Starting /dee2/code/volunteer_pipeline.sh SRR3723579 current disk space = 3119519326208 free memory = 1477336996 SRR3723579 SRAfilesize af6c97d998d6dc47b27d695057b515d3 SRR3723579.sra SRR3723579.sra file validated SRR3723579 is paired end SRR3723579 is conventional basespace SRR3723579 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16525 34.0 34.0 34.0 31.0 34.0 2 33.44925 34.0 34.0 34.0 33.0 34.0 3 33.62525 34.0 34.0 34.0 33.0 34.0 4 36.7975 37.0 37.0 37.0 37.0 37.0 5 36.73775 37.0 37.0 37.0 37.0 37.0 6 36.7995 37.0 37.0 37.0 37.0 37.0 7 36.8045 37.0 37.0 37.0 37.0 37.0 8 36.78325 37.0 37.0 37.0 37.0 37.0 9 38.74425 39.0 39.0 39.0 39.0 39.0 10-14 39.085950000000004 39.4 39.4 39.4 39.2 39.4 15-19 40.51 41.0 41.0 41.0 39.8 41.0 20-24 40.436099999999996 41.0 41.0 41.0 39.4 41.0 25-29 40.39495000000001 41.0 40.8 41.0 39.0 41.0 30-34 40.280449999999995 41.0 40.0 41.0 39.0 41.0 35-39 40.10549999999999 41.0 40.0 41.0 38.2 41.0 40-44 40.110200000000006 41.0 40.0 41.0 38.2 41.0 45-49 40.1552 41.0 40.0 41.0 38.2 41.0 50-54 39.99125 41.0 40.0 41.0 37.6 41.0 55-59 39.689800000000005 41.0 39.6 41.0 36.6 41.0 60-64 39.1727 40.6 38.4 41.0 35.4 41.0 65-69 38.42005 39.2 36.8 41.0 35.0 41.0 70-74 37.36585000000001 37.6 35.4 39.6 35.0 41.0 75-79 35.911449999999995 36.0 34.8 37.4 33.6 39.4 80-84 35.494299999999996 35.2 35.0 36.6 34.0 38.0 85-89 34.8894 35.0 35.0 35.8 34.0 36.6 90-94 34.60405000000001 35.0 35.0 35.0 34.0 36.0 95-99 34.4522 35.0 35.0 35.0 34.0 35.6 100-104 34.34795 35.0 35.0 35.0 34.0 35.0 105-109 34.27325 35.0 35.0 35.0 33.6 35.0 110-114 34.13205000000001 35.0 35.0 35.0 33.0 35.0 115-119 34.096900000000005 35.0 35.0 35.0 33.0 35.0 120-124 34.0043 35.0 34.4 35.0 33.0 35.0 125-129 33.8367 35.0 34.0 35.0 32.4 35.0 130-134 33.692600000000006 35.0 34.0 35.0 32.0 35.0 135-139 33.49905 35.0 34.0 35.0 31.4 35.0 140-144 33.2215 35.0 34.0 35.0 31.0 35.0 145-149 32.588350000000005 35.0 33.6 35.0 30.0 35.0 150 28.29425 32.0 27.0 34.0 17.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 3.0 16 0.0 17 2.0 18 3.0 19 3.0 20 6.0 21 1.0 22 3.0 23 5.0 24 1.0 25 10.0 26 10.0 27 8.0 28 7.0 29 20.0 30 20.0 31 35.0 32 31.0 33 49.0 34 95.0 35 225.0 36 1032.0 37 2380.0 38 49.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.691373640273206 12.926890968884392 7.816847963571972 39.56488742727043 2 23.724999999999998 14.025000000000002 33.25 28.999999999999996 3 19.5 17.4 24.675 38.425 4 22.1 24.825 23.95 29.125 5 24.375 29.875 24.125 21.625 6 20.549999999999997 35.6 23.125 20.724999999999998 7 14.299999999999999 28.95 39.2 17.549999999999997 8 16.875 27.800000000000004 31.95 23.375 9 16.725 25.05 34.675 23.549999999999997 10-14 19.215 31.869999999999997 26.8 22.115000000000002 15-19 18.83 29.799999999999997 27.905 23.465 20-24 19.54 29.74 27.61 23.11 25-29 19.28 30.009999999999998 27.33 23.380000000000003 30-34 19.68 29.654999999999998 27.439999999999998 23.225 35-39 19.7 29.9 26.85 23.549999999999997 40-44 19.009999999999998 30.245 27.150000000000002 23.595 45-49 20.015 30.505 25.929999999999996 23.549999999999997 50-54 19.33 29.69 26.83 24.15 55-59 19.645000000000003 