Starting /dee2/code/volunteer_pipeline.sh SRR3723578 current disk space = 3119475867648 free memory = 1490488132 SRR3723578 SRAfilesize 5b1005cef95062222bb6919fe7c5be40 SRR3723578.sra SRR3723578.sra file validated SRR3723578 is paired end SRR3723578 is conventional basespace SRR3723578 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36925 34.0 34.0 34.0 31.0 34.0 2 33.47875 34.0 34.0 34.0 31.0 34.0 3 33.577 34.0 34.0 34.0 31.0 34.0 4 36.7765 37.0 37.0 37.0 37.0 37.0 5 36.743 37.0 37.0 37.0 37.0 37.0 6 36.7675 37.0 37.0 37.0 37.0 37.0 7 36.772 37.0 37.0 37.0 37.0 37.0 8 36.69475 37.0 37.0 37.0 36.0 37.0 9 38.686 39.0 39.0 39.0 38.0 39.0 10-14 39.0206 39.4 39.4 39.4 38.2 39.4 15-19 40.3723 41.0 40.2 41.0 39.0 41.0 20-24 40.349250000000005 41.0 40.0 41.0 39.0 41.0 25-29 40.2405 41.0 40.0 41.0 38.8 41.0 30-34 40.0404 41.0 40.0 41.0 38.0 41.0 35-39 39.943999999999996 41.0 40.0 41.0 38.0 41.0 40-44 39.95625 41.0 40.0 41.0 38.0 41.0 45-49 40.08825 41.0 40.0 41.0 38.0 41.0 50-54 39.933350000000004 41.0 40.0 41.0 37.6 41.0 55-59 39.647949999999994 41.0 39.4 41.0 36.8 41.0 60-64 39.1426 40.4 38.6 41.0 35.4 41.0 65-69 38.39705 39.4 36.6 41.0 35.0 41.0 70-74 37.39255000000001 37.6 35.6 39.8 35.0 41.0 75-79 35.86915 36.0 34.8 37.4 33.4 39.4 80-84 35.42915 35.2 35.0 36.6 34.0 37.8 85-89 34.86274999999999 35.0 35.0 35.8 34.0 36.6 90-94 34.4721 35.0 35.0 35.0 34.0 36.0 95-99 34.297349999999994 35.0 35.0 35.0 33.2 35.4 100-104 34.19605 35.0 35.0 35.0 33.0 35.0 105-109 34.111450000000005 35.0 35.0 35.0 33.0 35.0 110-114 33.986000000000004 35.0 34.8 35.0 33.0 35.0 115-119 33.894000000000005 35.0 34.2 35.0 33.0 35.0 120-124 33.78060000000001 35.0 34.0 35.0 32.0 35.0 125-129 33.606100000000005 35.0 34.0 35.0 31.6 35.0 130-134 33.36805 35.0 34.0 35.0 31.0 35.0 135-139 33.16075 35.0 34.0 35.0 30.6 35.0 140-144 32.99655 35.0 34.0 35.0 30.4 35.0 145-149 32.359500000000004 35.0 33.2 35.0 29.2 35.0 150 26.40975 32.0 23.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 1.0 16 3.0 17 3.0 18 5.0 19 1.0 20 0.0 21 3.0 22 4.0 23 5.0 24 7.0 25 4.0 26 12.0 27 11.0 28 6.0 29 13.0 30 17.0 31 26.0 32 45.0 33 81.0 34 122.0 35 261.0 36 1113.0 37 2206.0 38 43.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.130522088353416 11.39558232931727 6.877510040160642 36.596385542168676 2 23.0 14.05 33.225 29.725 3 20.125 17.299999999999997 25.174999999999997 37.4 4 23.825 24.125 23.325000000000003 28.725 5 23.150000000000002 31.175000000000004 23.7 21.975 6 19.225 35.875 23.599999999999998 21.3 7 14.85 29.575000000000003 38.3 17.275 8 15.925 28.975 31.1 24.0 9 16.6 26.775 33.225 23.400000000000002 10-14 19.095000000000002 31.730000000000004 27.025 22.15 15-19 19.91 29.04 27.72 23.330000000000002 20-24 19.650000000000002 30.0 27.51 22.84 25-29 19.875 30.214999999999996 26.605 23.305 30-34 19.485 30.425 26.915 23.175 35-39 19.935 29.265 27.62 23.18 40-44 19.634999999999998 30.395 27.01 22.96 45-49 19.925 29.759999999999998 26.66 23.655 50-54 19.945 29.189999999999998 27.439999999999998 23.425 