Starting /dee2/code/volunteer_pipeline.sh SRR3723580 current disk space = 2820843937792 free memory = 1579324132 SRR3723580 SRAfilesize f90bf6e89458bb6c97f281bb7126bc68 SRR3723580.sra SRR3723580.sra file validated SRR3723580 is paired end SRR3723580 is conventional basespace SRR3723580 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1205 34.0 33.0 34.0 31.0 34.0 2 33.3005 34.0 34.0 34.0 31.0 34.0 3 33.377 34.0 34.0 34.0 31.0 34.0 4 36.62525 37.0 37.0 37.0 35.0 37.0 5 36.402 37.0 37.0 37.0 35.0 37.0 6 36.53675 37.0 37.0 37.0 35.0 37.0 7 36.57625 37.0 37.0 37.0 35.0 37.0 8 36.5795 37.0 37.0 37.0 35.0 37.0 9 38.47475 39.0 39.0 39.0 37.0 39.0 10-14 38.795500000000004 39.4 39.2 39.4 37.2 39.4 15-19 40.07135 41.0 40.0 41.0 38.0 41.0 20-24 40.02884999999999 41.0 40.0 41.0 38.0 41.0 25-29 39.939350000000005 41.0 40.0 41.0 38.0 41.0 30-34 39.74135 41.0 40.0 41.0 37.8 41.0 35-39 39.465450000000004 41.0 39.4 41.0 37.0 41.0 40-44 39.50855 41.0 39.8 41.0 37.2 41.0 45-49 39.6634 41.0 40.0 41.0 37.0 41.0 50-54 39.499 41.0 39.6 41.0 36.6 41.0 55-59 39.13035000000001 41.0 39.0 41.0 35.4 41.0 60-64 38.64765 40.2 37.6 41.0 35.0 41.0 65-69 37.934000000000005 39.0 36.4 41.0 34.6 41.0 70-74 36.9543 37.4 35.2 39.4 34.0 41.0 75-79 35.5602 36.0 34.6 37.4 32.6 39.2 80-84 35.102850000000004 35.2 35.0 36.6 33.4 37.8 85-89 34.5389 35.0 35.0 35.8 33.0 36.6 90-94 34.2039 35.0 35.0 35.0 33.0 36.0 95-99 33.9647 35.0 34.8 35.0 32.8 35.4 100-104 33.790049999999994 35.0 34.0 35.0 32.0 35.0 105-109 33.6699 35.0 34.0 35.0 31.6 35.0 110-114 33.63985 35.0 34.0 35.0 31.4 35.0 115-119 33.4855 35.0 34.0 35.0 31.2 35.0 120-124 33.31955000000001 35.0 34.0 35.0 30.8 35.0 125-129 33.116600000000005 35.0 34.0 35.0 30.2 35.0 130-134 32.8132 35.0 33.6 35.0 29.4 35.0 135-139 32.63 35.0 33.0 35.0 29.0 35.0 140-144 32.214 35.0 33.0 35.0 28.2 35.0 145-149 31.5757 34.2 33.0 35.0 26.2 35.0 150 25.93175 32.0 19.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 4.0 13 1.0 14 6.0 15 6.0 16 1.0 17 3.0 18 1.0 19 8.0 20 1.0 21 5.0 22 7.0 23 6.0 24 8.0 25 14.0 26 11.0 27 23.0 28 25.0 29 30.0 30 35.0 31 54.0 32 67.0 33 90.0 34 185.0 35 333.0 36 1048.0 37 1995.0 38 28.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.06406406406406 10.485485485485485 8.533533533533534 41.91691691691692 2 22.45 15.35 34.55 27.650000000000002 3 20.1 17.2 24.25 38.45 4 22.85 26.5 20.65 30.0 5 23.235367997990455 30.746043707611154 24.08942476764632 21.92916352675207 6 18.9 37.375 23.625 20.1 7 13.700000000000001 30.375000000000004 38.525 17.4 8 16.525000000000002 28.925 32.550000000000004 22.0 9 16.075 25.650000000000002 34.675 23.599999999999998 10-14 18.310000000000002 32.565 27.115000000000002 22.009999999999998 15-19 18.82 30.85 27.43 22.900000000000002 20-24 18.78 30.555 27.6 23.064999999999998 25-29 18.855 30.72 27.089999999999996 23.335 30-34 18.775 31.5 26.745 22.98 35-39 19.765 30.214999999999996 26.924999999999997 23.095 40-44 19.285 31.064999999999998 27.3 22.35 45-49 19.655 30.455 26.465 23.425 50-54 19.265 30.895 27.095000000000002 22.745 55-59 19.98 30.035 26.855 23.13 60-64 19.325 29.970000000000002 26.979999999999997 23.724999999999998 65-69 19.63 30.075000000000003 26.924999999999997 23.369999999999997 70-74 19.2 30.43 27.165 23.205000000000002 75-79 19.220000000000002 29.849999999999998 27.425 23.505000000000003 80-84 19.755 30.375000000000004 26.505000000000003 