Starting /dee2/code/volunteer_pipeline.sh SRR3723576 current disk space = 3117823090688 free memory = 1573005444 SRR3723576 SRAfilesize a72ad588aea523d009b8c220b9d5e9a8 SRR3723576.sra SRR3723576.sra file validated SRR3723576 is paired end SRR3723576 is conventional basespace SRR3723576 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.947 34.0 33.0 34.0 31.0 34.0 2 33.20975 34.0 34.0 34.0 31.0 34.0 3 33.38125 34.0 34.0 34.0 31.0 34.0 4 36.6665 37.0 37.0 37.0 35.0 37.0 5 36.65225 37.0 37.0 37.0 35.0 37.0 6 36.653 37.0 37.0 37.0 35.0 37.0 7 36.62875 37.0 37.0 37.0 35.0 37.0 8 36.6455 37.0 37.0 37.0 35.0 37.0 9 38.5615 39.0 39.0 39.0 37.0 39.0 10-14 38.837149999999994 39.4 39.2 39.4 37.2 39.4 15-19 40.0804 41.0 40.0 41.0 38.0 41.0 20-24 40.115500000000004 41.0 40.0 41.0 38.0 41.0 25-29 39.94865 41.0 40.0 41.0 38.0 41.0 30-34 39.794 41.0 40.0 41.0 38.0 41.0 35-39 39.57665000000001 41.0 40.0 41.0 37.2 41.0 40-44 39.5318 40.8 39.6 41.0 37.2 41.0 45-49 39.7652 41.0 40.0 41.0 37.4 41.0 50-54 39.64685 41.0 40.0 41.0 36.8 41.0 55-59 39.31145 41.0 39.0 41.0 35.6 41.0 60-64 38.8362 40.0 37.6 41.0 35.0 41.0 65-69 37.9895 39.0 36.4 41.0 34.8 41.0 70-74 36.9405 37.4 35.2 39.4 34.0 41.0 75-79 35.498050000000006 36.0 34.6 37.4 32.8 39.2 80-84 35.0933 35.0 35.0 36.6 33.6 37.8 85-89 34.528000000000006 35.0 35.0 35.8 33.0 36.6 90-94 34.23245 35.0 35.0 35.0 33.0 36.0 95-99 34.0203 35.0 35.0 35.0 33.0 35.4 100-104 33.86855 35.0 34.2 35.0 32.2 35.0 105-109 33.717650000000006 35.0 34.0 35.0 31.6 35.0 110-114 33.7518 35.0 34.0 35.0 32.0 35.0 115-119 33.5564 35.0 34.0 35.0 31.2 35.0 120-124 33.4412 35.0 34.0 35.0 31.0 35.0 125-129 33.303549999999994 35.0 34.0 35.0 31.0 35.0 130-134 32.993449999999996 35.0 33.6 35.0 30.0 35.0 135-139 32.71759999999999 35.0 33.2 35.0 29.2 35.0 140-144 32.23165 34.4 33.0 35.0 28.2 35.0 145-149 31.779450000000004 34.2 33.0 35.0 27.4 35.0 150 25.758 32.0 19.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 3.0 14 4.0 15 2.0 16 5.0 17 2.0 18 2.0 19 6.0 20 3.0 21 5.0 22 4.0 23 5.0 24 6.0 25 9.0 26 10.0 27 21.0 28 23.0 29 32.0 30 33.0 31 53.0 32 68.0 33 86.0 34 133.0 35 372.0 36 1172.0 37 1902.0 38 34.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.5448798988622 11.327433628318584 7.914032869785083 41.21365360303413 2 22.25 14.299999999999999 34.825 28.625 3 19.025 16.85 25.924999999999997 38.2 4 23.25 24.675 22.975 29.099999999999998 5 23.549999999999997 30.525000000000002 23.65 22.275 6 19.575 34.325 24.175 21.925 7 14.499999999999998 27.474999999999998 40.150000000000006 17.875 8 17.075000000000003 26.150000000000002 32.15 24.625 9 18.55 25.1 34.075 22.275 10-14 19.36 30.615 27.339999999999996 22.685 15-19 19.814999999999998 28.425 27.779999999999998 23.98 20-24 20.435 28.63 28.025 22.91 25-29 20.1 28.910000000000004 27.36 23.630000000000003 30-34 20.325 29.635 27.01 23.03 35-39 19.634999999999998 29.325000000000003 27.060000000000002 23.98 40-44 19.585 28.99 27.82 23.605 45-49 19.955000000000002 28.935 27.495000000000005 23.615 50-54 19.885 28.804999999999996 27.62 23.69 55-59 20.075000000000003 28.860000000000003 27.36 23.705000000000002 60-64 19.900000000000002 29.125 27.084999999999997 23.89 65-69 19.400000000000002 29.23 27.860000000000003 23.51 70-74 19.865 29.285 27.79 23.06 75-79 20.07 28.499999999999996 27.97 23.46 80-84 20.19 28.494999999999997 