55-59 19.965 30.03 26.965 23.04 60-64 19.66 29.494999999999997 27.215 23.630000000000003 65-69 20.13 29.12 27.615000000000002 23.135 70-74 20.580000000000002 29.544999999999998 26.735 23.14 75-79 19.365 28.835 27.105 24.695 80-84 19.950000000000003 29.09 26.884999999999998 24.075 85-89 20.525 28.595 27.275 23.605 90-94 20.121036310893267 29.018705611683504 26.878063419025704 23.982194658397518 95-99 20.520130032508128 28.852213053263316 26.76669167291823 23.86096524131033 100-104 20.630157539384847 28.287071767941985 27.196799199799948 23.885971492873217 105-109 20.31406281256251 28.710742148429684 27.20544108821764 23.769753950790157 110-114 20.649617136279467 28.652219608628197 27.265902607477106 23.432260647615237 115-119 20.67050287715787 29.041781336002003 26.53490117588191 23.75281461095822 120-124 21.981099054952747 28.431421571078552 26.30131506575329 23.286164308215408 125-129 21.12 28.549999999999997 26.045 24.285 130-134 20.75207520752075 27.997799779978 26.51765176517652 24.732473247324734 135-139 21.20302256918381 28.54926687684532 26.487514387229144 23.760196166741732 140-144 22.012201220122012 27.597759775977597 26.1976197619762 24.192419241924192 145-149 22.24 27.765 25.66 24.335 150 19.55 27.6 28.249999999999996 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 3.5 26 3.0 27 6.5 28 11.5 29 13.0 30 17.0 31 28.0 32 42.5 33 48.0 34 62.5 35 90.0 36 101.5 37 110.5 38 136.0 39 176.0 40 205.0 41 222.5 42 245.0 43 260.0 44 259.5 45 248.5 46 230.5 47 240.0 48 239.0 49 200.0 50 165.5 51 135.0 52 118.0 53 97.0 54 74.5 55 54.5 56 34.5 57 28.5 58 25.5 59 17.5 60 8.5 61 6.5 62 6.5 63 4.0 64 3.5 65 3.5 66 2.0 67 1.5 68 1.0 69 1.5 70 2.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.025 100-104 0.025 105-109 0.02 110-114 0.095 115-119 0.075 120-124 0.005 125-129 0.0 130-134 0.01 135-139 0.08499999999999999 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 2.85 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 5.6875 0.0 0.0 0.0 0.0 118-119 6.125 0.0 0.0 0.0 0.0 120-121 6.2 0.0 0.0 0.0 0.0 122-123 7.15 0.0 0.0 0.0 0.0 124-125 7.1625 0.0 0.0 0.0 0.0 126-127 7.237500000000001 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 11.225000000000001 0.0 0.0 0.0 0.0 136-137 11.925 0.0 0.0 0.0 0.0 138 12.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAGTT 10 0.006973645 144.0 4 CTATCAA 10 0.006973645 144.0 6 >>END_MODULE SRR3723578 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723578_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8075 34.0 33.0 34.0 31.0 34.0 2 32.94575 34.0 33.0 34.0 31.0 34.0 3 33.0135 34.0 34.0 34.0 31.0 34.0 4 36.288 37.0 37.0 37.0 35.0 37.0 5 36.266 37.0 37.0 37.0 35.0 37.0 6 36.2695 37.0 37.0 37.0 36.0 37.0 7 36.28725 37.0 37.0 37.0 36.0 37.0 8 36.2325 37.0 37.0 37.0 35.0 37.0 9 38.12775 39.0 39.0 39.0 38.0 39.0 10-14 38.47855 39.4 39.2 39.4 38.2 39.4 15-19 39.80454999999999 41.0 40.0 41.0 39.0 41.0 20-24 39.7538 41.0 40.0 41.0 38.6 41.0 25-29 39.66235 41.0 40.0 41.0 38.0 41.0 30-34 39.5394 41.0 40.0 