Starting /dee2/code/volunteer_pipeline.sh SRR3723581 current disk space = 3118904066048 free memory = 1466866872 SRR3723581 SRAfilesize 46346c57afcbc5be088149d67b2c28dc SRR3723581.sra SRR3723581.sra file validated SRR3723581 is paired end SRR3723581 is conventional basespace SRR3723581 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.45925 34.0 33.0 34.0 31.0 34.0 2 32.96025 34.0 34.0 34.0 31.0 34.0 3 33.3425 34.0 34.0 34.0 31.0 34.0 4 36.57475 37.0 37.0 37.0 35.0 37.0 5 36.60625 37.0 37.0 37.0 35.0 37.0 6 36.59275 37.0 37.0 37.0 35.0 37.0 7 36.62925 37.0 37.0 37.0 35.0 37.0 8 36.67025 37.0 37.0 37.0 35.0 37.0 9 38.5775 39.0 39.0 39.0 38.0 39.0 10-14 38.87875 39.4 39.2 39.4 37.8 39.4 15-19 40.1952 41.0 40.0 41.0 38.2 41.0 20-24 40.14135 41.0 40.0 41.0 38.2 41.0 25-29 40.0541 41.0 40.0 41.0 38.0 41.0 30-34 39.8625 41.0 40.0 41.0 38.0 41.0 35-39 39.72975 41.0 40.0 41.0 37.8 41.0 40-44 39.5576 41.0 40.0 41.0 37.0 41.0 45-49 39.39450000000001 41.0 39.4 41.0 36.4 41.0 50-54 39.099900000000005 40.2 39.0 41.0 35.4 41.0 55-59 38.823449999999994 40.0 38.0 41.0 35.0 41.0 60-64 38.643150000000006 40.0 37.4 41.0 35.0 41.0 65-69 38.005849999999995 39.0 36.4 41.0 35.0 41.0 70-74 37.008050000000004 37.4 35.2 39.6 34.0 41.0 75-79 35.74175 36.2 34.8 37.6 33.4 39.4 80-84 35.1535 35.2 35.0 36.6 34.0 38.0 85-89 34.543099999999995 35.0 35.0 35.6 33.0 36.6 90-94 34.17 35.0 35.0 35.0 33.0 36.0 95-99 34.021049999999995 35.0 35.0 35.0 33.0 35.2 100-104 33.667899999999996 35.0 34.0 35.0 31.6 35.0 105-109 33.699400000000004 35.0 34.2 35.0 31.8 35.0 110-114 33.640249999999995 35.0 34.0 35.0 32.0 35.0 115-119 33.5416 35.0 34.0 35.0 31.6 35.0 120-124 33.37904999999999 35.0 34.0 35.0 31.0 35.0 125-129 33.1327 35.0 34.0 35.0 30.6 35.0 130-134 32.92655 35.0 34.0 35.0 29.8 35.0 135-139 32.63325 35.0 33.8 35.0 29.2 35.0 140-144 32.290350000000004 35.0 33.2 35.0 28.6 35.0 145-149 31.454250000000002 35.0 32.8 35.0 25.4 35.0 150 25.842 32.0 19.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 2.0 10 3.0 11 0.0 12 3.0 13 1.0 14 1.0 15 1.0 16 3.0 17 4.0 18 9.0 19 3.0 20 7.0 21 8.0 22 5.0 23 4.0 24 9.0 25 16.0 26 17.0 27 12.0 28 28.0 29 24.0 30 35.0 31 54.0 32 62.0 33 82.0 34 167.0 35 364.0 36 1078.0 37 1961.0 38 34.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.492917847025495 11.743497295905229 7.185166108678856 38.57841874839042 2 22.641981486114584 15.111333500125093 32.524393294971226 29.72229171878909 3 20.375 16.85 26.5 36.275 4 22.907268170426065 25.31328320802005 21.629072681704262 30.15037593984962 5 23.599999999999998 30.825000000000003 23.474999999999998 22.1 6 20.674999999999997 35.425000000000004 22.0 21.9 7 14.249999999999998 29.525000000000002 37.824999999999996 18.4 8 16.125 27.900000000000002 31.724999999999998 24.25 9 16.625 27.525 32.45 23.400000000000002 10-14 18.655 31.615 27.465 22.264999999999997 15-19 19.12 30.04 26.965 23.875 20-24 19.134999999999998 30.570000000000004 27.065 23.23 25-29 19.055 