27.994999999999997 23.32 85-89 19.86 29.049999999999997 27.445000000000004 23.645 90-94 19.689922480620154 28.982245561390346 27.881970492623154 23.44586146536634 95-99 19.541954195419542 28.902890289028903 27.547754775477546 24.007400740074008 100-104 19.814999999999998 28.349999999999998 27.894999999999996 23.94 105-109 19.845 28.084999999999997 28.02 24.05 110-114 20.396118835650697 28.258477543262977 27.608282484745423 23.737121136340903 115-119 19.855 29.175 27.58 23.39 120-124 20.28 28.994999999999997 26.395000000000003 24.33 125-129 20.150000000000002 28.735 26.96 24.154999999999998 130-134 20.200000000000003 28.549999999999997 26.995 24.255 135-139 20.611183355006503 28.84365309592878 26.582974892467742 23.96218865659698 140-144 21.175 28.95 26.22 23.655 145-149 21.81 29.29 25.21 23.69 150 17.95 33.625 23.875 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.0 22 0.0 23 1.5 24 2.0 25 2.5 26 5.0 27 5.5 28 9.0 29 15.0 30 23.0 31 29.0 32 34.0 33 46.0 34 62.0 35 72.0 36 95.0 37 120.5 38 135.5 39 156.0 40 180.5 41 225.0 42 245.5 43 241.5 44 250.5 45 268.5 46 272.0 47 259.5 48 231.5 49 209.5 50 180.5 51 144.0 52 120.5 53 92.0 54 74.0 55 56.0 56 37.0 57 25.0 58 15.0 59 9.5 60 8.5 61 5.0 62 5.5 63 5.5 64 4.5 65 3.5 66 3.0 67 3.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.025 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 4.675000000000001 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 7.2875 0.0 0.0 0.0 0.0 136-137 8.4125 0.0 0.0 0.0 0.0 138 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGACA 10 0.0067147487 145.81013 1 AGAGCAC 40 0.007970727 17.99844 140-144 >>END_MODULE SRR3723576 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723576_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66175 34.0 33.0 34.0 31.0 34.0 2 32.7205 34.0 33.0 34.0 31.0 34.0 3 32.813 34.0 33.0 34.0 31.0 34.0 4 36.0795 37.0 37.0 37.0 35.0 37.0 5 36.0775 37.0 37.0 37.0 35.0 37.0 6 36.11375 37.0 37.0 37.0 35.0 37.0 7 36.11475 37.0 37.0 37.0 35.0 37.0 8 36.0635 37.0 37.0 37.0 35.0 37.0 9 37.88625 39.0 39.0 39.0 37.0 39.0 10-14 38.21804999999999 39.4 39.2 39.4 37.2 39.4 15-19 39.47175 41.0 40.0 41.0 38.0 41.0 20-24 39.45005 41.0 40.0 41.0 38.0 41.0 25-29 39.3432 41.0 40.0 41.0 37.8 41.0 30-34 39.217200000000005 41.0 40.0 41.0 37.2 41.0 35-39 39.0817 41.0 40.0 41.0 36.8 41.0 40-44 38.905499999999996 41.0 39.4 41.0 36.0 41.0 45-49 38.87425 41.0 39.2 41.0 36.0 41.0 50-54 37.9978 39.8 38.0 40.6 34.6 40.8 55-59 38.35505 40.0 38.2 41.0 35.0 41.0 60-64 37.88125 39.8 37.2 41.0 34.2 41.0 65-69 37.3507 39.0 36.2 41.0 34.0 41.0 70-74 36.372 37.2 35.0 39.4 34.0 41.0 75-79 35.283 35.8 35.0 37.8 33.0 39.2 80-84 34.4659 35.0 35.0 36.4 33.0 37.8 85-89 33.9204 35.0 35.0 35.6 32.2 36.4 90-94 33.58445 35.0 34.8 35.0 32.0 36.0 95-99 33.324200000000005 35.0 34.0 35.0 31.0 35.4 100-104 33.29125 35.0 34.0 35.0 31.2 35.0 105-109 33.14229999999999 35.0 34.0 35.0 30.8 35.0 110-114 33.114050000000006 35.0 34.0 35.0 31.0 35.0 115-119 32.9739 35.0 34.0 35.0 30.0 35.0 120-124 32.86645 35.0 34.0 35.0 30.0 35.0 125-129 32.66975000000001 35.0 34.0 35.0 29.4 35.0 130-134 32.2882 35.0 33.2 35.0 28.6 35.0 135-139 32.002449999999996 35.0 33.0 35.0 27.4 35.0 140-144 31.619400000000002 34.8 32.8 35.0 26.2 35.0 145-149 30.826050000000002 34.0 32.0 35.0 23.0 35.0 150 27.28375 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 3.0 4 3.0 5 3.0 6 2.0 7 2.0 8 4.0 9 0.0 10 4.0 11 2.0 12 1.0 13 1.0 14 3.0 15 3.0 16 3.0 17 4.0 18 4.0 19 4.0 20 11.0 21 3.0 22 7.0 23 11.0 24 8.0 25 11.0 26 25.0 27 5.0 28 23.0 29 25.0 30 40.0 31 46.0 32 71.0 33 116.0 34 155.0 35 340.0 36 1225.0 37 1758.0 38 27.