30.020000000000003 26.755000000000003 23.580000000000002 60-64 19.325 30.064999999999998 27.235 23.375 65-69 19.900000000000002 29.38 27.205000000000002 23.515 70-74 19.485 29.73 27.565 23.22 75-79 19.792917166866747 29.341736694677873 27.47098839535814 23.39435774309724 80-84 20.026001300065 29.19145957297865 26.601330066503326 24.181209060453025 85-89 19.75598779938997 29.6064803240162 27.386369318465924 23.251162558127906 90-94 19.429714857428714 29.299649824912454 27.848924462231118 23.421710855427712 95-99 20.0340153068881 29.773398029113103 27.10719823920764 23.085388424791155 100-104 20.48114434330299 29.35880764229269 27.00810243072922 23.1519455836751 105-109 20.44715650477667 29.285249837443107 26.609313259640878 23.658280398139347 110-114 20.463301145744733 29.944463901536 26.066943513283636 23.525291439435634 115-119 21.27138141442433 29.70891267380214 26.107832349704914 22.91187356206862 120-124 21.002100210021002 29.65796579657966 25.11751175117512 24.222422242224223 125-129 21.235 28.810000000000002 25.91 24.044999999999998 130-134 20.337033703370334 30.06800680068007 25.517551755175518 24.077407740774078 135-139 20.57528764382191 29.169584792396197 26.088044022011005 24.167083541770886 140-144 20.856042802140106 29.35146757337867 25.546277313865694 24.24621231061553 145-149 20.775 29.654999999999998 25.119999999999997 24.45 150 20.75 30.675 24.575 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 1.5 24 1.5 25 6.0 26 9.0 27 13.0 28 16.5 29 21.0 30 31.5 31 37.0 32 41.5 33 59.5 34 79.0 35 91.0 36 108.5 37 124.0 38 147.0 39 174.5 40 187.5 41 210.0 42 238.5 43 238.5 44 240.0 45 255.0 46 258.0 47 233.5 48 216.5 49 198.5 50 159.0 51 132.0 52 108.0 53 83.5 54 71.5 55 58.5 56 35.0 57 25.0 58 20.5 59 15.0 60 11.0 61 8.5 62 5.5 63 4.5 64 3.5 65 2.5 66 3.0 67 2.5 68 2.5 69 3.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.04 80-84 0.005 85-89 0.005 90-94 0.05 95-99 0.045 100-104 0.03 105-109 0.034999999999999996 110-114 0.065 115-119 0.03 120-124 0.01 125-129 0.0 130-134 0.01 135-139 0.05 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.9124999999999999 0.0 0.0 0.0 0.0 98-99 2.6 0.0 0.0 0.0 0.0 100-101 2.975 0.0 0.0 0.0 0.0 102-103 3.35 0.0 0.0 0.0 0.0 104-105 3.75 0.0 0.0 0.0 0.0 106-107 4.5375 0.0 0.0 0.0 0.0 108-109 5.65 0.0 0.0 0.0 0.0 110-111 6.625 0.0 0.0 0.0 0.0 112-113 7.7375 0.0 0.0 0.0 0.0 114-115 8.524999999999999 0.0 0.0 0.0 0.0 116-117 9.8625 0.0 0.0 0.0 0.0 118-119 11.0 0.0 0.0 0.0 0.0 120-121 11.825 0.0 0.0 0.0 0.0 122-123 13.0125 0.0 0.0 0.0 0.0 124-125 13.8625 0.0 0.0 0.0 0.0 126-127 14.7875 0.0 0.0 0.0 0.0 128-129 15.875 0.0 0.0 0.0 0.0 130-131 17.025 0.0 0.0 0.0 0.0 132-133 18.487499999999997 0.0 0.0 0.0 0.0 134-135 19.8875 0.0 0.0 0.0 0.0 136-137 21.3375 0.0 0.0 0.0 0.0 138 22.