41.0 38.0 41.0 35-39 39.37275 41.0 40.0 41.0 38.0 41.0 40-44 39.284749999999995 41.0 40.0 41.0 37.8 41.0 45-49 39.202099999999994 41.0 40.0 41.0 37.2 41.0 50-54 38.26675 39.8 38.6 40.6 35.6 40.6 55-59 38.558299999999996 40.0 38.8 41.0 35.2 41.0 60-64 37.98325 39.8 37.2 41.0 35.0 41.0 65-69 37.47885 39.0 36.4 40.8 35.0 41.0 70-74 36.4544 37.0 35.2 39.2 34.4 41.0 75-79 35.42895 36.0 35.0 37.4 34.0 39.2 80-84 34.6211 35.0 35.0 36.2 33.4 37.4 85-89 34.07835 35.0 35.0 35.4 33.0 36.4 90-94 33.845299999999995 35.0 35.0 35.0 33.0 36.0 95-99 33.6657 35.0 35.0 35.0 32.6 35.2 100-104 33.5035 35.0 34.4 35.0 32.0 35.0 105-109 33.354150000000004 35.0 34.0 35.0 31.4 35.0 110-114 33.237550000000006 35.0 34.0 35.0 31.0 35.0 115-119 33.0304 35.0 34.0 35.0 30.8 35.0 120-124 32.815749999999994 35.0 34.0 35.0 30.0 35.0 125-129 32.690099999999994 35.0 34.0 35.0 29.8 35.0 130-134 32.268649999999994 35.0 33.0 35.0 28.2 35.0 135-139 31.954200000000004 35.0 33.0 35.0 27.0 35.0 140-144 31.511899999999997 34.2 32.2 35.0 25.4 35.0 145-149 30.79135 34.0 31.8 35.0 23.0 35.0 150 27.32725 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 3.0 4 2.0 5 1.0 6 0.0 7 2.0 8 5.0 9 4.0 10 1.0 11 2.0 12 2.0 13 2.0 14 1.0 15 2.0 16 5.0 17 2.0 18 3.0 19 6.0 20 2.0 21 1.0 22 2.0 23 4.0 24 7.0 25 12.0 26 11.0 27 9.0 28 19.0 29 21.0 30 29.0 31 38.0 32 57.0 33 86.0 34 163.0 35 393.0 36 1301.0 37 1714.0 38 39.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.050000000000004 21.925 11.275 26.75 2 26.424999999999997 27.375 29.525000000000002 16.675 3 20.9 28.1 30.875000000000004 20.125 4 24.675 31.374999999999996 23.7 20.25 5 25.55 35.55 21.475 17.424999999999997 6 20.3 38.175 23.724999999999998 17.8 7 20.080020005001252 23.58089522380595 37.634408602150536 18.704676169042262 8 22.975 25.275 28.125 23.625 9 22.91718789091819 25.01876407305479 30.172629472104077 21.891418563922944 10-14 23.476173808690433 29.42147107355368 26.336316815840792 20.766038301915096 15-19 24.25 28.21 26.695 20.845 20-24 23.26 28.01 27.205000000000002 21.525 25-29 23.755000000000003 27.935 27.68 20.630000000000003 30-34 23.79332766468264 27.35957585154804 28.064822687940776 20.78227379582854 35-39 23.715 27.779999999999998 27.58 20.925 40-44 23.2161608080404 27.77638881944097 27.75638781939097 21.251062553127657 45-49 23.684210526315788 27.656593956373825 28.01180708425055 20.647388433059835 50-54 23.658280398139347 27.06447256539789 27.984794678137348 21.292452358325413 55-59 24.192419241924192 27.607760776077605 27.95779577957796 20.242024202420243 60-64 23.754750950190036 27.800560112022403 28.350670134026807 20.09401880376075 65-69 23.632089626888067 27.2481744523357 28.553566069820945 20.566169850955287 70-74 23.468775020016015 27.136709367493992 28.41773418734988 20.97678142514011 75-79 23.181159057952897 27.426371318565927 28.711435571778587 20.681034051702586 80-84 23.71 27.839999999999996 28.144999999999996 20.305 85-89 23.463212124243483 28.11984194468064 28.11984194468064 20.297103986395236 90-94 23.46 