30.435000000000002 27.084999999999997 23.425 30-34 19.45 30.635 26.6 23.315 35-39 19.33 30.775000000000002 26.41 23.485 40-44 19.34 30.44 26.625 23.595 45-49 19.575 29.775000000000002 27.315 23.335 50-54 19.375 30.61 26.97 23.044999999999998 55-59 19.74 30.580000000000002 26.479999999999997 23.200000000000003 60-64 20.105 30.209999999999997 26.55 23.135 65-69 19.695 29.59 27.215 23.5 70-74 19.994999999999997 29.93 26.979999999999997 23.095 75-79 20.06 29.609999999999996 27.185 23.145 80-84 19.655 29.310000000000002 27.515 23.52 85-89 19.89 29.744999999999997 26.790000000000003 23.575 90-94 20.46 29.64 26.865 23.035 95-99 19.81 29.53 27.02 23.64 100-104 20.43 29.354999999999997 26.669999999999998 23.544999999999998 105-109 20.115 29.065 26.625 24.195 110-114 20.945 29.555 26.224999999999998 23.275000000000002 115-119 20.919999999999998 30.11 25.55 23.419999999999998 120-124 20.91 29.715000000000003 25.779999999999998 23.595 125-129 21.14 29.115000000000002 25.72 24.025 130-134 20.72 29.13 26.490000000000002 23.66 135-139 21.215 29.925 25.230000000000004 23.630000000000003 140-144 21.925 30.37 24.395 23.31 145-149 20.945 30.64 23.93 24.485 150 17.95065458207452 33.58509566968782 23.136958710976838 25.327291037260824 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.5 21 2.5 22 3.0 23 2.0 24 3.0 25 5.0 26 5.0 27 8.0 28 13.0 29 16.5 30 23.5 31 37.5 32 48.5 33 65.5 34 86.0 35 96.0 36 107.5 37 142.5 38 161.5 39 166.0 40 179.5 41 194.0 42 224.5 43 248.0 44 235.0 45 231.0 46 249.5 47 250.0 48 222.5 49 195.0 50 173.5 51 139.0 52 119.5 53 97.0 54 66.0 55 42.0 56 32.0 57 26.0 58 18.5 59 14.5 60 11.5 61 6.5 62 3.0 63 3.5 64 3.5 65 4.5 66 3.5 67 3.5 68 2.0 69 0.0 70 0.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.075 3 0.0 4 0.25 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.8374999999999999 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.075 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.225 0.0 0.0 0.0 0.0 90-91 1.2625 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 1.8375 0.0 0.0 0.0 0.0 98-99 2.0999999999999996 0.0 0.0 0.0 0.0 100-101 2.35 0.0 0.0 0.0 0.0 102-103 2.825 0.0 0.0 0.0 0.0 104-105 3.6 0.0 0.0 0.0 0.0 106-107 4.4125 0.0 0.0 0.0 0.0 108-109 5.199999999999999 0.0 0.0 0.0 0.0 110-111 6.1625 0.0 0.0 0.0 0.0 112-113 6.9125 0.0 0.0 0.0 0.0 114-115 7.7875 0.0 0.0 0.0 0.0 116-117 8.7375 0.0 0.0 0.0 0.0 118-119 9.2375 0.0 0.0 0.0 0.0 120-121 9.725000000000001 0.0 0.0 0.0 0.0 122-123 11.1 0.0 0.0 0.0 0.0 124-125 11.8375 0.0 0.0 0.0 0.0 126-127 12.212499999999999 0.0 0.0 0.0 0.0 128-129 13.037500000000001 0.0 0.0 0.0 0.0 130-131 14.3375 0.0 0.0 0.0 0.0 132-133 15.6375 0.0 0.0 0.0 0.0 134-135 17.262500000000003 0.0 0.0 0.0 0.0 136-137 18.675 0.0 0.0 0.0 0.0 138 19.