Starting /dee2/code/volunteer_pipeline.sh SRR3727110 current disk space = 3116963987456 free memory = 1578246068 SRR3727110 SRAfilesize 9c036b9a76d386a3b16d750968c9f798 SRR3727110.sra SRR3727110.sra file validated SRR3727110 is paired end SRR3727110 is conventional basespace SRR3727110 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727110_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.828 33.0 31.0 34.0 28.0 34.0 2 31.8745 34.0 31.0 34.0 30.0 34.0 3 29.40025 31.0 28.0 34.0 16.0 34.0 4 34.9295 37.0 35.0 37.0 32.0 37.0 5 35.64075 37.0 35.0 37.0 33.0 37.0 6 35.91375 37.0 35.0 37.0 35.0 37.0 7 36.046 37.0 35.0 37.0 35.0 37.0 8 36.1045 37.0 36.0 37.0 35.0 37.0 9 37.78825 39.0 38.0 39.0 35.0 39.0 10-14 38.047399999999996 39.2 38.0 39.4 35.2 39.4 15-19 39.0495 40.0 38.0 41.0 35.8 41.0 20-24 38.9971 40.0 38.4 41.0 35.2 41.0 25-29 38.7789 40.0 38.0 41.0 34.6 41.0 30-34 38.393950000000004 40.0 38.0 41.0 34.0 41.0 35-39 38.139649999999996 40.0 38.0 41.0 33.6 41.0 40-44 38.1062 40.0 37.8 41.0 33.2 41.0 45-49 37.97275 40.0 37.4 41.0 33.2 41.0 50-54 38.139149999999994 40.0 37.8 41.0 33.6 41.0 55-59 37.4892 39.8 36.6 41.0 32.0 41.0 60-64 37.18565 39.2 36.2 40.8 31.6 41.0 65-69 36.1263 37.8 34.8 40.0 30.4 41.0 70-74 35.38405 36.4 34.2 39.0 29.8 40.4 75-79 34.157349999999994 35.2 33.6 37.2 29.2 39.0 80-84 33.7225 35.0 33.8 36.2 29.2 37.6 85-89 33.02835 35.0 33.0 35.2 29.0 36.4 90-94 32.4608 35.0 33.0 35.0 27.8 35.6 95-99 31.844749999999998 34.4 32.2 35.0 25.8 35.0 100-104 31.68315 34.0 31.8 35.0 25.0 35.0 105-109 31.618650000000002 34.0 31.8 35.0 25.0 35.0 110-114 31.04865 34.0 31.0 35.0 24.2 35.0 115-119 30.400149999999996 34.0 30.2 35.0 21.6 35.0 120-124 29.996550000000003 34.0 29.4 35.0 18.8 35.0 125-129 29.4147 33.8 28.6 35.0 16.2 35.0 130-134 28.558699999999998 33.0 28.2 34.6 10.8 35.0 135-139 27.01415 32.2 24.8 34.0 2.6 35.0 140-144 25.6424 31.6 21.8 34.0 2.0 35.0 145-149 21.815649999999998 28.6 4.6 33.8 2.0 34.8 150 14.253 2.0 2.0 30.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 4.0 9 4.0 10 5.0 11 6.0 12 7.0 13 8.0 14 4.0 15 5.0 16 13.0 17 9.0 18 22.0 19 10.0 20 13.0 21 16.0 22 24.0 23 37.0 24 32.0 25 29.0 26 53.0 27 81.0 28 83.0 29 97.0 30 127.0 31 202.0 32 216.0 33 307.0 34 455.0 35 709.0 36 1010.0 37 407.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.13409563409564 18.814968814968815 11.746361746361748 36.304573804573806 2 17.675 28.325 37.675 16.325 3 18.00450112528132 30.732683170792697 25.6064016004001 25.656414103525883 4 19.275000000000002 38.85 21.975 19.900000000000002 5 19.625 38.074999999999996 23.674999999999997 18.625 6 15.725 37.125 25.55 21.6 7 13.3 19.650000000000002 45.65 21.4 8 18.65 20.75 28.299999999999997 32.300000000000004 9 17.325 22.975 29.475 30.225 10-14 19.405 30.69 26.75 23.155 15-19 19.63 29.099999999999998 27.87 23.400000000000002 20-24 19.634999999999998 29.13 27.76 23.474999999999998 25-29 19.439999999999998 29.520000000000003 27.894999999999996 23.145 30-34 19.695984799239962 29.6064803240162 27.631381569078457 23.06615330766538 35-39 20.07 29.349999999999998 27.365000000000002 23.215 40-44 20.19 29.74 27.74 22.33 45-49 20.02 29.635 26.900000000000002 23.445 50-54 19.84 28.799999999999997 27.935 23.425 55-59 20.06 29.15 27.71 23.080000000000002 60-64 19.71 29.349999999999998 27.18 23.76 65-69 19.625 28.955 27.93 23.49 70-74 19.905 29.315 27.24 23.54 75-79 19.885 29.415000000000003 27.474999999999998 23.225 80-84 19.48 29.2 27.33 23.990000000000002 85-89 20.52 