Starting /dee2/code/volunteer_pipeline.sh SRR3723577 current disk space = 3084883955712 free memory = 1455380700 SRR3723577 SRAfilesize a668ec1b62d029d6144fd6e731ad0b02 SRR3723577.sra SRR3723577.sra file validated SRR3723577 is paired end SRR3723577 is conventional basespace SRR3723577 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28975 34.0 34.0 34.0 31.0 34.0 2 33.42 34.0 34.0 34.0 31.0 34.0 3 33.47925 34.0 34.0 34.0 31.0 34.0 4 36.7115 37.0 37.0 37.0 35.0 37.0 5 36.6085 37.0 37.0 37.0 35.0 37.0 6 36.64475 37.0 37.0 37.0 35.0 37.0 7 36.6675 37.0 37.0 37.0 35.0 37.0 8 36.6675 37.0 37.0 37.0 35.0 37.0 9 38.6 39.0 39.0 39.0 38.0 39.0 10-14 38.90285 39.4 39.2 39.4 37.8 39.4 15-19 40.2057 41.0 40.0 41.0 38.2 41.0 20-24 40.13080000000001 41.0 40.0 41.0 38.2 41.0 25-29 39.997499999999995 41.0 40.0 41.0 38.0 41.0 30-34 39.80375 41.0 40.0 41.0 38.0 41.0 35-39 39.63755 41.0 40.0 41.0 37.6 41.0 40-44 39.617200000000004 41.0 40.0 41.0 37.4 41.0 45-49 39.75555 41.0 40.0 41.0 37.8 41.0 50-54 39.5727 41.0 39.8 41.0 36.8 41.0 55-59 39.2412 41.0 39.0 41.0 35.6 41.0 60-64 38.7414 40.0 37.4 41.0 35.0 41.0 65-69 37.94455000000001 39.0 36.4 41.0 35.0 41.0 70-74 36.995850000000004 37.2 35.2 39.4 34.0 41.0 75-79 35.568149999999996 36.0 34.8 37.4 33.0 39.4 80-84 35.1603 35.0 35.0 36.6 34.0 38.0 85-89 34.62925 35.0 35.0 35.6 33.6 36.6 90-94 34.2415 35.0 35.0 35.0 33.0 36.0 95-99 34.05835 35.0 35.0 35.0 33.0 35.6 100-104 33.94085 35.0 35.0 35.0 33.0 35.0 105-109 33.861650000000004 35.0 34.6 35.0 32.8 35.0 110-114 33.65265000000001 35.0 34.0 35.0 32.0 35.0 115-119 33.598749999999995 35.0 34.0 35.0 32.0 35.0 120-124 33.4221 35.0 34.0 35.0 31.0 35.0 125-129 33.26685 35.0 34.0 35.0 31.0 35.0 130-134 32.956399999999995 35.0 34.0 35.0 30.2 35.0 135-139 32.66015 35.0 33.4 35.0 29.4 35.0 140-144 32.277049999999996 35.0 33.0 35.0 28.6 35.0 145-149 31.557949999999998 34.4 33.0 35.0 26.6 35.0 150 24.72425 31.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 1.0 8 5.0 9 2.0 10 3.0 11 2.0 12 0.0 13 0.0 14 3.0 15 4.0 16 2.0 17 3.0 18 3.0 19 1.0 20 6.0 21 6.0 22 3.0 23 8.0 24 7.0 25 8.0 26 13.0 27 18.0 28 22.0 29 19.0 30 28.0 31 39.0 32 68.0 33 89.0 34 138.0 35 336.0 36 1174.0 37 1943.0 38 43.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.249435948859364 13.562296314865883 7.52068187515668 33.66758586111808 2 24.925 12.475 32.675 29.925 3 19.950000000000003 16.400000000000002 26.875 36.775000000000006 4 23.799999999999997 22.625 23.075000000000003 30.5 5 23.05 29.25 23.875 23.825 6 19.2 35.325 23.150000000000002 22.325 7 13.525 30.175 39.4 16.900000000000002 8 16.05 30.425 31.35 22.175 9 16.775000000000002 26.200000000000003 34.25 22.775000000000002 10-14 19.615 31.830000000000002 26.805 21.75 15-19 19.35 29.895 27.29 23.465 20-24 19.6 29.98 27.639999999999997 22.78 25-29 19.67 30.235 27.025 23.07 30-34 19.6 29.875 27.279999999999998 23.244999999999997 35-39 19.455 29.94 27.155 23.45 40-44 19.885 30.345 27.200000000000003 22.57 45-49 19.405 29.270000000000003 27.395000000000003 23.93 50-54 20.06 30.049999999999997 27.245 