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3723581 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3723581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17725 34.0 31.0 34.0 31.0 34.0 2 32.09025 34.0 31.0 34.0 31.0 34.0 3 32.34075 34.0 33.0 34.0 31.0 34.0 4 35.6685 37.0 37.0 37.0 35.0 37.0 5 35.634 37.0 37.0 37.0 35.0 37.0 6 35.725 37.0 37.0 37.0 35.0 37.0 7 35.66175 37.0 37.0 37.0 35.0 37.0 8 35.682 37.0 37.0 37.0 35.0 37.0 9 37.44625 39.0 39.0 39.0 37.0 39.0 10-14 37.79455 39.4 39.2 39.4 37.2 39.4 15-19 39.068200000000004 41.0 40.0 41.0 37.6 41.0 20-24 38.976749999999996 41.0 40.0 41.0 37.2 41.0 25-29 38.86295 41.0 40.0 41.0 37.0 41.0 30-34 38.8114 41.0 40.0 41.0 36.8 41.0 35-39 38.590250000000005 41.0 39.8 41.0 36.0 41.0 40-44 38.367749999999994 41.0 39.0 41.0 35.0 41.0 45-49 38.16715 40.0 39.0 41.0 34.8 41.0 50-54 37.4219 39.6 38.0 40.6 33.6 40.8 55-59 37.42864999999999 40.0 37.6 41.0 33.2 41.0 60-64 37.362 39.8 37.0 41.0 34.0 41.0 65-69 36.818650000000005 38.8 35.8 41.0 34.0 41.0 70-74 35.835950000000004 37.0 35.0 39.4 33.2 41.0 75-79 34.79185 35.8 35.0 37.6 32.2 39.2 80-84 33.9172 35.0 35.0 36.4 31.8 37.8 85-89 33.273399999999995 35.0 34.4 35.4 31.0 36.4 90-94 33.049099999999996 35.0 34.0 35.0 31.0 36.0 95-99 32.7901 35.0 34.0 35.0 30.2 35.4 100-104 32.60455 35.0 34.0 35.0 29.6 35.0 105-109 32.45665 35.0 34.0 35.0 29.0 35.0 110-114 32.2908 35.0 34.0 35.0 29.0 35.0 115-119 32.114799999999995 35.0 34.0 35.0 27.4 35.0 120-124 31.943699999999996 35.0 33.4 35.0 27.4 35.0 125-129 31.699900000000003 35.0 33.0 35.0 25.0 35.0 130-134 31.4443 35.0 33.0 35.0 24.6 35.0 135-139 30.979650000000003 35.0 32.0 35.0 21.4 35.0 140-144 30.56495 34.4 31.8 35.0 18.6 35.0 145-149 30.049500000000002 34.0 31.2 35.0 7.4 35.0 150 27.83625 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 86.0 3 6.0 4 5.0 5 4.0 6 3.0 7 6.0 8 5.0 9 3.0 10 1.0 11 3.0 12 6.0 13 4.0 14 8.0 15 1.0 16 4.0 17 8.0 18 8.0 19 5.0 20 8.0 21 11.0 22 10.0 23 10.0 24 10.0 25 15.0 26 17.0 27 21.0 28 22.0 29 24.0 30 22.0 31 46.0 32 77.0 33 109.0 34 175.0 35 434.0 36 1161.0 37 1612.0 38 50.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1969887076537 20.125470514429107 12.547051442910917 28.130489335006274 2 26.194645984488368 26.51988991743808 31.148361270953217 16.13710282712034 3 21.335667833916958 26.88844422211106 32.21610805402702 19.559779889944974 4 23.861930965482742 32.7663831915958 24.462231115557778 18.90945472736368 5 24.787393696848426 34.94247123561781 23.71185592796398 16.558279139569784 6 21.4 36.675000000000004 24.175 17.75 7 20.625 21.9 38.6 18.875 8 21.25 25.275 31.15 22.325 9 23.400000000000002 25.0 30.599999999999998 21.0 10-14 24.3 28.199999999999996 27.450000000000003 20.05 15-19 23.375 27.68 28.32 20.625 20-24 23.72 27.944999999999997 28.09 20.244999999999997 25-29 23.810000000000002 27.24 28.384999999999998 20.565 30-34 23.465 27.794999999999998 28.71 20.03 35-39 22.770000000000003 27.12 29.409999999999997 20.7 40-44 23.69 27.589999999999996 28.804999999999996 19.915 45-49 23.21 27.295 29.115000000000002 20.380000000000003 50-54 23.49 26.83 29.065 20.615 55-59 23.400000000000002 26.99 28.925 