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAACT 10 0.006973645 144.0 4 GTGCTTT 10 0.006973645 144.0 3 >>END_MODULE SRR3723579 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9435 34.0 33.0 34.0 31.0 34.0 2 33.095 34.0 34.0 34.0 31.0 34.0 3 33.1355 34.0 34.0 34.0 31.0 34.0 4 36.32225 37.0 37.0 37.0 35.0 37.0 5 36.2945 37.0 37.0 37.0 37.0 37.0 6 36.31625 37.0 37.0 37.0 37.0 37.0 7 36.337 37.0 37.0 37.0 37.0 37.0 8 36.28725 37.0 37.0 37.0 37.0 37.0 9 38.2165 39.0 39.0 39.0 38.0 39.0 10-14 38.5135 39.4 39.4 39.4 38.2 39.4 15-19 39.851000000000006 41.0 40.8 41.0 39.0 41.0 20-24 39.802049999999994 41.0 40.4 41.0 39.0 41.0 25-29 39.720299999999995 41.0 40.0 41.0 39.0 41.0 30-34 39.608799999999995 41.0 40.0 41.0 38.0 41.0 35-39 39.511250000000004 41.0 40.0 41.0 38.0 41.0 40-44 39.405 41.0 40.0 41.0 38.0 41.0 45-49 39.37355 41.0 40.0 41.0 37.6 41.0 50-54 38.508050000000004 40.0 38.8 40.6 36.0 40.8 55-59 38.808949999999996 41.0 39.0 41.0 35.6 41.0 60-64 38.244749999999996 40.0 37.6 41.0 35.0 41.0 65-69 37.6902 39.0 36.6 41.0 35.0 41.0 70-74 36.628550000000004 37.4 35.2 39.4 34.8 41.0 75-79 35.55275 36.2 35.0 37.8 34.0 39.2 80-84 34.72345 35.0 35.0 36.4 34.0 37.4 85-89 34.1971 35.0 35.0 35.6 33.8 36.4 90-94 33.9314 35.0 35.0 35.0 33.0 36.0 95-99 33.758750000000006 35.0 35.0 35.0 33.0 35.6 100-104 33.65815 35.0 35.0 35.0 33.0 35.2 105-109 33.5871 35.0 35.0 35.0 32.8 35.0 110-114 33.4404 35.0 35.0 35.0 32.0 35.0 115-119 33.29765 35.0 34.0 35.0 31.6 35.0 120-124 33.141600000000004 35.0 34.0 35.0 31.0 35.0 125-129 32.94815 35.0 34.0 35.0 30.4 35.0 130-134 32.721799999999995 35.0 34.0 35.0 29.6 35.0 135-139 32.4668 35.0 33.6 35.0 29.2 35.0 140-144 32.05305 35.0 33.0 35.0 28.2 35.0 145-149 31.35505 35.0 33.0 35.0 25.0 35.0 150 27.09025 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 50.0 3 6.0 4 3.0 5 1.0 6 1.0 7 4.0 8 0.0 9 1.0 10 4.0 11 1.0 12 1.0 13 2.0 14 2.0 15 1.0 16 3.0 17 1.0 18 2.0 19 4.0 20 3.0 21 8.0 22 4.0 23 4.0 24 2.0 25 10.0 26 10.0 27 13.0 28 13.0 29 16.0 30 14.0 31 33.0 32 52.0 33 71.0 34 126.0 35 277.0 36 1160.0 37 2036.0 38 61.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.175 20.9 12.975 27.950000000000003 2 27.05 24.975 32.625 15.35 3 19.85 27.800000000000004 32.475 19.875 4 23.875 32.2 25.45 18.475 5 24.8 33.25 25.224999999999998 16.725 6 21.175 37.3 25.174999999999997 16.35 7 21.2 21.0 39.1 18.7 8 22.75 23.775 30.375000000000004 23.1 9 23.305826456614152 24.406101525381345 30.107526881720432 22.18054513628407 10-14 23.557355735573555 28.74787478747875 26.992699269926995 20.7020702070207 15-19 23.635 27.63 28.444999999999997 20.29 20-24 23.605 28.265 28.549999999999997 19.580000000000002 25-29 24.031201560078003 28.041402070103505 27.74138706935347 20.186009300465024 30-34 23.653278647526633 27.43460211073876 28.70504676636823 20.207072475366378 35-39 23.45 27.38 28.884999999999998 20.285 40-44 23.551177558877946 27.31136556827841 29.156457822891145 19.980999049952498 45-49 23.719231538923356 27.511506904142486 28.687212327396438 20.082049229537724 50-54 23.51322963037063 27.809733406692345 28.790076526784375 19.886960436152652 55-59 23.067306730673067 27.382738273827385 29.27292729272927 20.27702770277028 60-64 22.865716429107277 27.82195548887222 28.632158039509875 20.68017004251063 65-69 23.338168358925625 27.36957935277347 29.050167558645523 20.242084729655378 70-74 23.451725862931465 26.87343671835918 29.204602301150572 20.47023511755878 