Starting /dee2/code/volunteer_pipeline.sh SRR3727111 current disk space = 3116723965952 free memory = 1578051768 SRR3727111 SRAfilesize 4c020929284607334e3ae81f8c0bcb1f SRR3727111.sra SRR3727111.sra file validated SRR3727111 is paired end SRR3727111 is conventional basespace SRR3727111 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92375 33.0 31.0 34.0 28.0 34.0 2 31.90375 34.0 31.0 34.0 30.0 34.0 3 29.2325 31.0 28.0 34.0 16.0 34.0 4 34.7825 37.0 35.0 37.0 32.0 37.0 5 35.586 37.0 35.0 37.0 33.0 37.0 6 35.88275 37.0 35.0 37.0 35.0 37.0 7 36.03275 37.0 35.0 37.0 35.0 37.0 8 36.1375 37.0 35.0 37.0 35.0 37.0 9 37.80925 39.0 38.0 39.0 35.0 39.0 10-14 38.0317 39.2 37.8 39.4 35.2 39.4 15-19 39.05 40.0 38.2 41.0 35.8 41.0 20-24 38.959999999999994 40.0 38.6 41.0 35.0 41.0 25-29 38.6744 40.0 38.0 41.0 34.8 41.0 30-34 38.309099999999994 40.0 38.0 41.0 33.8 41.0 35-39 38.00805 40.0 37.8 41.0 33.2 41.0 40-44 38.07235 40.0 37.8 41.0 33.2 41.0 45-49 37.9816 40.0 37.4 41.0 33.4 41.0 50-54 37.998149999999995 40.0 37.6 41.0 33.2 41.0 55-59 37.413599999999995 39.4 36.4 41.0 32.0 41.0 60-64 37.02395 39.0 35.6 40.4 31.2 41.0 65-69 36.0272 37.6 34.8 39.8 30.2 41.0 70-74 35.25535 36.4 34.0 39.0 29.8 40.4 75-79 34.04075 35.2 33.4 37.2 28.8 39.0 80-84 33.616150000000005 35.0 33.8 36.2 29.0 37.4 85-89 32.9351 35.0 33.0 35.2 29.0 36.2 90-94 32.441 34.6 32.8 35.0 28.0 35.4 95-99 31.739099999999997 34.0 31.8 35.0 25.6 35.0 100-104 31.57125 34.0 31.6 35.0 25.0 35.0 105-109 31.4709 34.0 31.8 35.0 24.8 35.0 110-114 30.726049999999997 34.0 31.0 35.0 22.8 35.0 115-119 30.03535 33.8 29.8 35.0 19.6 35.0 120-124 29.48755 33.8 29.0 35.0 17.8 35.0 125-129 28.996500000000005 33.6 28.2 34.8 14.8 35.0 130-134 28.10335 32.8 26.2 34.6 5.6 35.0 135-139 26.57665 32.0 24.4 34.0 2.0 35.0 140-144 24.95225 31.4 18.2 34.0 2.0 35.0 145-149 21.235049999999994 28.2 3.0 33.8 2.0 34.8 150 13.829 2.0 2.0 29.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 2.0 8 2.0 9 5.0 10 4.0 11 7.0 12 6.0 13 2.0 14 6.0 15 10.0 16 12.0 17 12.0 18 16.0 19 13.0 20 18.0 21 17.0 22 28.0 23 26.0 24 48.0 25 47.0 26 55.0 27 74.0 28 92.0 29 102.0 30 134.0 31 178.0 32 247.0 33 343.0 34 465.0 35 756.0 36 938.0 37 329.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.36129032258065 18.503225806451614 10.580645161290322 34.55483870967742 2 18.15 26.75 37.85 17.25 3 16.566566566566568 30.605605605605607 27.677677677677675 25.150150150150154 4 19.175 36.875 22.625 21.325 5 21.175 37.175000000000004 23.125 18.525 6 16.35 35.9 24.325 23.425 7 12.425 20.275000000000002 45.425 21.875 8 18.45 20.325 28.349999999999998 32.875 9 17.275 21.224999999999998 30.75 30.75 10-14 19.705000000000002 29.69 26.05 24.555 15-19 20.294999999999998 28.345 27.595 