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 19.575 11.55 30.049999999999997 2 25.45 26.625 33.0 14.924999999999999 3 20.424999999999997 27.175 31.35 21.05 4 23.925 32.25 25.4 18.425 5 25.025 35.475 22.95 16.55 6 19.825 38.224999999999994 24.625 17.325 7 21.675 20.849999999999998 39.0 18.475 8 21.375 25.224999999999998 29.9 23.5 9 22.7 23.375 31.624999999999996 22.3 10-14 23.91 28.09 26.96 21.04 15-19 23.255 28.265 28.01 20.47 20-24 23.419999999999998 28.595 27.689999999999998 20.294999999999998 25-29 23.665 27.85 28.125 20.36 30-34 23.695923980995246 27.366841710427607 28.27706926731683 20.660165041260314 35-39 23.0 28.215 28.305000000000003 20.48 40-44 23.49 27.894999999999996 27.805000000000003 20.810000000000002 45-49 23.375518983542594 28.43779700865389 28.18268220699315 20.004001800810364 50-54 23.02 28.125 28.9 19.955000000000002 55-59 23.22232223222322 27.93279327932793 28.93289328932893 19.911991199119914 60-64 23.217321732173218 27.767776777677767 28.532853285328535 20.482048204820483 65-69 23.145 28.325 28.43 20.1 70-74 24.006001500375092 27.426856714178545 28.43710927731933 20.130032508127034 75-79 23.895 27.755000000000003 28.299999999999997 20.05 80-84 23.225 27.889999999999997 28.27 20.615 85-89 23.532353235323534 28.477847784778476 28.16281628162816 19.826982698269827 90-94 24.305 27.115000000000002 29.28 19.3 95-99 24.154999999999998 27.67 28.08 20.095 100-104 24.4 27.834999999999997 28.144999999999996 19.62 105-109 23.655 27.615000000000002 29.025000000000002 19.705000000000002 110-114 24.169999999999998 27.91 28.235 19.685 115-119 23.655 27.83 28.34 20.175 120-124 23.380000000000003 27.755000000000003 28.685 20.18 125-129 24.93 28.155 27.685 19.23 130-134 25.38126906345317 27.78638931946597 27.551377568878443 19.28096404820241 135-139 24.385 27.67 27.79 20.155 140-144 25.441360340085023 28.637159289822456 26.63165791447862 19.2898224556139 145-149 26.69769303908322 28.22399039183306 26.242305960066055 18.836010609017663 150 27.2090112640801 27.659574468085108 25.5819774718398 19.549436795994993 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 1.5 25 2.0 26 4.5 27 6.0 28 8.0 29 13.0 30 19.5 31 26.5 32 32.0 33 41.5 34 49.0 35 65.0 36 88.0 37 111.5 38 140.0 39 167.5 40 204.5 41 226.5 42 247.0 43 277.0 44 282.0 45 275.5 46 278.0 47 268.0 48 224.5 49 191.5 50 171.5 51 144.5 52 114.0 53 84.5 54 66.5 55 47.5 56 30.0 57 21.5 58 18.5 59 12.0 60 7.5 61 6.0 62 6.0 63 4.5 64 3.5 65 3.0 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.0 40-44 0.0 45-49 0.045 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.025 145-149 0.08499999999999999 150 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 4.550000000000001 0.0 0.0 0.0 0.0 124-125 4.699999999999999 0.0 0.0 0.0 0.0 126-127 4.95 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.6125 0.0 0.0 0.0 0.0 138 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATGT 10 0.006973645 144.0 4 AGAGCGT 40 0.007966741 18.0 140-144 >>END_MODULE Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240389 spots for SRR3723576.sra