75-79 23.26965393078616 27.460492098419685 29.170834166833366 20.09901980396079 80-84 23.205000000000002 26.96 29.445 20.39 85-89 23.62326814385035 26.56929925473916 29.735407392587405 20.07202520882309 90-94 23.494999999999997 27.275 29.049999999999997 20.18 95-99 23.95 27.35 29.2 19.5 100-104 23.919999999999998 27.575 28.994999999999997 19.509999999999998 105-109 23.84738473847385 27.722772277227726 28.842884288428845 19.586958695869587 110-114 24.7912395619781 27.01635081754088 28.851442572128605 19.340967048352418 115-119 25.979999999999997 27.279999999999998 27.639999999999997 19.1 120-124 25.975195039007804 27.58551710342068 27.275455091018202 19.16383276655331 125-129 26.731682920730183 27.371842960740185 27.58689672418104 18.309577394348587 130-134 26.5666416604151 28.06201550387597 26.916729182295573 18.454613653413354 135-139 27.21272127212721 27.707770777077705 27.21272127212721 17.866786678667868 140-144 27.898133786961527 28.418472006804425 25.651673587832093 18.031720618401962 145-149 28.506379784838632 28.011008256192145 25.479109331999002 18.003502626970228 150 30.24768576432324 26.8951713785339 25.894420815611706 16.962722041531148 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 4.0 27 7.5 28 11.0 29 13.0 30 19.5 31 26.0 32 29.0 33 42.0 34 64.0 35 83.5 36 101.5 37 123.5 38 148.5 39 168.5 40 200.5 41 228.5 42 235.5 43 251.0 44 258.5 45 271.5 46 276.5 47 258.0 48 224.0 49 199.5 50 176.5 51 130.0 52 103.0 53 81.0 54 60.0 55 43.5 56 34.5 57 27.5 58 16.5 59 15.0 60 11.5 61 7.5 62 7.5 63 6.5 64 3.5 65 1.5 66 3.0 67 2.5 68 1.0 69 2.5 70 2.0 71 0.0 72 0.0 73 1.5 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.034999999999999996 35-39 0.0 40-44 0.005 45-49 0.06 50-54 0.034999999999999996 55-59 0.01 60-64 0.025 65-69 0.034999999999999996 70-74 0.05 75-79 0.02 80-84 0.0 85-89 0.034999999999999996 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.005 115-119 0.0 120-124 0.02 125-129 0.025 130-134 0.025 135-139 0.01 140-144 0.065 145-149 0.075 150 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 1.0750000000000002 0.0 0.0 0.0 0.0 94-95 1.45 0.0 0.0 0.0 0.0 96-97 1.8875 0.0 0.0 0.0 0.0 98-99 2.5875000000000004 0.0 0.0 0.0 0.0 100-101 2.975 0.0 0.0 0.0 0.0 102-103 3.3625 0.0 0.0 0.0 0.0 104-105 3.75 0.0 0.0 0.0 0.0 106-107 4.550000000000001 0.0 0.0 0.0 0.0 108-109 5.65 0.0 0.0 0.0 0.0 110-111 6.625 0.0 0.0 0.0 0.0 112-113 7.75 0.0 0.0 0.0 0.0 114-115 8.5375 0.0 0.0 0.0 0.0 116-117 9.8625 0.0 0.0 0.0 0.0 118-119 10.975000000000001 0.0 0.0 0.0 0.0 120-121 11.787500000000001 0.0 0.0 0.0 0.0 122-123 12.9375 0.0 0.0 0.0 0.0 124-125 13.787500000000001 0.0 0.0 0.0 0.0 126-127 14.775 0.0 0.0 0.0 0.0 128-129 15.8625 0.0 0.0 0.0 0.0 130-131 17.012500000000003 0.0 0.0 0.0 0.0 132-133 18.475 0.0 0.0 0.0 0.0 134-135 19.8125 0.0 0.0 0.0 0.0 136-137 21.2875 0.0 0.0 0.0 0.0 138 22.