28.525 27.655 23.3 90-94 19.91599579978999 28.72643632181609 27.426371318565927 23.931196559827992 95-99 20.24 28.95 27.13 23.68 100-104 19.886988698869885 29.157915791579157 27.642764276427645 23.312331233123313 105-109 20.169999999999998 28.51 27.96 23.36 110-114 20.01 28.875 27.88 23.235 115-119 20.31 28.935 27.555000000000003 23.200000000000003 120-124 20.330000000000002 28.499999999999996 27.705000000000002 23.465 125-129 20.43 29.085 27.42 23.064999999999998 130-134 20.205000000000002 28.48 27.355 23.96 135-139 19.625 28.810000000000002 27.584999999999997 23.98 140-144 19.73 29.235 27.655 23.380000000000003 145-149 19.12 29.59 27.365000000000002 23.925 150 8.725 34.825 28.275 28.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 2.0 24 4.0 25 8.0 26 9.0 27 10.5 28 15.5 29 21.0 30 23.5 31 26.0 32 38.5 33 56.5 34 75.5 35 89.0 36 98.5 37 120.0 38 158.0 39 189.5 40 205.5 41 222.5 42 243.5 43 266.0 44 270.5 45 262.0 46 243.5 47 229.5 48 215.0 49 193.5 50 176.0 51 133.0 52 98.5 53 82.5 54 55.0 55 36.5 56 32.0 57 26.5 58 21.0 59 13.5 60 7.0 61 4.5 62 3.0 63 3.0 64 2.0 65 1.0 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.05 0.025 0.0 0.0 0.0 86-87 0.05 0.025 0.0 0.0 0.0 88-89 0.05 0.025 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.05 0.025 0.0 0.0 0.0 94-95 0.05 0.025 0.0 0.0 0.0 96-97 0.05 0.025 0.0 0.0 0.0 98-99 0.05 0.025 0.0 0.0 0.0 100-101 0.05 0.025 0.0 0.0 0.0 102-103 0.05 0.025 0.0 0.0 0.0 104-105 0.07500000000000001 0.025 0.0 0.0 0.0 106-107 0.175 0.025 0.0 0.0 0.0 108-109 0.25 0.025 0.0 0.0 0.0 110-111 0.35 0.025 0.0 0.0 0.0 112-113 0.375 0.025 0.0 0.0 0.0 114-115 0.4125 0.025 0.0 0.0 0.0 116-117 0.6125 0.025 0.0 0.0 0.0 118-119 0.6625000000000001 0.025 0.0 0.0 0.0 120-121 0.7124999999999999 0.025 0.0 0.0 0.0 122-123 0.8 0.025 0.0 0.0 0.0 124-125 0.85 0.025 0.0 0.0 0.0 126-127 0.875 0.025 0.0 0.0 0.0 128-129 0.875 0.025 0.0 0.0 0.0 130-131 0.9125 0.025 0.0 0.0 0.0 132-133 1.125 0.025 0.0 0.0 0.0 134-135 1.5375 0.025 0.0 0.0 0.0 136-137 1.6875 0.025 0.0 0.0 0.0 138 1.925 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGTT 10 0.0069808904 143.95 8 AATAAGT 10 0.0069808904 143.95 7 >>END_MODULE SRR3727110 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727110_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.21175 33.0 31.0 34.0 30.0 34.0 2 31.2885 33.0 31.0 34.0 29.0 34.0 3 31.50925 34.0 31.0 34.0 30.0 34.0 4 34.966 37.0 35.0 37.0 33.0 37.0 5 35.0245 37.0 35.0 37.0 33.0 37.0 6 34.90975 37.0 35.0 37.0 33.0 37.0 7 34.8905 37.0 35.0 37.0 33.0 37.0 8 34.98425 37.0 35.0 37.0 33.0 37.0 9 36.661 39.0 37.0 39.0 33.0 39.0 10-14 36.75425 39.2 37.2 39.4 33.0 39.4 15-19 37.7885 40.0 38.0 41.0 33.0 41.0 20-24 37.6622 40.0 38.0 41.0 32.8 41.0 25-29 37.68245 40.0 38.0 41.0 33.0 41.0 30-34 37.2236 40.0 37.8 41.0 31.8 41.0 35-39 37.0621 40.0 37.4 41.0 31.4 41.0 40-44 36.804100000000005 40.0 36.8 41.0 30.8 41.0 45-49 36.4307 39.4 36.4 40.8 30.0 41.0 50-54 35.86225 38.8 35.4 40.0 29.4 40.6 55-59 35.915350000000004 39.0 35.4 40.0 29.0 41.0 60-64 35.914300000000004 39.0 35.0 40.8 29.4 41.0 65-69 35.14875000000001 37.6 34.8 39.8 28.6 41.0 70-74 34.1927 36.4 34.0 38.8 28.0 40.4 75-79 33.1185 35.0 33.4 37.0 27.0 39.0 80-84 32.22965 35.0 33.0 35.8 25.8 37.2 85-89 31.4694 34.8 32.0 35.0 24.6 36.2 90-94 31.016700000000004 34.4 31.6 35.0 22.6 35.4 95-99 30.565450000000006 34.0 31.4 35.0 20.0 35.0 100-104 30.29305 34.0 31.0 35.0 18.8 35.0 105-109 29.93585 34.0 30.4 35.0 17.2 35.0 110-114 29.4313 34.0 29.6 35.0 11.4 35.0 115-119 29.1462 34.0 29.4 35.0 7.2 35.0 120-124 28.508100000000002 33.6 29.0 35.0 2.0 35.0 125-129 27.47785 33.2 26.2 34.8 2.0 35.0 130-134 25.60165 31.8 23.0 34.0 2.0 35.0 135-139 24.5397 31.0 17.8 34.0 2.0 35.0 140-144 23.438499999999998 30.2 7.2 34.0 2.0 35.0 145-149 21.424149999999997 29.2 2.0 34.0 2.0 35.0 150 17.90575 23.