22.645 55-59 19.81 30.09 26.979999999999997 23.119999999999997 60-64 19.07 30.044999999999998 27.3 23.585 65-69 19.715 29.735 27.445000000000004 23.105 70-74 19.395 29.494999999999997 27.025 24.085 75-79 19.72 30.259999999999998 26.174999999999997 23.845 80-84 19.74 30.5 26.265 23.494999999999997 85-89 20.085 30.070000000000004 26.5 23.345 90-94 19.798959791958392 30.39107821564313 26.275255051010205 23.53470694138828 95-99 19.927989198379755 29.19437915687353 27.594139120868128 23.283492523878582 100-104 19.92099604980249 29.75148757437872 26.561328066403323 23.76618830941547 105-109 20.605 29.38 26.565 23.45 110-114 21.138740181117726 29.58422974933707 25.966878471006154 23.31015159853905 115-119 20.577202020707247 29.260241084379533 26.634322012704448 23.528234882208775 120-124 20.51 29.595 26.145000000000003 23.75 125-129 20.915 28.935 26.645000000000003 23.505000000000003 130-134 20.75 29.404999999999998 26.44 23.405 135-139 21.36923230907817 29.181263136823144 25.973376038434594 23.476128515664097 140-144 21.871093554677735 29.226461323066154 25.416270813540677 23.486174308715434 145-149 21.475 29.42 25.05 24.055 150 18.975 30.2 26.325 24.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 3.0 24 3.0 25 4.5 26 8.5 27 10.5 28 13.0 29 20.5 30 32.0 31 47.0 32 59.5 33 62.0 34 75.0 35 99.5 36 109.5 37 118.5 38 144.5 39 167.5 40 191.5 41 208.0 42 216.5 43 238.0 44 240.0 45 242.0 46 267.5 47 254.5 48 207.0 49 179.5 50 151.5 51 129.5 52 117.0 53 91.0 54 66.5 55 46.0 56 31.5 57 28.0 58 23.0 59 18.0 60 18.0 61 12.0 62 7.0 63 4.5 64 4.0 65 6.5 66 4.0 67 1.5 68 2.5 69 2.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.015 100-104 0.005 105-109 0.0 110-114 0.065 115-119 0.034999999999999996 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.09 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98989898989899 98.0 2 1.0101010101010102 2.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.4375 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.7124999999999999 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.825 0.0 0.0 0.0 0.0 100-101 2.1624999999999996 0.0 0.0 0.0 0.0 102-103 2.55 0.0 0.0 0.0 0.0 104-105 3.2625 0.0 0.0 0.0 0.0 106-107 3.8125 0.0 0.0 0.0 0.0 108-109 4.5 0.0 0.0 0.0 0.0 110-111 4.824999999999999 0.0 0.0 0.0 0.0 112-113 5.137499999999999 0.0 0.0 0.0 0.0 114-115 5.2875 0.0 0.0 0.0 0.0 116-117 6.175 0.0 0.0 0.0 0.0 118-119 6.325 0.0 0.0 0.0 0.0 120-121 6.8125 0.0 0.0 0.0 0.0 122-123 7.2125 0.0 0.0 0.0 0.0 124-125 7.625 0.0 0.0 0.0 0.0 126-127 8.325 0.0 0.0 0.0 0.0 128-129 9.162500000000001 0.0 0.0 0.0 0.0 130-131 10.225 0.0 0.0 0.0 0.0 132-133 11.425 0.0 0.0 0.0 0.0 134-135 13.100000000000001 0.0 0.0 0.0 0.0 136-137 14.65 0.0 0.0 0.0 0.0 138 15.