20.685000000000002 60-64 22.720000000000002 27.325 29.665000000000003 20.29 65-69 23.494999999999997 26.8 29.794999999999998 19.91 70-74 23.615 27.16 29.03 20.195 75-79 23.0 26.815 30.159999999999997 20.025000000000002 80-84 23.875 27.16 29.304999999999996 19.66 85-89 23.25 26.72 29.99 20.04 90-94 23.7 27.485 29.354999999999997 19.46 95-99 24.29 26.96 29.315 19.435 100-104 24.46 27.295 28.595 19.650000000000002 105-109 24.38 27.195000000000004 28.84 19.585 110-114 24.8 26.939999999999998 28.82 19.439999999999998 115-119 24.560000000000002 26.995 29.345 19.1 120-124 25.369999999999997 27.495000000000005 27.750000000000004 19.384999999999998 125-129 26.035000000000004 26.855 28.57 18.54 130-134 26.424999999999997 28.335 27.255000000000003 17.985 135-139 26.295 28.715000000000003 26.645000000000003 18.345 140-144 27.195000000000004 28.000000000000004 26.705000000000002 18.099999999999998 145-149 27.57 28.515 26.135 17.78 150 29.158266129032256 26.789314516129032 25.554435483870968 18.49798387096774 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 2.0 8 2.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 3.0 21 2.5 22 1.0 23 1.0 24 1.0 25 3.5 26 8.0 27 7.0 28 11.5 29 16.5 30 22.0 31 28.0 32 27.5 33 41.0 34 62.5 35 80.5 36 95.5 37 117.0 38 140.5 39 174.0 40 196.0 41 211.5 42 245.0 43 261.5 44 263.5 45 258.5 46 247.0 47 243.0 48 238.5 49 193.0 50 154.5 51 146.5 52 114.5 53 95.0 54 81.0 55 48.0 56 30.5 57 26.0 58 22.5 59 15.5 60 9.5 61 8.0 62 5.5 63 5.5 64 5.0 65 2.5 66 2.5 67 3.0 68 1.5 69 0.5 70 0.5 71 1.0 72 2.5 73 1.5 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.075 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.8374999999999999 0.0 0.0 0.0 0.0 82-83 0.9624999999999999 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.675 0.0 0.0 0.0 0.0 96-97 1.8875000000000002 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.8499999999999996 0.0 0.0 0.0 0.0 104-105 3.6 0.0 0.0 0.0 0.0 106-107 4.3875 0.0 0.0 0.0 0.0 108-109 5.15 0.0 0.0 0.0 0.0 110-111 6.1 0.0 0.0 0.0 0.0 112-113 6.875 0.0 0.0 0.0 0.0 114-115 7.7875 0.0 0.0 0.0 0.0 116-117 8.787500000000001 0.0 0.0 0.0 0.0 118-119 9.287500000000001 0.0 0.0 0.0 0.0 120-121 9.774999999999999 0.0 0.0 0.0 0.0 122-123 11.125 0.0 0.0 0.0 0.0 124-125 11.8625 0.0 0.0 0.0 0.0 126-127 12.2375 0.0 0.0 0.0 0.0 128-129 13.05 0.0 0.0 0.0 0.0 130-131 14.35 0.0 0.0 0.0 0.0 132-133 15.6 0.0 0.0 0.0 0.0 134-135 17.1875 0.0 0.0 0.0 0.0 136-137 18.5875 0.0 0.0 0.0 0.0 138 19.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283162 spots for SRR3723581.sra Written 1283162 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra Read 1283154 spots for SRR3723581.sra Written 1283154 spots for SRR3723581.sra SRR ids: ['SRR3723581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w6ih5i5s SRR3723581.sra spots: 25663088 blocks: [[1, 1283154], [1283155, 2566308], [2566309, 3849462], [3849463, 5132616], [5132617, 6415770], [6415771, 7698924], [7698925, 