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 106.0 3 4.0 4 5.0 5 3.0 6 3.0 7 7.0 8 8.0 9 7.0 10 8.0 11 12.0 12 7.0 13 11.0 14 17.0 15 13.0 16 5.0 17 19.0 18 14.0 19 21.0 20 21.0 21 20.0 22 30.0 23 32.0 24 46.0 25 52.0 26 48.0 27 64.0 28 102.0 29 105.0 30 121.0 31 179.0 32 240.0 33 285.0 34 387.0 35 634.0 36 927.0 37 436.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.824999999999996 15.775 13.875000000000002 32.525 2 22.775000000000002 24.4 36.65 16.175 3 20.3 25.4 32.0 22.3 4 23.400000000000002 35.925000000000004 20.925 19.75 5 22.075 37.45 22.5 17.974999999999998 6 17.125 38.775 24.575 19.525000000000002 7 18.079519879969993 15.95398849712428 45.73643410852713 20.230057514378593 8 20.775 21.275 28.375 29.575000000000003 9 22.1 23.125 28.425 26.35 10-14 22.916145807290363 28.86144307215361 26.55132756637832 21.67108355417771 15-19 22.93 27.715 28.134999999999998 21.22 20-24 23.244999999999997 28.105000000000004 27.87 20.78 25-29 22.32 28.52 28.65 20.51 30-34 22.835 27.939999999999998 28.18 21.044999999999998 35-39 22.939999999999998 27.529999999999998 28.470000000000002 21.060000000000002 40-44 23.155 27.82 28.215 20.810000000000002 45-49 22.869999999999997 28.155 28.455000000000002 20.52 50-54 23.628544281642245 27.974196129419415 27.524128619292892 20.873130969645448 55-59 22.6390556222489 27.531012404961984 28.621448579431775 21.208483393357344 60-64 22.95114755737787 27.931396569828493 28.521426071303562 20.596029801490072 65-69 22.796139806990347 28.016400820041003 28.496424821241064 20.691034551727586 70-74 23.009601920384075 27.885577115423082 28.445689137827568 20.659131826365275 75-79 22.627919771920173 27.91977192017206 28.725053768819087 20.72725453908868 80-84 23.520880220055012 27.746936734183546 28.08702175543886 20.64516129032258 85-89 23.200000000000003 27.48 28.67 20.65 90-94 22.82369421652992 27.601560936561935 29.337602561536926 20.237142285371224 95-99 23.22125487841489 27.694386070249173 28.289802862003405 20.794556189332532 100-104 23.810000000000002 27.694999999999997 28.34 20.155 105-109 22.72340851127669 27.33410011501725 29.079361904285644 20.863129469420414 110-114 23.34167083541771 27.988994497248626 28.274137068534266 20.3951975987994 115-119 23.551177558877946 27.78138906945347 27.91139556977849 20.756037801890095 120-124 24.015 27.55 28.349999999999998 20.085 125-129 23.665 27.235 28.455000000000002 20.645 130-134 23.96479295859172 28.060612122424484 27.895579115823168 20.079015803160633 135-139 24.144144144144146 28.113113113113116 27.36736736736737 20.375375375375377 140-144 24.401961765589032 28.33550195175658 27.2695425883295 19.99299369432489 145-149 24.62962962962963 27.85785785785786 27.117117117117118 20.395395395395397 150 24.233283056812468 28.00402212166918 25.84213172448467 21.920563097033686 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.5 5 1.