23.365 85-89 19.67 29.92 26.935 23.474999999999998 90-94 19.59 29.86 26.919999999999998 23.630000000000003 95-99 20.055 29.98 26.645000000000003 23.32 100-104 20.48 29.81 26.26 23.45 105-109 20.415 29.645 26.395000000000003 23.544999999999998 110-114 20.515 29.770000000000003 26.810000000000002 22.905 115-119 20.91 30.014999999999997 25.674999999999997 23.400000000000002 120-124 20.94 29.765000000000004 25.009999999999998 24.285 125-129 21.36 29.315 25.245 24.08 130-134 20.985 29.32 25.290000000000003 24.404999999999998 135-139 20.45 29.205 25.28 25.064999999999998 140-144 20.43 29.145 25.005 25.419999999999998 145-149 20.405 29.12 24.82 25.655 150 15.65 32.25 24.325 27.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 2.5 25 6.0 26 11.0 27 15.0 28 18.5 29 23.5 30 30.0 31 46.5 32 59.0 33 60.0 34 86.5 35 110.5 36 114.0 37 132.5 38 156.0 39 180.0 40 214.5 41 230.0 42 229.5 43 241.5 44 253.0 45 245.5 46 234.0 47 233.5 48 219.0 49 178.5 50 141.5 51 111.0 52 86.5 53 71.5 54 59.0 55 50.5 56 34.0 57 22.0 58 21.0 59 17.0 60 10.0 61 7.0 62 6.0 63 7.5 64 8.0 65 4.0 66 0.5 67 1.5 68 2.5 69 2.5 70 2.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.475 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 90-91 1.3625 0.0 0.0 0.0 0.0 92-93 1.6 0.0 0.0 0.0 0.0 94-95 1.9625 0.0 0.0 0.0 0.0 96-97 2.45 0.0 0.0 0.0 0.0 98-99 3.0125 0.0 0.0 0.0 0.0 100-101 3.4749999999999996 0.0 0.0 0.0 0.0 102-103 3.95 0.0 0.0 0.0 0.0 104-105 4.512499999999999 0.0 0.0 0.0 0.0 106-107 5.175 0.0 0.0 0.0 0.0 108-109 6.225 0.0 0.0 0.0 0.0 110-111 7.199999999999999 0.0 0.0 0.0 0.0 112-113 7.949999999999999 0.0 0.0 0.0 0.0 114-115 8.7875 0.0 0.0 0.0 0.0 116-117 10.1 0.0 0.0 0.0 0.0 118-119 11.3625 0.0 0.0 0.0 0.0 120-121 12.6625 0.0 0.0 0.0 0.0 122-123 14.1875 0.0 0.0 0.0 0.0 124-125 15.350000000000001 0.0 0.0 0.0 0.0 126-127 16.65 0.0 0.0 0.0 0.0 128-129 17.9625 0.0 0.0 0.0 0.0 130-131 19.2875 0.0 0.0 0.0 0.0 132-133 20.65 0.0 0.0 0.0 0.0 134-135 21.9625 0.0 0.0 0.0 0.0 136-137 23.700000000000003 0.0 0.0 0.0 0.0 138 25.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAT 10 0.006721726 145.75949 1 ATGTCTT 10 0.0069827023 143.9375 7 GGGGGGG 30 0.0015069954 23.989584 65-69 >>END_MODULE SRR3723580 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723580_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87475 34.0 33.0 34.0 31.0 34.0 2 32.9345 34.0 33.0 34.0 31.0 34.0 3 32.98825 34.0 34.0 34.0 31.0 34.0 4 36.21775 37.0 37.0 37.0 35.0 37.0 5 36.21175 37.0 37.0 37.0 35.0 37.0 6 36.2565 37.0 37.0 37.0 35.0 37.0 7 36.2305 37.0 37.0 37.0 35.0 37.0 8 36.25625 37.0 37.0 37.0 35.0 37.0 9 38.0625 39.0 39.0 39.0 37.0 39.0 10-14 38.4125 39.4 39.2 39.4 37.2 39.4 15-19 39.6203 41.0 40.0 41.0 38.0 41.0 20-24 39.608450000000005 41.0 40.0 41.0 38.0 41.0 25-29 39.44255 41.0 40.0 41.0 37.6 41.0 30-34 39.37865 41.0 40.0 41.0 37.2 41.0 35-39 39.17900000000001 41.0 39.6 41.0 37.0 41.0 40-44 39.087900000000005 40.8 39.0 41.0 36.6 41.0 45-49 39.053 41.0 39.2 41.0 36.0 41.0 50-54 38.11385 39.8 38.0 40.6 34.6 40.6 55-59 38.41865 40.0 38.0 41.0 34.8 41.0 60-64 37.89825 39.6 37.0 41.0 34.0 41.0 65-69 37.469300000000004 39.0 36.2 41.0 34.0 41.0 70-74 36.4225 37.0 35.0 39.2 33.8 41.0 75-79 35.39855 36.0 35.0 37.6 33.0 39.2 80-84 34.58415 35.0 35.0 36.4 33.0 37.6 85-89 34.027 35.0 35.0 35.6 32.0 36.4 90-94 33.706399999999995 35.0 34.6 35.0 31.8 36.0 95-99 33.4769 35.0 34.0 35.0 31.2 35.6 100-104 33.4001 35.0 34.0 35.0 31.0 35.0 105-109 33.213 35.0 34.0 35.0 30.8 35.0 110-114 33.04195 35.0 34.0 35.0 30.0 35.0 115-119 32.8496 35.0 34.0 35.0 29.4 35.0 120-124 32.611000000000004 35.0 33.4 35.0 29.0 35.0 125-129 32.363 35.0 33.0 35.0 28.6 35.0 130-134 32.01805 35.0 32.8 35.0 27.0 35.0 135-139 31.635849999999998 34.6 32.2 35.0 25.0 35.0 140-144 31.092750000000002 34.0 31.8 35.0 24.0 35.0 145-149 30.188800000000004 34.0 31.0 35.0 15.8 35.0 150 25.77175 30.0 23.