Written 1240389 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra Read 1240387 spots for SRR3723576.sra Written 1240387 spots for SRR3723576.sra SRR ids: ['SRR3723576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8f25dg65 SRR3723576.sra spots: 24807742 blocks: [[1, 1240387], [1240388, 2480774], [2480775, 3721161], [3721162, 4961548], [4961549, 6201935], [6201936, 7442322], [7442323, 8682709], [8682710, 9923096], [9923097, 11163483], [11163484, 12403870], [12403871, 13644257], [13644258, 14884644], [14884645, 16125031], [16125032, 17365418], [17365419, 18605805], [18605806, 19846192], [19846193, 21086579], [21086580, 22326966], [22326967, 23567353], [23567354, 24807742]] SRR3723576 file size 8336376 SRR3723576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3723576 SRR3723576_1.fastq SRR3723576_2.fastq Input file: SRR3723576_1.fastq Paired file: SRR3723576_2.fastq trimmed: SRR3723576-trimmed-pair1.fastq, SRR3723576-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:45:40 2025 >> started Fri Feb 14 08:46:09 2025 >> done (29.193s) 24807742 read pairs processed; of these: 65380 ( 0.26%) short read pairs filtered out after trimming by size control 179039 ( 0.72%) empty read pairs filtered out after trimming by size control 24563323 (99.01%) read pairs available; of these: 8570296 (34.89%) trimmed read pairs available after processing 15993027 (65.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 9 0.00% 22 14 0.00% 23 20 0.00% 24 17 0.00% 25 44 0.00% 26 54 0.00% 27 63 0.00% 28 65 0.00% 29 102 0.00% 30 99 0.00% 31 131 0.00% 32 141 0.00% 33 163 0.00% 34 187 0.00% 35 215 0.00% 36 285 0.00% 37 308 0.00% 38 342 0.00% 39 391 0.00% 40 405 0.00% 41 487 0.00% 42 533 0.00% 43 549 0.00% 44 591 0.00% 45 663 0.00% 46 707 0.00% 47 733 0.00% 48 791 0.00% 49 858 0.00% 50 1006 0.00% 51 1055 0.00% 52 1109 0.00% 53 1168 0.00% 54 1281 0.01% 55 1330 0.01% 56 1469 0.01% 57 1575 0.01% 58 1857 0.01% 59 2507 0.01% 60 2080 0.01% 61 2099 0.01% 62 2319 0.01% 63 2592 0.01% 64 2778 0.01% 65 3046 0.01% 66 3522 0.01% 67 4895 0.02% 68 4756 0.02% 69 4074 0.02% 70 4738 0.02% 71 5066 0.02% 72 5790 0.02% 73 6435 0.03% 74 7058 0.03% 75 7625 0.03% 76 8217 0.03% 77 7975 0.03% 78 7444 0.03% 79 6642 0.03% 80 5560 0.02% 81 4920 0.02% 82 5245 0.02% 83 5829 0.02% 84 10738 0.04% 85 10962 0.04% 86 12791 0.05% 87 15936 0.06% 88 15612 0.06% 89 15987 0.07% 90 18018 0.07% 91 31757 0.13% 92 23489 0.10% 93 18649 0.08% 94 19818 0.08% 95 21672 0.09% 96 23215 0.09% 97 46018 0.19% 98 57382 0.23% 99 24433 0.10% 100 19392 0.08% 101 24120 0.10% 102 45665 0.19% 103 32074 0.13% 104 66314 0.27% 105 95106 0.39% 106 28495 0.12% 107 41765 0.17% 108 38285 0.16% 109 89496 0.36% 110 34310 0.14% 111 22354 0.09% 112 20717 0.08% 113 27783 0.11% 114 75134 0.31% 115 155138 0.63% 116 52297 0.21% 117 34534 0.14% 118 25525 0.10% 119 27279 0.11% 120 62674 0.26% 121 151773 0.62% 122 69072 0.28% 123 29866 0.12% 124 25736 0.10% 125 50252 0.20% 126 81095 0.33% 127 47080 0.19% 128 40711 0.17% 129 71959 0.29% 130 155215 0.63% 131 119819 0.49% 132 173447 0.71% 133 202532 0.82% 134 199146 0.81% 135 139552 0.57% 136 201635 0.82% 137 207402 0.84% 138 222629 0.91% 139 233199 0.95% 140 236581 0.96% 141 244944 1.00% 142 251383 1.02% 143 263039 1.07% 144 284605 1.16% 145 310369 1.26% 146 358284 1.46% 147 429459 1.75% 148 590751 2.41% 149 1649788 6.72% 