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 2.5 13 2.5 14 0.5 15 0.5 16 0.5 17 1.0 18 3.0 19 2.5 20 1.5 21 1.5 22 1.5 23 2.0 24 2.5 25 3.0 26 4.5 27 7.5 28 11.0 29 16.0 30 20.0 31 24.5 32 35.5 33 42.5 34 45.0 35 61.5 36 82.0 37 108.0 38 134.0 39 172.0 40 201.0 41 208.5 42 241.0 43 280.5 44 293.0 45 282.0 46 258.0 47 234.5 48 217.5 49 197.5 50 168.5 51 136.0 52 109.5 53 83.0 54 65.0 55 52.0 56 41.0 57 32.0 58 24.0 59 18.0 60 14.5 61 11.0 62 10.0 63 10.0 64 6.5 65 4.0 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.04 60-64 0.005 65-69 0.005 70-74 0.02 75-79 0.034999999999999996 80-84 0.025 85-89 0.0 90-94 0.06 95-99 0.06999999999999999 100-104 0.0 105-109 0.015 110-114 0.05 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.1 140-144 0.09 145-149 0.1 150 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 1.9375 0.0 0.0 0.0 0.0 138 2.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGACGG 10 0.0069754543 143.9875 9 >>END_MODULE Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401203 spots for SRR3727110.sra Written 1401203 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra Read 1401188 spots for SRR3727110.sra Written 1401188 spots for SRR3727110.sra SRR ids: ['SRR3727110.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qz70r6fd SRR3727110.sra spots: 28023775 blocks: [[1, 1401188], [1401189, 2802376], [2802377, 4203564], [4203565, 5604752], [5604753, 7005940], [7005941, 8407128], [8407129, 9808316], [9808317, 11209504], [11209505, 12610692], [12610693, 14011880], [14011881, 15413068], [15413069, 16814256], [16814257, 18215444], [18215445, 19616632], [19616633, 21017820], [21017821, 22419008], [22419009, 23820196], [23820197, 25221384], [25221385, 26622572], [26622573, 28023775]] SRR3727110 file size 9419903 SRR3727110 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727110 SRR3727110_1.fastq SRR3727110_2.fastq Input file: SRR3727110_1.fastq Paired file: SRR3727110_2.fastq trimmed: SRR3727110-trimmed-pair1.fastq, SRR3727110-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:35:19 2025 >> started Fri Feb 14 09:35:54 2025 >> done (35.607s) 28023775 read pairs processed; of these: 154195 ( 0.55%) short read pairs filtered out after trimming by size control 627174 ( 2.24%) empty read pairs filtered out after trimming by size control 27242406 (97.21%) read pairs available; of these: 14757103 (54.17%) trimmed read pairs available after processing 12485303 (45.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 4 0.00% 21 25 0.00% 22 38 0.00% 23 53 0.00% 24 62 0.00% 25 93 0.00% 26 116 0.00% 27 144 0.00% 28 195 0.00% 29 206 0.00% 30 282 0.00% 31 328 0.00% 32 396 0.00% 33 454 0.00% 34 446 0.00% 35 563 0.00% 36 693 0.00% 37 716 0.00% 38 830 0.00% 39 970 0.00% 40 1026 0.00% 41 1109 0.00% 42 1196 0.00% 43 1342 0.00% 44 1555 0.01% 45 1637 0.01% 46 1811 0.01% 47 1973 0.01% 48 2135 0.01% 49 2218 0.01% 50 2342 0.01% 51 2638 0.01% 52 2735 0.01% 53 2880 0.01% 54 3103 0.01% 55 3245 0.01% 56 3537 0.01% 57 3729 0.01% 58 3795 0.01% 59 3999 0.01% 60 4311 0.02% 61 4455 0.02% 62 4694 0.02% 63 4932 0.02% 64 5325 0.02% 65 5522 0.02% 66 5927 0.02% 67 6116 0.02% 68 6617 0.02% 69 6857 0.03% 70 7304 0.03% 71 7939 0.03% 72 8269 0.03% 73 8773 0.03% 74 9144 0.03% 75 9875 0.04% 76 10743 0.04% 77 11045 0.04% 78 11632 0.04% 79 12437 0.05% 80 13096 0.05% 81 14178 0.05% 82 15249 0.06% 83 16826 0.06% 84 23776 0.09% 85 24102 0.09% 86 25149 0.09% 87 27507 0.10% 88 27617 0.10% 89 28567 0.10% 90 29601 0.11% 91 32064 0.12% 92 32297 0.12% 93 32586 0.12% 94 33741 0.12% 95 34577 0.13% 96 36466 0.13% 97 38392 0.14% 98 38957 0.14% 99 38450 0.14% 100 37996 0.14% 101 43503 0.16% 102 43520 0.16% 103 42166 0.15% 104 46864 0.17% 105 59617 0.22% 106 46490 0.17% 107 50633 0.19% 108 51166 