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 6.0 4 0.0 5 2.0 6 1.0 7 1.0 8 3.0 9 3.0 10 2.0 11 2.0 12 4.0 13 1.0 14 6.0 15 3.0 16 4.0 17 3.0 18 3.0 19 1.0 20 2.0 21 4.0 22 7.0 23 14.0 24 12.0 25 20.0 26 8.0 27 21.0 28 27.0 29 27.0 30 41.0 31 83.0 32 78.0 33 124.0 34 189.0 35 410.0 36 1242.0 37 1582.0 38 34.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9 18.9 15.125 29.075 2 26.5 25.15 33.175 15.174999999999999 3 20.4 27.400000000000002 33.25 18.95 4 24.9 31.324999999999996 25.650000000000002 18.125 5 25.4 33.825 23.225 17.549999999999997 6 20.7 38.65 23.325000000000003 17.325 7 21.224999999999998 22.0 39.25 17.525 8 21.725 25.474999999999998 28.799999999999997 24.0 9 22.525000000000002 24.349999999999998 30.099999999999998 23.025000000000002 10-14 24.245 28.89 26.395000000000003 20.47 15-19 23.54 27.650000000000002 28.485 20.325 20-24 22.955000000000002 27.76 28.965000000000003 20.32 25-29 23.805 27.66 28.815 19.72 30-34 23.044999999999998 27.6 29.085 20.27 35-39 23.25 27.250000000000004 28.665000000000003 20.835 40-44 24.3 27.72 28.16 19.82 45-49 22.95 27.235 29.435 20.380000000000003 50-54 23.125 27.395000000000003 29.520000000000003 19.96 55-59 23.46 26.985 29.18 20.375 60-64 23.18 26.979999999999997 29.909999999999997 19.93 65-69 23.28 26.534999999999997 30.36 19.825 70-74 23.69 27.675 28.96 19.675 75-79 23.53 26.795 30.11 19.564999999999998 80-84 23.86 27.029999999999998 29.285 19.825 85-89 23.78 27.175 29.770000000000003 19.275000000000002 90-94 23.244999999999997 27.675 29.470000000000002 19.61 95-99 23.595 27.22 29.92 19.265 100-104 24.29 27.57 28.915000000000003 19.225 105-109 24.66 27.425 28.849999999999998 19.064999999999998 110-114 24.51 27.305 29.14 19.045 115-119 25.695 27.79 27.99 18.525 120-124 25.53 28.189999999999998 27.775 18.505 125-129 26.615 27.834999999999997 27.439999999999998 18.11 130-134 26.665 27.47 27.584999999999997 18.279999999999998 135-139 27.150000000000002 28.115000000000002 26.985 17.75 140-144 28.595 27.785 26.13 17.49 145-149 28.694999999999997 28.15 25.590000000000003 17.565 150 29.799999999999997 26.775 25.674999999999997 17.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 1.5 23 1.5 24 0.5 25 1.5 26 3.0 27 4.5 28 11.0 29 15.0 30 20.0 31 31.0 32 37.0 33 55.5 34 82.0 35 100.0 36 118.0 37 130.0 38 135.0 39 153.0 40 195.0 41 231.5 42 247.5 43 260.5 44 258.5 45 267.5 46 269.0 47 236.0 48 209.5 49 196.0 50 155.5 51 109.5 52 95.5 53 79.0 54 67.5 55 57.0 56 38.0 57 27.5 58 23.0 59 17.0 60 10.0 61 7.0 62 5.0 63 3.5 64 5.5 65 6.0 66 3.5 67 2.5 68 2.0 69 1.5 70 2.