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTTT 10 0.006973645 144.0 2 CTGATTT 10 0.006973645 144.0 1 >>END_MODULE Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883949 spots for SRR3723579.sra Written 883949 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra Read 883943 spots for SRR3723579.sra Written 883943 spots for SRR3723579.sra SRR ids: ['SRR3723579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6njz3ojz SRR3723579.sra spots: 17678866 blocks: [[1, 883943], [883944, 1767886], [1767887, 2651829], [2651830, 3535772], [3535773, 4419715], [4419716, 5303658], [5303659, 6187601], [6187602, 7071544], [7071545, 7955487], [7955488, 8839430], [8839431, 9723373], [9723374, 10607316], [10607317, 11491259], [11491260, 12375202], [12375203, 13259145], [13259146, 14143088], [14143089, 15027031], [15027032, 15910974], [15910975, 16794917], [16794918, 17678866]] SRR3723579 file size 5934558 SRR3723579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3723579 SRR3723579_1.fastq SRR3723579_2.fastq Input file: SRR3723579_1.fastq Paired file: SRR3723579_2.fastq trimmed: SRR3723579-trimmed-pair1.fastq, SRR3723579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:32:27 2025 >> started Fri Feb 14 07:32:56 2025 >> done (29.350s) 17678866 read pairs processed; of these: 51609 ( 0.29%) short read pairs filtered out after trimming by size control 162573 ( 0.92%) empty read pairs filtered out after trimming by size control 17464684 (98.79%) read pairs available; of these: 8348868 (47.80%) trimmed read pairs available after processing 9115816 (52.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 7 0.00% 22 13 0.00% 23 13 0.00% 24 26 0.00% 25 38 0.00% 26 35 0.00% 27 45 0.00% 28 52 0.00% 29 64 0.00% 30 65 0.00% 31 83 0.00% 32 90 0.00% 33 120 0.00% 34 130 0.00% 35 148 0.00% 36 189 0.00% 37 242 0.00% 38 255 0.00% 39 252 0.00% 40 299 0.00% 41 314 0.00% 42 336 0.00% 43 349 0.00% 44 394 0.00% 45 478 0.00% 46 489 0.00% 47 519 0.00% 48 625 0.00% 49 640 0.00% 50 758 0.00% 51 804 0.00% 52 857 0.00% 53 892 0.01% 54 974 0.01% 55 1027 0.01% 56 1199 0.01% 57 1410 0.01% 58 1613 0.01% 59 2882 0.02% 60 2060 0.01% 61 2093 0.01% 62 2403 0.01% 63 2755 0.02% 64 2977 0.02% 65 3369 0.02% 66 3684 0.02% 67 4981 0.03% 68 5128 0.03% 69 5403 0.03% 70 5722 0.03% 71 6695 0.04% 72 7711 0.04% 73 8733 0.05% 74 9868 0.06% 75 11076 0.06% 76 12204 0.07% 77 13031 0.07% 78 13909 0.08% 79 13906 0.08% 80 12800 0.07% 81 8646 0.05% 82 7294 0.04% 83 6710 0.04% 84 9856 0.06% 85 10897 0.06% 86 12350 0.07% 87 14672 0.08% 88 19030 0.11% 89 21778 0.12% 90 36790 0.21% 91 37613 0.22% 92 29804 0.17% 93 35864 0.21% 94 54196 0.31% 95 45347 0.26% 96 47703 0.27% 97 66020 0.38% 98 46628 0.27% 99 37259 0.21% 100 44001 0.25% 101 47774 0.27% 102 43958 0.25% 103 57541 0.33% 104 72604 0.42% 105 83944 0.48% 106 90659 0.52% 107 110491 0.63% 108 88542 0.51% 109 116720 0.67% 110 107204 0.61% 111 125281 0.72% 112 119214 0.68% 113 106797 0.61% 114 111932 0.64% 115 144922 0.83% 116 118628 0.68% 117 108961 0.62% 118 114809 0.66% 119 94250 0.54% 120 120237 0.69% 121 126670 0.73% 122 125325 0.72% 123 103863 0.59% 124 109307 0.63% 125 111859 0.64% 126 113954 0.65% 127 131370 0.75% 128 121528 0.70% 129 126388 0.72% 130 134214 0.77% 131 143501 0.82% 132 153878 0.88% 133 151626 0.87% 134 152296 0.87% 135 159124 0.91% 136 158383 0.91% 137 164214 0.94% 138 167167 0.96% 139 170387 