4.0 61 6.0 62 4.5 63 1.5 64 0.0 65 0.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra Read 864851 spots for SRR3473014.sra Written 864851 spots for SRR3473014.sra Read 864836 spots for SRR3473014.sra Written 864836 spots for SRR3473014.sra SRR ids: ['SRR3473014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v8r1k4zd SRR3473014.sra spots: 17296735 blocks: [[1, 864836], [864837, 1729672], [1729673, 2594508], [2594509, 3459344], [3459345, 4324180], [4324181, 5189016], [5189017, 6053852], [6053853, 6918688], [6918689, 7783524], [7783525, 8648360], [8648361, 9513196], [9513197, 10378032], [10378033, 11242868], [11242869, 12107704], [12107705, 12972540], [12972541, 13837376], [13837377, 14702212], [14702213, 15567048], [15567049, 16431884], [16431885, 17296735]] SRR3473014 file size 4507403 SRR3473014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3473014 SRR3473014_1.fastq Input file: SRR3473014_1.fastq trimmed: SRR3473014-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 02:43:32 2025 >> started Fri Feb 14 02:43:41 2025 >> done (9.002s) 17296735 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 17296735 (100.00%) reads available; of these: 965406 ( 5.58%) trimmed reads available after processing 16331329 (94.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 49 1 0.00% 50 0 0.00% 51 2222 0.01% 52 3136 0.02% 53 3753 0.02% 54 4523 0.03% 55 5050 0.03% 56 5977 0.03% 57 6364 0.04% 58 6736 0.04% 59 7165 0.04% 60 7774 0.04% 61 8007 0.05% 62 8142 0.05% 63 8414 0.05% 64 9045 0.05% 65 9259 0.05% 66 9372 0.05% 67 9701 0.06% 68 9754 0.06% 69 10227 0.06% 70 10331 0.06% 71 10798 0.06% 72 11397 0.07% 73 11729 0.07% 74 12247 0.07% 75 12603 0.07% 76 8559 0.05% 77 9593 0.06% 78 10584 0.06% 79 11409 0.07% 80 12368 0.07% 81 13102 0.08% 82 13806 0.08% 83 14886 0.09% 84 15806 0.09% 85 17026 0.10% 86 18261 0.11% 87 19884 0.11% 88 21658 0.13% 89 23907 0.14% 90 26459 0.15% 91 29278 0.17% 92 33370 0.19% 93 38110 0.22% 94 44197 0.26% 95 50766 0.29% 96 61642 0.36% 97 71826 0.42% 98 87046 0.50% 99 108136 0.63% 100 16331329 94.42% 17296735 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=6.38 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=1.9 sequence=TTCCATGGAATTATGTATCTTTAATCGGAAGCTTGATTCTGCTTTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=5 fanout-score=204.82 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=24.0 sequence=TTTTCTTTTCTTTT Started job on | Feb 14 02:44:02 Started mapping on | Feb 14 02:44:02 Finished on | Feb 14 02:44:21 Mapping speed, Million of reads per hour | 3277.28 Number of input reads | 17296735 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 16531927 Uniquely mapped reads % | 95.58% Average mapped length | 98.33 Number of splices: Total | 1173625 Number of splices: Annotated (sjdb) | 1026974 Number of splices: GT/AG | 1062455 Number of splices: GC/AG | 16245 Number of splices: AT/AC | 1663 Number of splices: Non-canonical | 93262 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.06% Deletion average length | 1.86 Insertion rate per base | 0.05% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351988 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 52223 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412820 412820 412820 N_multimapping 351988 351988 351988 N_noFeature 1018942 8480782 8840610 N_ambiguous 297576 35767 33150 UnstrandedReadsAssigned:15215409 PositiveStrandReadsAssigned:8015378 NegativeStrandReadsAssigned:7658167 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3473014 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3473014-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,296,735 reads, 15,742,449 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR3473014.ke.tsv 34699 SRR3473014.se.tsv 87100 total ==> SRR3473014.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1038 42.3256 Potri.005G024800.1.v4.1 1035 936 292 24.4111 Potri.004G059700.1.v4.1 961 862 35 3.17718 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 415.141 11.4221 Potri.016G087400.1.v4.1 270 171 239 109.366 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.0467439 Potri.012G127500.1.v4.1 977 878 349 31.1037 ==> SRR3473014.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 201 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 789 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 193 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3473014 completed mapping pipeline successfully