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 90-91 1.3875 0.0 0.0 0.0 0.0 92-93 1.625 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.4749999999999996 0.0 0.0 0.0 0.0 98-99 3.0125 0.0 0.0 0.0 0.0 100-101 3.4875 0.0 0.0 0.0 0.0 102-103 3.975 0.0 0.0 0.0 0.0 104-105 4.5375 0.0 0.0 0.0 0.0 106-107 5.225 0.0 0.0 0.0 0.0 108-109 6.3 0.0 0.0 0.0 0.0 110-111 7.275 0.0 0.0 0.0 0.0 112-113 8.037500000000001 0.0 0.0 0.0 0.0 114-115 8.8875 0.0 0.0 0.0 0.0 116-117 10.2125 0.0 0.0 0.0 0.0 118-119 11.5 0.0 0.0 0.0 0.0 120-121 12.8375 0.0 0.0 0.0 0.0 122-123 14.375 0.0 0.0 0.0 0.0 124-125 15.6125 0.0 0.0 0.0 0.0 126-127 16.9625 0.0 0.0 0.0 0.0 128-129 18.325000000000003 0.0 0.0 0.0 0.0 130-131 19.6875 0.0 0.0 0.0 0.0 132-133 21.0625 0.0 0.0 0.0 0.0 134-135 22.4375 0.0 0.0 0.0 0.0 136-137 24.15 0.0 0.0 0.0 0.0 138 25.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363707 spots for SRR3723580.sra Written 1363707 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra Read 1363705 spots for SRR3723580.sra Written 1363705 spots for SRR3723580.sra SRR ids: ['SRR3723580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yuebj7ae SRR3723580.sra spots: 27274102 blocks: [[1, 1363705], [1363706, 2727410], [2727411, 4091115], [4091116, 5454820], [5454821, 6818525], [6818526, 8182230], [8182231, 9545935], [9545936, 10909640], [10909641, 12273345], [12273346, 13637050], [13637051, 15000755], [15000756, 16364460], [16364461, 17728165], [17728166, 19091870], [19091871, 20455575], [20455576, 21819280], [21819281, 23182985], [23182986, 24546690], [24546691, 25910395], [25910396, 27274102]] SRR3723580 file size 9167328 SRR3723580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3723580 SRR3723580_1.fastq SRR3723580_2.fastq Input file: SRR3723580_1.fastq Paired file: SRR3723580_2.fastq trimmed: SRR3723580-trimmed-pair1.fastq, SRR3723580-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:15:39 2025 >> started Thu Apr 10 15:16:14 2025 >> done (35.443s) 27274102 read pairs processed; of these: 67487 ( 0.25%) short read pairs filtered out after trimming by size control 161498 ( 0.59%) empty read pairs filtered out after trimming by size control 27045117 (99.16%) read pairs available; of these: 13061058 (48.29%) trimmed read pairs available after processing 13984059 (51.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 10 0.00% 21 9 0.00% 22 25 0.00% 23 28 0.00% 24 31 0.00% 25 51 0.00% 26 50 0.00% 27 85 0.00% 28 116 0.00% 29 143 0.00% 30 160 0.00% 31 192 0.00% 32 215 0.00% 33 268 0.00% 34 302 0.00% 35 320 0.00% 36 402 0.00% 37 487 0.00% 38 505 0.00% 39 548 0.00% 40 634 0.00% 41 688 0.00% 42 743 0.00% 43 853 0.00% 44 954 0.00% 45 951 0.00% 46 1052 0.00% 47 1135 0.00% 48 1257 0.00% 49 1369 0.01% 50 1435 0.01% 51 1549 0.01% 52 1603 0.01% 53 1734 0.01% 54 1930 0.01% 55 2066 0.01% 56 2234 0.01% 57 2480 0.01% 58 3482 0.01% 59 3080 0.01% 60 3235 0.01% 61 3433 0.01% 62 3718 0.01% 63 4172 0.02% 64 4481 0.02% 65 5063 0.02% 66 6545 0.02% 67 6647 0.02% 68 7460 0.03% 69 7504 0.03% 70 8148 0.03% 71 9078 0.03% 72 10287 0.04% 73 11576 0.04% 74 13313 0.05% 75 14630 0.05% 76 16538 0.06% 77 16974 0.06% 78 18385 0.07% 79 18468 0.07% 80 18311 0.07% 81 15364 0.06% 82 14075 0.05% 83 13582 0.05% 84 17037 0.06% 85 18428 0.07% 86 21374 0.08% 87 22930 0.08% 88 25850 0.10% 89 27867 0.10% 90 46379 0.17% 91 44892 0.17% 92 38614 0.14% 93 56496 0.21% 94 58387 0.22% 95 67164 0.25% 96 90983 0.34% 97 86316 0.32% 98 61821 0.23% 99 55543 0.21% 100 70892 0.26% 101 74270 0.27% 102 103884 0.38% 103 91224 0.34% 104 131256 0.49% 105 88588 0.33% 106 136448 0.50% 107 112205 0.41% 108 169780 0.63% 109 164076 0.61% 110 128100 0.47% 111 152242 0.56% 112 98958 