27.084999999999997 28.705000000000002 20.75 95-99 23.315 27.98 28.735 19.97 100-104 23.794999999999998 27.365000000000002 28.825 20.015 105-109 23.585 27.694999999999997 28.71 20.01 110-114 23.84 27.845 27.975 20.34 115-119 24.975 27.36 27.62 20.044999999999998 120-124 24.287286185855756 27.658297489246774 28.258477543262977 19.79593878163449 125-129 25.440088017603518 27.465493098619724 28.170634126825366 18.923784756951388 130-134 25.461365341335334 27.9869967491873 27.911977994498628 18.639659914978747 135-139 26.286314315715785 27.386369318465924 27.76638831941597 18.56092804640232 140-144 26.1208967173739 29.238390712570055 26.276020816653322 18.364691753402724 145-149 27.097420485850236 27.122464312546956 27.107438016528924 18.67267718507388 150 25.501002004008015 29.008016032064127 25.90180360721443 19.589178356713425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 2.0 25 3.0 26 3.5 27 3.5 28 4.0 29 8.0 30 11.5 31 16.5 32 28.5 33 35.5 34 45.0 35 57.0 36 79.0 37 105.0 38 135.0 39 161.0 40 181.0 41 215.5 42 235.5 43 261.5 44 280.0 45 282.0 46 281.0 47 261.5 48 240.0 49 215.5 50 177.5 51 150.5 52 125.5 53 102.0 54 77.5 55 49.0 56 37.0 57 32.0 58 26.5 59 16.5 60 12.0 61 8.5 62 4.0 63 5.0 64 5.5 65 2.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.075 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.0 40-44 0.005 45-49 0.06 50-54 0.034999999999999996 55-59 0.01 60-64 0.02 65-69 0.03 70-74 0.08 75-79 0.005 80-84 0.0 85-89 0.034999999999999996 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.02 130-134 0.025 135-139 0.005 140-144 0.08 145-149 0.17500000000000002 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.075 0.0 0.0 0.025 0.0 60-61 0.075 0.0 0.0 0.025 0.0 62-63 0.1 0.0 0.0 0.025 0.0 64-65 0.1125 0.0 0.0 0.025 0.0 66-67 0.125 0.0 0.0 0.025 0.0 68-69 0.125 0.0 0.0 0.025 0.0 70-71 0.125 0.0 0.0 0.025 0.0 72-73 0.125 0.0 0.0 0.025 0.0 74-75 0.1875 0.0 0.0 0.025 0.0 76-77 0.225 0.0 0.0 0.025 0.0 78-79 0.25 0.0 0.0 0.025 0.0 80-81 0.25 0.0 0.0 0.025 0.0 82-83 0.25 0.0 0.0 0.025 0.0 84-85 0.25 0.0 0.0 0.025 0.0 86-87 0.25 0.0 0.0 0.025 0.0 88-89 0.275 0.0 0.0 0.025 0.0 90-91 0.275 0.0 0.0 0.025 0.0 92-93 0.32499999999999996 0.0 0.0 0.025 0.0 94-95 0.3625 0.0 0.0 0.025 0.0 96-97 0.4 0.0 0.0 0.025 0.0 98-99 0.525 0.0 0.0 0.025 0.0 100-101 0.65 0.0 0.0 0.025 0.0 102-103 1.0 0.0 0.0 0.025 0.0 104-105 1.45 0.0 0.0 0.025 0.0 106-107 2.2375 0.0 0.0 0.025 0.0 108-109 2.425 0.0 0.0 0.025 0.0 110-111 2.6624999999999996 0.0 0.0 0.025 0.0 112-113 2.825 0.0 0.0 0.025 0.0 114-115 3.7750000000000004 0.0 0.0 0.025 0.0 116-117 5.6125 0.0 0.0 0.025 0.0 118-119 6.1 0.0 0.0 0.025 0.0 120-121 6.175 0.0 0.0 0.025 0.0 122-123 7.1125 0.0 0.0 0.025 0.0 124-125 7.1375 0.0 0.0 0.025 0.0 126-127 7.25 0.0 0.0 0.025 0.0 128-129 7.3 0.0 0.0 0.025 0.0 130-131 8.2 0.0 0.0 0.025 0.0 132-133 9.274999999999999 0.0 0.0 0.025 0.0 134-135 11.2875 0.0 0.0 0.025 0.0 136-137 12.0 0.0 0.0 0.025 0.0 138 12.25 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCTC 10 0.006973645 