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3723577 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723577_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.721 34.0 33.0 34.0 31.0 34.0 2 32.81875 34.0 34.0 34.0 31.0 34.0 3 32.826 34.0 34.0 34.0 31.0 34.0 4 35.95675 37.0 37.0 37.0 35.0 37.0 5 36.042 37.0 37.0 37.0 35.0 37.0 6 36.04475 37.0 37.0 37.0 35.0 37.0 7 36.05925 37.0 37.0 37.0 35.0 37.0 8 36.00275 37.0 37.0 37.0 35.0 37.0 9 37.8625 39.0 39.0 39.0 37.0 39.0 10-14 38.185500000000005 39.4 39.2 39.4 37.2 39.4 15-19 39.48295 41.0 40.0 41.0 38.0 41.0 20-24 39.394549999999995 41.0 40.0 41.0 38.0 41.0 25-29 39.251250000000006 41.0 40.0 41.0 38.0 41.0 30-34 39.1164 41.0 40.0 41.0 37.2 41.0 35-39 38.97745 41.0 40.0 41.0 36.8 41.0 40-44 38.90239999999999 41.0 39.8 41.0 36.8 41.0 45-49 38.75025 41.0 39.4 41.0 35.6 41.0 50-54 37.862500000000004 39.8 38.0 40.6 34.6 40.6 55-59 38.133750000000006 40.0 38.0 41.0 34.6 41.0 60-64 37.52905 39.6 36.8 41.0 33.8 41.0 65-69 37.0738 38.8 35.8 41.0 34.0 41.0 70-74 36.126599999999996 37.0 35.0 39.2 33.8 41.0 75-79 35.1178 35.8 35.0 37.8 33.0 39.2 80-84 34.2878 35.0 35.0 36.4 33.0 37.6 85-89 33.71155 35.0 35.0 35.6 32.2 36.4 90-94 33.43445 35.0 35.0 35.0 32.0 36.0 95-99 33.27555 35.0 34.4 35.0 31.6 35.4 100-104 33.11685000000001 35.0 34.0 35.0 31.0 35.0 105-109 32.98795 35.0 34.0 35.0 30.8 35.0 110-114 32.873999999999995 35.0 34.0 35.0 30.4 35.0 115-119 32.65435000000001 35.0 34.0 35.0 29.4 35.0 120-124 32.386199999999995 35.0 34.0 35.0 28.6 35.0 125-129 32.23335 35.0 33.4 35.0 29.0 35.0 130-134 31.987849999999998 35.0 33.0 35.0 27.4 35.0 135-139 31.5342 35.0 32.8 35.0 25.0 35.0 140-144 31.026599999999995 34.6 32.0 35.0 23.6 35.0 145-149 30.31945 34.0 31.4 35.0 15.4 35.0 150 26.4605 31.0 24.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 5.0 4 8.0 5 2.0 6 1.0 7 5.0 8 3.0 9 3.0 10 4.0 11 3.0 12 0.0 13 2.0 14 4.0 15 3.0 16 4.0 17 9.0 18 4.0 19 2.0 20 10.0 21 4.0 22 7.0 23 6.0 24 8.0 25 10.0 26 12.0 27 19.0 28 22.0 29 21.0 30 34.0 31 54.0 32 71.0 33 121.0 34 174.0 35 352.0 36 1209.0 37 1706.0 38 38.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.675 21.675 12.025 26.625 2 26.5 26.650000000000002 30.275000000000002 16.575 3 21.9 26.275 33.675 18.15 4 23.474999999999998 31.175000000000004 25.2 20.150000000000002 5 24.975 34.525 24.4 16.1 6 21.625 38.074999999999996 24.95 15.35 7 21.125 23.075000000000003 37.675 18.125 8 22.675 25.3 28.849999999999998 23.175 9 21.43035758939735 24.88122030507627 31.632908227056767 22.05551387846962 10-14 23.849999999999998 28.625 27.345000000000002 20.18 15-19 23.785 27.560000000000002 27.875 20.78 20-24 22.8 28.384999999999998 27.944999999999997 20.87 25-29 23.794999999999998 27.125 28.355000000000004 20.724999999999998 30-34 23.787136140842254 27.403220966289886 28.443533059917975 20.366109832949885 35-39 23.68 27.025 28.46 20.835 40-44 23.294999999999998 27.605 28.560000000000002 20.54 45-49 23.420855213803453 27.031757939484873 29.03225806451613 20.51512878219555 50-54 23.37116855842792 27.67138356917846 28.63143157157858 20.32601630081504 55-59 23.405 26.834999999999997 29.585 20.175 60-64 23.419999999999998 27.229999999999997 28.865000000000002 20.485 65-69 23.335 27.02 29.425 20.22 70-74 23.731186559327966 26.70133506675334 29.581479073953698 19.985999299965 75-79 23.44 26.340000000000003 29.99 20.23 80-84 23.380000000000003 26.179999999999996 