23.765 20-24 19.96 28.744999999999997 27.089999999999996 24.205 25-29 19.915 29.07 27.950000000000003 23.064999999999998 30-34 20.265 28.77 27.38 23.585 35-39 20.27 28.48 27.785 23.465 40-44 20.82 28.08 27.860000000000003 23.24 45-49 19.735 28.77 27.83 23.665 50-54 20.24 28.555000000000003 27.794999999999998 23.41 55-59 20.145 29.035 27.765 23.055 60-64 20.06 28.215 27.985 23.74 65-69 20.474999999999998 28.955 27.339999999999996 23.23 70-74 20.695 27.97 27.625 23.71 75-79 20.48 28.285 28.084999999999997 23.150000000000002 80-84 20.24 28.38 27.845 23.535 85-89 20.474999999999998 28.585 28.005000000000003 22.935 90-94 20.505000000000003 27.939999999999998 27.250000000000004 24.305 95-99 20.53 28.57 27.055 23.845 100-104 20.815 28.23 27.779999999999998 23.175 105-109 20.525 28.585 27.705000000000002 23.185 110-114 20.52 28.12 27.955000000000002 23.405 115-119 20.76 28.4 27.615000000000002 23.225 120-124 20.655 27.925 27.785 23.635 125-129 20.34 28.93 26.974999999999998 23.755000000000003 130-134 20.205000000000002 28.78 27.6 23.415 135-139 19.830000000000002 27.985 27.96 24.224999999999998 140-144 20.535 28.055000000000003 28.095 23.315 145-149 18.84 28.754999999999995 27.860000000000003 24.545 150 9.35 34.175 29.275000000000002 27.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 3.0 24 3.5 25 4.5 26 4.0 27 4.0 28 7.5 29 11.5 30 17.5 31 28.0 32 37.5 33 40.0 34 53.0 35 75.0 36 97.0 37 117.5 38 142.0 39 161.0 40 200.5 41 239.0 42 251.0 43 256.0 44 261.5 45 268.5 46 269.0 47 261.5 48 221.0 49 192.0 50 161.0 51 125.0 52 118.0 53 95.0 54 65.0 55 49.0 56 37.5 57 33.5 58 24.5 59 15.5 60 14.0 61 11.0 62 6.0 63 2.5 64 2.5 65 3.0 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.874749498998 99.675 2 0.1002004008016032 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0250501002004008 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.025 0.0 0.0 0.0 96-97 0.075 0.025 0.0 0.0 0.0 98-99 0.075 0.025 0.0 0.0 0.0 100-101 0.075 0.025 0.0 0.0 0.0 102-103 0.1125 0.025 0.0 0.0 0.0 104-105 0.175 0.025 0.0 0.0 0.0 106-107 0.225 0.025 0.0 0.0 0.0 108-109 0.2625 0.025 0.0 0.0 0.0 110-111 0.38749999999999996 0.025 0.0 0.0 0.0 112-113 0.525 0.025 0.0 0.0 0.0 114-115 0.5874999999999999 0.025 0.0 0.0 0.0 116-117 0.675 0.025 0.0 0.0 0.0 118-119 0.7124999999999999 0.025 0.0 0.0 0.0 120-121 0.725 0.025 0.0 0.0 0.0 122-123 0.7625 0.025 0.0 0.0 0.0 124-125 0.775 0.025 0.0 0.0 0.0 126-127 0.8 0.025 0.0 0.0 0.0 128-129 0.8125 0.025 0.0 0.0 0.0 130-131 0.8875 0.025 0.0 0.0 0.0 132-133 0.95 0.025 0.0 0.0 0.0 134-135 1.1 0.025 0.0 0.0 0.0 136-137 1.2625 0.025 0.0 0.0 0.0 138 1.4 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTTCC 10 0.0069790767 143.96251 3 >>END_MODULE SRR3727111 