144.0 5 ACATTCT 10 0.006973645 144.0 4 ATTCTCG 10 0.006973645 144.0 6 >>END_MODULE Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701261 spots for SRR3723578.sra Written 701261 spots for SRR3723578.sra Read 701266 spots for SRR3723578.sra Written 701266 spots for SRR3723578.sra SRR ids: ['SRR3723578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jn_y2dzq SRR3723578.sra spots: 14025225 blocks: [[1, 701261], [701262, 1402522], [1402523, 2103783], [2103784, 2805044], [2805045, 3506305], [3506306, 4207566], [4207567, 4908827], [4908828, 5610088], [5610089, 6311349], [6311350, 7012610], [7012611, 7713871], [7713872, 8415132], [8415133, 9116393], [9116394, 9817654], [9817655, 10518915], [10518916, 11220176], [11220177, 11921437], [11921438, 12622698], [12622699, 13323959], [13323960, 14025225]] SRR3723578 file size 4703595 SRR3723578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3723578 SRR3723578_1.fastq SRR3723578_2.fastq Input file: SRR3723578_1.fastq Paired file: SRR3723578_2.fastq trimmed: SRR3723578-trimmed-pair1.fastq, SRR3723578-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:41:56 2025 >> started Fri Feb 14 07:42:11 2025 >> done (15.281s) 14025225 read pairs processed; of these: 34162 ( 0.24%) short read pairs filtered out after trimming by size control 109686 ( 0.78%) empty read pairs filtered out after trimming by size control 13881377 (98.97%) read pairs available; of these: 5532989 (39.86%) trimmed read pairs available after processing 8348388 (60.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 14 0.00% 24 23 0.00% 25 14 0.00% 26 28 0.00% 27 34 0.00% 28 34 0.00% 29 41 0.00% 30 54 0.00% 31 58 0.00% 32 79 0.00% 33 118 0.00% 34 104 0.00% 35 114 0.00% 36 119 0.00% 37 157 0.00% 38 148 0.00% 39 209 0.00% 40 218 0.00% 41 209 0.00% 42 263 0.00% 43 274 0.00% 44 296 0.00% 45 328 0.00% 46 313 0.00% 47 390 0.00% 48 469 0.00% 49 556 0.00% 50 586 0.00% 51 552 0.00% 52 627 0.00% 53 681 0.00% 54 748 0.01% 55 798 0.01% 56 874 0.01% 57 1090 0.01% 58 1508 0.01% 59 1763 0.01% 60 1316 0.01% 61 1488 0.01% 62 1636 0.01% 63 1944 0.01% 64 2145 0.02% 65 2434 0.02% 66 3447 0.02% 67 3697 0.03% 68 3013 0.02% 69 3281 0.02% 70 3618 0.03% 71 3886 0.03% 72 4115 0.03% 73 4256 0.03% 74 4225 0.03% 75 3906 0.03% 76 3433 0.02% 77 2847 0.02% 78 2597 0.02% 79 2507 0.02% 80 2398 0.02% 81 2555 0.02% 82 2757 0.02% 83 3037 0.02% 84 5556 0.04% 85 5938 0.04% 86 6704 0.05% 87 11238 0.08% 88 9491 0.07% 89 9077 0.07% 90 9359 0.07% 91 15997 0.12% 92 15930 0.11% 93 10264 0.07% 94 10135 0.07% 95 10838 0.08% 96 11149 0.08% 97 17117 0.12% 98 36636 0.26% 99 14369 0.10% 100 10759 0.08% 101 18330 0.13% 102 70628 0.51% 103 10683 0.08% 104 33702 0.24% 105 97750 0.70% 106 19664 0.14% 107 28228 0.20% 108 18885 0.14% 109 37910 0.27% 110 10790 0.08% 111 17685 0.13% 112 46693 0.34% 113 77242 0.56% 114 93284 0.67% 115 159072 1.15% 116 101220 0.73% 117 21251 0.15% 118 10138 0.07% 119 13273 0.10% 120 33524 0.24% 121 128852 0.93% 122 13455 0.10% 123 13743 0.10% 124 11928 0.09% 125 20116 