30.080000000000002 20.36 85-89 22.921146057302867 27.076353817690883 29.806490324516226 20.196009800490025 90-94 23.325000000000003 27.615000000000002 29.09 19.97 95-99 23.745 27.18 29.725 19.35 100-104 24.044999999999998 27.305 28.910000000000004 19.74 105-109 23.855 27.61 29.03 19.505 110-114 23.655 27.375 28.96 20.01 115-119 24.42 27.389999999999997 28.595 19.595000000000002 120-124 24.5499099819964 27.085417083416687 29.13082616523305 19.23384676935387 125-129 24.501225061253063 28.40642032101605 28.351417570878546 18.740937046852345 130-134 25.03625181259063 27.716385819290963 27.85139256962848 19.395969798489922 135-139 25.766288314415718 27.476373818690934 28.10140507025351 18.65593279663983 140-144 26.09696302596688 28.173312653224595 26.53224595987392 19.197478360934607 145-149 27.62538792671939 26.63930323355691 26.929622584843326 18.805686254880367 150 28.020050125313283 27.092731829573935 26.416040100250626 18.471177944862156 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 4.5 26 6.5 27 7.5 28 13.5 29 18.0 30 22.0 31 31.5 32 42.0 33 44.0 34 52.5 35 71.0 36 89.0 37 110.5 38 137.5 39 176.0 40 204.5 41 217.5 42 252.0 43 273.5 44 257.5 45 256.5 46 260.5 47 252.5 48 228.5 49 189.0 50 164.0 51 135.0 52 99.0 53 84.0 54 70.5 55 48.5 56 38.0 57 31.0 58 22.0 59 13.5 60 11.5 61 9.5 62 4.5 63 9.5 64 8.0 65 2.0 66 2.0 67 2.5 68 2.5 69 1.5 70 2.0 71 1.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.03 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.005 130-134 0.005 135-139 0.005 140-144 0.065 145-149 0.11 150 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.7826306488260539 1.55 3 0.10098459984852311 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.4375 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.7124999999999999 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.2625 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.875 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.5374999999999996 0.0 0.0 0.0 0.0 104-105 3.25 0.0 0.0 0.0 0.0 106-107 3.8125 0.0 0.0 0.0 0.0 108-109 4.525 0.0 0.0 0.0 0.0 110-111 4.85 0.0 0.0 0.0 0.0 112-113 5.1625 0.0 0.0 0.0 0.0 114-115 5.3125 0.0 0.0 0.0 0.0 116-117 6.25 0.0 0.0 0.0 0.0 118-119 6.4 0.0 0.0 0.0 0.0 120-121 6.887499999999999 0.0 0.0 0.0 0.0 122-123 7.2875 0.0 0.0 0.0 0.0 124-125 7.7125 0.0 0.0 0.0 0.0 126-127 8.4375 0.0 0.0 0.0 0.0 128-129 9.2625 0.0 0.0 0.0 0.0 130-131 10.3625 0.0 0.0 0.0 0.0 132-133 11.5375 0.0 0.0 0.0 0.0 134-135 13.2125 0.0 0.0 0.0 0.0 136-137 14.775 0.0 0.0 0.0 0.0 138 15.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817664 spots for SRR3723577.sra Written 817664 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra Read 817663 spots for SRR3723577.sra Written 817663 spots for SRR3723577.sra SRR ids: ['SRR3723577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4j1977eb SRR3723577.sra spots: 16353261 blocks: [[1, 817663], [817664, 1635326], [1635327, 2452989], [2452990, 3270652], [3270653, 4088315], [4088316, 4905978], [4905979, 5723641], [5723642, 6541304], [6541305, 7358967], [7358968, 