8982078], [8982079, 10265232], [10265233, 11548386], [11548387, 12831540], [12831541, 14114694], [14114695, 15397848], [15397849, 16681002], [16681003, 17964156], [17964157, 19247310], [19247311, 20530464], [20530465, 21813618], [21813619, 23096772], [23096773, 24379926], [24379927, 25663088]] SRR3723581 file size 8624554 SRR3723581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3723581 SRR3723581_1.fastq SRR3723581_2.fastq Input file: SRR3723581_1.fastq Paired file: SRR3723581_2.fastq trimmed: SRR3723581-trimmed-pair1.fastq, SRR3723581-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:51:56 2025 >> started Fri Feb 14 07:52:27 2025 >> done (31.314s) 25663088 read pairs processed; of these: 94270 ( 0.37%) short read pairs filtered out after trimming by size control 329916 ( 1.29%) empty read pairs filtered out after trimming by size control 25238902 (98.35%) read pairs available; of these: 11260727 (44.62%) trimmed read pairs available after processing 13978175 (55.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 6 0.00% 21 14 0.00% 22 20 0.00% 23 43 0.00% 24 38 0.00% 25 49 0.00% 26 72 0.00% 27 88 0.00% 28 189 0.00% 29 691 0.00% 30 123 0.00% 31 180 0.00% 32 208 0.00% 33 235 0.00% 34 273 0.00% 35 334 0.00% 36 352 0.00% 37 355 0.00% 38 455 0.00% 39 441 0.00% 40 469 0.00% 41 543 0.00% 42 597 0.00% 43 611 0.00% 44 650 0.00% 45 742 0.00% 46 848 0.00% 47 881 0.00% 48 954 0.00% 49 1064 0.00% 50 1121 0.00% 51 1237 0.00% 52 1332 0.01% 53 1458 0.01% 54 1571 0.01% 55 1755 0.01% 56 1848 0.01% 57 2115 0.01% 58 2345 0.01% 59 2580 0.01% 60 2891 0.01% 61 3194 0.01% 62 3610 0.01% 63 4070 0.02% 64 4381 0.02% 65 5037 0.02% 66 5448 0.02% 67 6077 0.02% 68 6717 0.03% 69 7506 0.03% 70 8581 0.03% 71 9786 0.04% 72 11093 0.04% 73 13031 0.05% 74 14452 0.06% 75 16179 0.06% 76 17911 0.07% 77 19334 0.08% 78 20596 0.08% 79 20509 0.08% 80 18847 0.07% 81 15976 0.06% 82 10636 0.04% 83 10430 0.04% 84 16704 0.07% 85 17599 0.07% 86 21757 0.09% 87 32159 0.13% 88 31461 0.12% 89 22049 0.09% 90 23910 0.09% 91 31685 0.13% 92 38366 0.15% 93 28167 0.11% 94 28229 0.11% 95 28190 0.11% 96 31245 0.12% 97 39678 0.16% 98 57474 0.23% 99 53343 0.21% 100 31809 0.13% 101 44392 0.18% 102 136060 0.54% 103 79951 0.32% 104 82553 0.33% 105 115238 0.46% 106 108606 0.43% 107 71211 0.28% 108 110827 0.44% 109 132016 0.52% 110 149636 0.59% 111 66009 0.26% 112 91305 0.36% 113 153480 0.61% 114 136886 0.54% 115 221205 0.88% 116 62516 0.25% 117 41593 0.16% 118 55567 0.22% 119 87081 0.35% 120 64266 0.25% 121 182194 0.72% 122 194198 0.77% 123 102270 0.41% 124 39179 0.16% 125 41776 0.17% 126 124401 0.49% 127 103791 0.41% 128 109906 0.44% 129 188700 0.75% 130 236664 0.94% 131 159254 0.63% 132 127123 0.50% 133 230141 0.91% 134 247960 0.98% 135 194909 0.77% 136 249219 0.99% 137 243185 0.96% 138 265092 1.05% 139 265923 1.05% 140 275305 1.09% 141 279658 1.11% 142 285916 1.13% 143 289681 1.15% 144 304316 1.21% 145 331621 1.31% 146 362177 1.43% 147 420279 1.67% 148 