0.14% 126 29899 0.22% 127 11821 0.09% 128 12661 0.09% 129 47267 0.34% 130 133059 0.96% 131 68219 0.49% 132 89027 0.64% 133 162489 1.17% 134 165412 1.19% 135 20387 0.15% 136 70040 0.50% 137 33925 0.24% 138 179280 1.29% 139 190359 1.37% 140 130939 0.94% 141 199221 1.44% 142 97317 0.70% 143 104930 0.76% 144 217757 1.57% 145 231646 1.67% 146 258102 1.86% 147 289104 2.08% 148 300431 2.16% 149 1086649 7.83% 150 8348388 60.14% 13881377 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.4 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=368.67 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=3.7 sequence=CAGCACCAGCACCTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=42.00 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.6 sequence=TTCTCTTCTCTCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCCGGAACTCCATCTTCTGATGGCACTACCACTTCTCCGGCCGGTAGTAACGTCACCAATTACAAGCCTTCATCCAACAACGTACCCGATTCATCCTT SRR3723578 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:42:52 Started mapping on | Feb 14 07:42:53 Finished on | Feb 14 07:43:49 Mapping speed, Million of reads per hour | 892.37 Number of input reads | 13881377 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 13390300 Uniquely mapped reads % | 96.46% Average mapped length | 286.45 Number of splices: Total | 9782075 Number of splices: Annotated (sjdb) | 9576640 Number of splices: GT/AG | 9627557 Number of splices: GC/AG | 110621 Number of splices: AT/AC | 9260 Number of splices: Non-canonical | 34637 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.04% Deletion average length | 2.61 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311830 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 45828 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 193269 193269 193269 N_multimapping 311830 311830 311830 N_noFeature 355325 13167674 447244 N_ambiguous 189896 968 58424 UnstrandedReadsAssigned:12845079 PositiveStrandReadsAssigned:221658 NegativeStrandReadsAssigned:12884632 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR3723578 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3723578-trimmed-pair1.fastq SRR3723578-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,881,377 reads, 12,935,627 reads pseudoaligned [quant] estimated average fragment length: 190.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR3723578.ke.tsv 34699 SRR3723578.se.tsv 87100 total ==> SRR3723578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.54 387 17.6992 Potri.005G024800.1.v4.1 1035 845.538 55 5.43972 Potri.004G059700.1.v4.1 961 771.538 20 2.1678 Potri.007G009000.2.v4.1 1416 1226.54 0 0 Potri.003G141000.2.v4.1 2943 2753.54 179.036 5.43747 Potri.016G087400.1.v4.1 270 99.7768 1863 1561.46 Potri.015G069301.1.v4.1 564 375.32 0 0 Potri.010G195200.1.v4.1 1773 1583.54 41 2.16522 Potri.012G127500.1.v4.1 977 787.538 869 92.2774 ==> SRR3723578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1990 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3723578 completed mapping pipeline successfully