8176630], [8176631, 8994293], [8994294, 9811956], [9811957, 10629619], [10629620, 11447282], [11447283, 12264945], [12264946, 13082608], [13082609, 13900271], [13900272, 14717934], [14717935, 15535597], [15535598, 16353261]] SRR3723577 file size 5487943 SRR3723577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3723577 SRR3723577_1.fastq SRR3723577_2.fastq Input file: SRR3723577_1.fastq Paired file: SRR3723577_2.fastq trimmed: SRR3723577-trimmed-pair1.fastq, SRR3723577-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:06:06 2025 >> started Fri Feb 14 07:06:25 2025 >> done (19.151s) 16353261 read pairs processed; of these: 55074 ( 0.34%) short read pairs filtered out after trimming by size control 195662 ( 1.20%) empty read pairs filtered out after trimming by size control 16102525 (98.47%) read pairs available; of these: 6925508 (43.01%) trimmed read pairs available after processing 9177017 (56.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 6 0.00% 21 11 0.00% 22 13 0.00% 23 23 0.00% 24 34 0.00% 25 35 0.00% 26 44 0.00% 27 70 0.00% 28 62 0.00% 29 72 0.00% 30 95 0.00% 31 103 0.00% 32 156 0.00% 33 170 0.00% 34 173 0.00% 35 201 0.00% 36 220 0.00% 37 252 0.00% 38 271 0.00% 39 293 0.00% 40 338 0.00% 41 382 0.00% 42 400 0.00% 43 419 0.00% 44 461 0.00% 45 497 0.00% 46 604 0.00% 47 639 0.00% 48 696 0.00% 49 757 0.00% 50 859 0.01% 51 938 0.01% 52 995 0.01% 53 996 0.01% 54 1199 0.01% 55 1257 0.01% 56 1359 0.01% 57 1511 0.01% 58 1817 0.01% 59 1894 0.01% 60 2128 0.01% 61 2418 0.02% 62 2728 0.02% 63 2933 0.02% 64 3302 0.02% 65 3684 0.02% 66 4162 0.03% 67 4616 0.03% 68 4586 0.03% 69 5135 0.03% 70 5640 0.04% 71 6394 0.04% 72 6637 0.04% 73 6831 0.04% 74 6642 0.04% 75 5840 0.04% 76 5304 0.03% 77 4677 0.03% 78 4102 0.03% 79 4068 0.03% 80 3977 0.02% 81 4128 0.03% 82 4666 0.03% 83 5081 0.03% 84 8871 0.06% 85 10068 0.06% 86 12198 0.08% 87 12032 0.07% 88 13212 0.08% 89 18193 0.11% 90 62158 0.39% 91 24314 0.15% 92 15543 0.10% 93 15282 0.09% 94 17088 0.11% 95 19113 0.12% 96 54964 0.34% 97 66446 0.41% 98 20055 0.12% 99 20032 0.12% 100 70205 0.44% 101 23765 0.15% 102 18694 0.12% 103 39051 0.24% 104 78255 0.49% 105 32465 0.20% 106 57109 0.35% 107 54932 0.34% 108 53335 0.33% 109 21317 0.13% 110 19243 0.12% 111 28081 0.17% 112 27881 0.17% 113 16245 0.10% 114 24110 0.15% 115 146514 0.91% 116 32049 0.20% 117 23962 0.15% 118 28985 0.18% 119 64174 0.40% 120 80330 0.50% 121 55327 0.34% 122 31666 0.20% 123 33146 0.21% 124 86325 0.54% 125 49798 0.31% 126 32403 0.20% 127 51155 0.32% 128 123727 0.77% 129 103483 0.64% 130 85078 0.53% 131 135591 0.84% 132 162666 1.01% 133 151080 0.94% 134 160659 1.00% 135 163983 1.02% 136 163317 1.01% 137 167047 1.04% 138 170176 1.06% 139 174030 1.08% 140 174158 1.08% 141 178973 1.11% 142 184509 1.15% 143 190344 1.18% 144 199687 1.24% 145 215186 1.34% 146 244451 1.52% 147 292773 1.82% 148 401212 2.49% 149 1283275 7.97% 150 9177017 56.99% 16102525 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.59 fanout-score-rank=21 prefix-density=0.36 prefix-fanout=3.3 