566417 2.24% 149 2010061 7.96% 150 13978175 55.38% 25238902 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=14.62 fanout-score-rank=15 prefix-density=0.30 prefix-fanout=7.2 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=246.79 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=30.0 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=6.57 fanout-score-rank=21 prefix-density=0.19 prefix-fanout=4.4 sequence=CAGCACCAGCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=243.48 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=15.9 sequence=TGGTGGTGGAGCCAACACTTTGGCCGATGGGTTCAGCACCGGCACTGGATTGGGTGCTGAGATCATTGGCACTTTTGTCCTGGTCTACACTGTTTTCTCTGCTACAGATCCAAAGAGGAGTGCTAGGGACTCCCATGTGCCTGTTTTGGCTCCTCTTCCAATTGGATTTGCTGTGTTCATGGTTCACTTGGCCACCATCCCCATCACTGGAACTGG SRR3723581 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:53:22 Started mapping on | Feb 14 07:53:23 Finished on | Feb 14 07:56:31 Mapping speed, Million of reads per hour | 483.30 Number of input reads | 25238902 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 23721098 Uniquely mapped reads % | 93.99% Average mapped length | 282.59 Number of splices: Total | 17245498 Number of splices: Annotated (sjdb) | 16912855 Number of splices: GT/AG | 16964150 Number of splices: GC/AG | 212152 Number of splices: AT/AC | 18375 Number of splices: Non-canonical | 50821 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.04% Deletion average length | 2.44 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471271 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 133012 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1073924 1073924 1073924 N_multimapping 471271 471271 471271 N_noFeature 667118 23350597 843964 N_ambiguous 280205 1792 85383 UnstrandedReadsAssigned:22773775 PositiveStrandReadsAssigned:368709 NegativeStrandReadsAssigned:22791751 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR3723581 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3723581-trimmed-pair1.fastq SRR3723581-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,238,902 reads, 22,863,730 reads pseudoaligned [quant] estimated average fragment length: 180.466 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR3723581.ke.tsv 34699 SRR3723581.se.tsv 87100 total ==> SRR3723581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.53 495 12.5638 Potri.005G024800.1.v4.1 1035 855.534 56 3.05449 Potri.004G059700.1.v4.1 961 781.539 27 1.61214 Potri.007G009000.2.v4.1 1416 1236.53 0 0 Potri.003G141000.2.v4.1 2943 2763.53 414.13 6.99296 Potri.016G087400.1.v4.1 270 105.71 3204.95 1414.8 Potri.015G069301.1.v4.1 564 385.027 0 0 Potri.010G195200.1.v4.1 1773 1593.53 106 3.10408 Potri.012G127500.1.v4.1 977 797.534 12474 729.869 ==> SRR3723581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2388 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 424 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3723581 completed mapping pipeline successfully