0.98% 140 171282 0.98% 141 174303 1.00% 142 178429 1.02% 143 184313 1.06% 144 193702 1.11% 145 207457 1.19% 146 234426 1.34% 147 285396 1.63% 148 373081 2.14% 149 975258 5.58% 150 9115816 52.20% 17464684 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.4 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=231.58 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.7 sequence=AAAACAACTCCCCTCGAATACAAAAGCTTCCCTCAAAAATCTCCCCAAAGAATCCAACCGAATGTATAATATATGGCTCAAGTACTGGTAATAAAAGATCTCATCACCGCGCAGGGGCTAAAATGGCAGCCAGTAATATATGTAGACAACAGCAGAAATTAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=11.14 fanout-score-rank=10 prefix-density=0.30 prefix-fanout=6.1 sequence=GAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGATGAGTACTGATAGTAGGAAGTGTACTTCCTTTTGTGTTTTTGTTTGGCTGCTATGAGTTTGCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=45.53 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.1 sequence=TGTTGGTGGTGGTACTGGAGCTGT SRR3723579 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:33:41 Started mapping on | Feb 14 07:33:41 Finished on | Feb 14 07:37:27 Mapping speed, Million of reads per hour | 278.20 Number of input reads | 17464684 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 16454757 Uniquely mapped reads % | 94.22% Average mapped length | 278.18 Number of splices: Total | 11355636 Number of splices: Annotated (sjdb) | 11102876 Number of splices: GT/AG | 11172424 Number of splices: GC/AG | 132893 Number of splices: AT/AC | 11360 Number of splices: Non-canonical | 38959 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.04% Deletion average length | 2.62 Insertion rate per base | 0.03% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354572 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 102795 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 673019 673019 673019 N_multimapping 354572 354572 354572 N_noFeature 610674 16180785 738229 N_ambiguous 211413 1260 64111 UnstrandedReadsAssigned:15632670 PositiveStrandReadsAssigned:272712 NegativeStrandReadsAssigned:15652417 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=132 echo kmer=127 SRR3723579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3723579-trimmed-pair1.fastq SRR3723579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,464,684 reads, 15,734,617 reads pseudoaligned [quant] estimated average fragment length: 175.014 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR3723579.ke.tsv 34699 SRR3723579.se.tsv 87100 total ==> SRR3723579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1843.99 392 15.2093 Potri.005G024800.1.v4.1 1035 860.986 31 2.576 Potri.004G059700.1.v4.1 961 786.986 38 3.45459 Potri.007G009000.2.v4.1 1416 1241.99 0 0 Potri.003G141000.2.v4.1 2943 2768.99 206.138 5.32621 Potri.016G087400.1.v4.1 270 110.412 1801.04 1167.05 Potri.015G069301.1.v4.1 564 390.367 0 0 Potri.010G195200.1.v4.1 1773 1598.99 83 3.71376 Potri.012G127500.1.v4.1 977 802.986 1786 159.131 ==> SRR3723579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2948 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3723579 completed mapping pipeline successfully