sequence=CAAACTTCCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=261.63 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=9.3 sequence=AAAACAACTCCCCTCGAATACAAAAGCTTCCCTCAAAAATCTCCCCAAAGAATCCAACCGAATGTATAATATATGGCTCAAGTACTGGTAATAAAAGATCTCATCACCGCGCAGGGGCTAAAATGGCAGCCAGTAATATATGTAGACAACAGCAGAAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=6.12 fanout-score-rank=22 prefix-density=0.44 prefix-fanout=4.1 sequence=TGAGGAAGTTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=303.42 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=20.1 sequence=AGAAGAAGAGAAAAAAGGGGATCACTGGCACAGAGTAGAGAGATCGTATGGCAAGTTCATCAGGCAGTTTAAGCTGCCAGAGAATGTGGACTTGGATTCTGTGAAGGCTAAGCTTGAGAATGGGGTTCTCATTTTGTCACTTTCCAATTTGTCCCTTGACAAAATCAAGGGTCCTACGGTGGTTAGCATTGAGGGGGGAGAAGAACCAGCCAAGCTCAAGAGTGATGAAGCAAAGCAAGAGCTCTAGATGTTTTCATGTATTGAGGCCTGAGATCGGCAACGCTTGTTTGTGAGAAAATAAGGGATGTTTTTCATTTCGATCGTGTGATTTTGTTTTGTATGTTCCAACTTGATGCACTAATGTAATACGTACGTATGCCATCTATGGTAC SRR3723577 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:07:11 Started mapping on | Feb 14 07:07:12 Finished on | Feb 14 07:09:52 Mapping speed, Million of reads per hour | 362.31 Number of input reads | 16102525 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 14606292 Uniquely mapped reads % | 90.71% Average mapped length | 284.66 Number of splices: Total | 9505470 Number of splices: Annotated (sjdb) | 9327356 Number of splices: GT/AG | 9359061 Number of splices: GC/AG | 100989 Number of splices: AT/AC | 9957 Number of splices: Non-canonical | 35463 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.03% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330441 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 223724 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.67% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1188694 1188694 1188694 N_multimapping 330441 330441 330441 N_noFeature 340060 14341339 441781 N_ambiguous 232322 1057 68333 UnstrandedReadsAssigned:14033910 PositiveStrandReadsAssigned:263896 NegativeStrandReadsAssigned:14096178 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR3723577 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3723577-trimmed-pair1.fastq SRR3723577-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,102,525 reads, 14,351,008 reads pseudoaligned [quant] estimated average fragment length: 187.124 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR3723577.ke.tsv 34699 SRR3723577.se.tsv 87100 total ==> SRR3723577.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1831.88 329 14.7303 Potri.005G024800.1.v4.1 1035 848.876 49 4.73438 Potri.004G059700.1.v4.1 961 774.876 18 1.90525 Potri.007G009000.2.v4.1 1416 1229.88 0 0 Potri.003G141000.2.v4.1 2943 2756.88 86.023 2.55923 Potri.016G087400.1.v4.1 270 101.903 1412 1136.47 Potri.015G069301.1.v4.1 564 378.693 0 0 Potri.010G195200.1.v4.1 1773 1586.88 53 2.73933 Potri.012G127500.1.v4.1 977 790.876 1138 118.017 ==> SRR3723577.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2280 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3723577 completed mapping pipeline successfully