0.37% 113 168367 0.62% 114 144167 0.53% 115 204774 0.76% 116 149410 0.55% 117 197321 0.73% 118 136730 0.51% 119 190002 0.70% 120 171970 0.64% 121 211396 0.78% 122 165500 0.61% 123 153729 0.57% 124 179412 0.66% 125 174537 0.65% 126 223684 0.83% 127 195133 0.72% 128 173327 0.64% 129 227810 0.84% 130 213460 0.79% 131 235465 0.87% 132 235128 0.87% 133 249392 0.92% 134 249488 0.92% 135 247693 0.92% 136 258023 0.95% 137 260407 0.96% 138 267759 0.99% 139 273381 1.01% 140 274632 1.02% 141 281548 1.04% 142 288175 1.07% 143 298904 1.11% 144 318225 1.18% 145 343882 1.27% 146 404253 1.49% 147 463557 1.71% 148 636201 2.35% 149 1646045 6.09% 150 13984059 51.71% 27045117 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.1 sequence=TATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=41 fanout-score=330.17 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=21.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=9.00 fanout-score-rank=13 prefix-density=0.29 prefix-fanout=5.3 sequence=GAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGATGAGTACTGATA criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=234.34 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=27.5 sequence=AAGAAGAAGAAA SRR3723580 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:16:56 Started mapping on | Apr 10 15:16:56 Finished on | Apr 10 15:18:53 Mapping speed, Million of reads per hour | 832.16 Number of input reads | 27045117 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 26145343 Uniquely mapped reads % | 96.67% Average mapped length | 278.98 Number of splices: Total | 18104970 Number of splices: Annotated (sjdb) | 17742976 Number of splices: GT/AG | 17814705 Number of splices: GC/AG | 215061 Number of splices: AT/AC | 18390 Number of splices: Non-canonical | 56814 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.05% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 564064 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 136751 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 356788 356788 356788 N_multimapping 564064 564064 564064 N_noFeature 842526 25754218 1026551 N_ambiguous 305161 1467 97075 UnstrandedReadsAssigned:24997656 PositiveStrandReadsAssigned:389658 NegativeStrandReadsAssigned:25021717 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=130 echo kmer=125 SRR3723580 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3723580-trimmed-pair1.fastq SRR3723580-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,045,117 reads, 25,132,198 reads pseudoaligned [quant] estimated average fragment length: 173.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR3723580.ke.tsv 34699 SRR3723580.se.tsv 87100 total ==> SRR3723580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1845.81 578 13.0858 Potri.005G024800.1.v4.1 1035 862.808 63 3.05131 Potri.004G059700.1.v4.1 961 788.818 17 0.900601 Potri.007G009000.2.v4.1 1416 1243.81 0 0 Potri.003G141000.2.v4.1 2943 2770.81 425.035 6.41031 Potri.016G087400.1.v4.1 270 110.168 2929.83 1111.34 Potri.015G069301.1.v4.1 564 392.135 0 0 Potri.010G195200.1.v4.1 1773 1600.81 93 2.42775 Potri.012G127500.1.v4.1 977 804.813 8766 455.163 ==> SRR3723580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2806 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 522 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3723580 completed mapping pipeline successfully