150 15993027 65.11% 24563323 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=25.61 fanout-score-rank=4 prefix-density=0.41 prefix-fanout=9.9 sequence=TTCTCATCAAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=36.25 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.2 sequence=CCATCACCAACAGGAAGCATGCAAATTTCAATCCTGGGGTCAGCAGCAAGAGCCTTGTTGAGCTCCAAAACAAAGTCCCTGTAGTACCTCACATACTTCCTCATCGGAGCATCAGGTGGTGCCACCACAGATCCATTCCACAAAGTGTTGTCGTACCCAATCAGCCCACCAACTTTGACAAGCTCAATCAACCTCTTGTGATAATTTATATAATTGTCCTTGTCAGCATCCACAAAGATGAAATCAAAACTTCCATGGCACTTCCCATCTTCAATCATTTGATCAAGAACTGGTAGAGCAGGGCCTTCCTTGAAATCAATCTTGTGCGCAACACCAGCTTTCTGAATTACTGGGAGACCCAATTCATAGTTTTCTCTGTTGATGTCCATAGCCAAGATCTTGCCATCCTCAGGGATAGCCAGGGCAGTGGCCAAGAGAGAATAGCCAGTGTAAACACCGATCTCCATGGTGTTCTTGGCATTGACAAGCTTCAAAAGCATATTCAAGAATT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=17.58 fanout-score-rank=5 prefix-density=0.35 prefix-fanout=9.3 sequence=AGGTTCTTGAAGACAGCTGCATACGGACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=58.80 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=10.7 sequence=ATGGTGATGCTGG SRR3723576 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:46:55 Started mapping on | Feb 14 08:46:56 Finished on | Feb 14 08:50:25 Mapping speed, Million of reads per hour | 423.10 Number of input reads | 24563323 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 23063305 Uniquely mapped reads % | 93.89% Average mapped length | 287.07 Number of splices: Total | 20016692 Number of splices: Annotated (sjdb) | 19557239 Number of splices: GT/AG | 19652827 Number of splices: GC/AG | 239679 Number of splices: AT/AC | 16385 Number of splices: Non-canonical | 107801 Mismatch rate per base, % | 1.12% Deletion rate per base | 0.09% Deletion average length | 3.01 Insertion rate per base | 0.06% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 840760 % of reads mapped to multiple loci | 3.42% Number of reads mapped to too many loci | 49658 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 687860 687860 687860 N_multimapping 840760 840760 840760 N_noFeature 612648 22754770 750378 N_ambiguous 291420 1169 120188 UnstrandedReadsAssigned:22159237 PositiveStrandReadsAssigned:307366 NegativeStrandReadsAssigned:22192739 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR3723576 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3723576-trimmed-pair1.fastq SRR3723576-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,563,323 reads, 21,398,109 reads pseudoaligned [quant] estimated average fragment length: 199.61 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR3723576.ke.tsv 34699 SRR3723576.se.tsv 87100 total ==> SRR3723576.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.39 690 19.2708 Potri.005G024800.1.v4.1 1035 836.39 289 17.5576 Potri.004G059700.1.v4.1 961 762.404 36 2.39935 Potri.007G009000.2.v4.1 1416 1217.39 0 0 Potri.003G141000.2.v4.1 2943 2744.39 437.372 8.09806 Potri.016G087400.1.v4.1 270 93.9271 2064 1116.59 Potri.015G069301.1.v4.1 564 366.387 0 0 Potri.010G195200.1.v4.1 1773 1574.39 51 1.64602 Potri.012G127500.1.v4.1 977 778.404 4360 284.615 ==> SRR3723576.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1550 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 474 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR3723576 completed mapping pipeline successfully