0.19% 109 58192 0.21% 110 51983 0.19% 111 68779 0.25% 112 63481 0.23% 113 52776 0.19% 114 54706 0.20% 115 91865 0.34% 116 67753 0.25% 117 59857 0.22% 118 59924 0.22% 119 61873 0.23% 120 76583 0.28% 121 88500 0.32% 122 70811 0.26% 123 69703 0.26% 124 71309 0.26% 125 84004 0.31% 126 84126 0.31% 127 83654 0.31% 128 90361 0.33% 129 134806 0.49% 130 126340 0.46% 131 116594 0.43% 132 149668 0.55% 133 178273 0.65% 134 177450 0.65% 135 154362 0.57% 136 189577 0.70% 137 203081 0.75% 138 264778 0.97% 139 294694 1.08% 140 315370 1.16% 141 349223 1.28% 142 389244 1.43% 143 444333 1.63% 144 533114 1.96% 145 642260 2.36% 146 804540 2.95% 147 1093213 4.01% 148 1589998 5.84% 149 4004248 14.70% 150 12485303 45.83% 27242406 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.6 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=78.95 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.2 sequence=CATCCTCATCACCTCCTTCAGCTGAAGGATTTGCACCAATGTCTACATCAACGGCTCCTTGAACAACCCACTTTCCTTCAACTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=6.14 fanout-score-rank=23 prefix-density=0.19 prefix-fanout=3.7 sequence=TGTGGCTCTGGCTGCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=427.85 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=35.1 sequence=AAGAAGAAGAAA SRR3727110 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:36:43 Started mapping on | Feb 14 09:36:49 Finished on | Feb 14 09:39:25 Mapping speed, Million of reads per hour | 628.67 Number of input reads | 27242406 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 26143847 Uniquely mapped reads % | 95.97% Average mapped length | 287.08 Number of splices: Total | 22924783 Number of splices: Annotated (sjdb) | 22448770 Number of splices: GT/AG | 22522817 Number of splices: GC/AG | 335817 Number of splices: AT/AC | 20239 Number of splices: Non-canonical | 45910 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 676566 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 98331 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.08% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455745 455745 455745 N_multimapping 676566 676566 676566 N_noFeature 962397 25789359 1137485 N_ambiguous 328700 1671 148355 UnstrandedReadsAssigned:24852750 PositiveStrandReadsAssigned:352817 NegativeStrandReadsAssigned:24858007 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR3727110 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727110-trimmed-pair1.fastq SRR3727110-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,242,406 reads, 25,157,978 reads pseudoaligned [quant] estimated average fragment length: 244.117 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR3727110.ke.tsv 34699 SRR3727110.se.tsv 87100 total ==> SRR3727110.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.88 1100 21.5223 Potri.005G024800.1.v4.1 1035 791.883 664 29.1187 Potri.004G059700.1.v4.1 961 717.916 122 5.90135 Potri.007G009000.2.v4.1 1416 1172.88 1 0.0296081 Potri.003G141000.2.v4.1 2943 2699.88 1223.64 15.7388 Potri.016G087400.1.v4.1 270 74.1995 2237 1046.96 Potri.015G069301.1.v4.1 564 324.856 0 0 Potri.010G195200.1.v4.1 1773 1529.88 283 6.42382 Potri.012G127500.1.v4.1 977 733.892 6639 314.149 ==> SRR3727110.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 426 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 580 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 244 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 17 SRR3727110 completed mapping pipeline successfully