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1465 33.0 31.0 34.0 30.0 34.0 2 31.21 33.0 31.0 34.0 28.0 34.0 3 31.406 34.0 31.0 34.0 30.0 34.0 4 34.76675 37.0 35.0 37.0 32.0 37.0 5 34.8055 37.0 35.0 37.0 32.0 37.0 6 34.8165 37.0 35.0 37.0 32.0 37.0 7 34.76275 37.0 35.0 37.0 32.0 37.0 8 34.89275 37.0 35.0 37.0 33.0 37.0 9 36.5355 39.0 37.0 39.0 33.0 39.0 10-14 36.60405 39.2 37.2 39.4 32.4 39.4 15-19 37.54335 40.0 38.0 41.0 32.4 41.0 20-24 37.329 40.0 37.8 41.0 32.0 41.0 25-29 37.40585 40.0 38.0 41.0 32.0 41.0 30-34 36.87015 40.0 37.2 41.0 30.6 41.0 35-39 36.7515 40.0 37.0 41.0 30.8 41.0 40-44 36.47095 39.8 36.8 41.0 30.0 41.0 45-49 36.16485 39.0 36.0 40.4 29.6 41.0 50-54 35.5594 38.4 35.2 40.0 28.6 40.6 55-59 35.566500000000005 38.6 35.0 40.0 28.0 41.0 60-64 35.64645 38.8 35.0 40.4 28.2 41.0 65-69 34.938900000000004 37.4 34.6 39.6 28.2 41.0 70-74 34.0019 36.2 34.0 38.8 27.6 40.2 75-79 32.83705 35.0 33.4 36.8 26.2 38.8 80-84 32.00359999999999 35.0 32.6 35.6 25.6 37.0 85-89 31.2048 34.8 32.0 35.0 23.0 36.0 90-94 30.575850000000003 34.0 31.0 35.0 20.0 35.2 95-99 30.224650000000004 34.0 30.8 35.0 18.6 35.0 100-104 29.87095 34.0 30.0 35.0 17.2 35.0 105-109 29.58835 34.0 29.6 35.0 12.0 35.0 110-114 29.190649999999998 34.0 29.0 35.0 7.8 35.0 115-119 28.831650000000003 33.8 29.0 35.0 5.0 35.0 120-124 28.139099999999996 33.0 27.8 35.0 2.0 35.0 125-129 27.221749999999997 32.6 25.6 34.6 2.0 35.0 130-134 25.20035 31.0 20.0 34.0 2.0 35.0 135-139 24.02205 30.4 15.6 34.0 2.0 35.0 140-144 22.98235 30.0 4.6 34.0 2.0 35.0 145-149 20.60345 28.6 2.0 34.0 2.0 35.0 150 16.94 19.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 110.0 3 8.0 4 7.0 5 10.0 6 6.0 7 7.0 8 10.0 9 7.0 10 4.0 11 7.0 12 11.0 13 11.0 14 13.0 15 19.0 16 11.0 17 15.0 18 18.0 19 19.0 20 20.0 21 21.0 22 31.0 23 30.0 24 46.0 25 45.0 26 47.0 27 78.0 28 101.0 29 101.0 30 159.0 31 217.0 32 262.0 33 277.0 34 433.0 35 606.0 36 857.0 37 375.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.725 16.1 9.975000000000001 32.2 2 21.45 23.125 37.925 17.5 3 20.349999999999998 24.65 32.0 23.0 4 23.974999999999998 36.1 18.975 20.95 5 22.725 39.125 20.724999999999998 17.424999999999997 6 17.05 38.3 23.724999999999998 20.925 7 16.725 15.35 46.675 21.25 8 19.525000000000002 20.549999999999997 28.000000000000004 31.924999999999997 9 21.9 23.65 27.675 26.775 10-14 22.59 29.654999999999998 26.27 21.485000000000003 15-19 23.07 28.12 27.800000000000004 21.01 20-24 21.935 28.59 27.83 21.645 25-29 22.495 28.845 27.66 21.0 30-34 22.835 28.34 27.644999999999996 21.18 35-39 22.515 28.225 28.165000000000003 21.095 40-44 22.84 28.09 28.08 20.990000000000002 45-49 22.009999999999998 28.105000000000004 28.050000000000004 21.834999999999997 50-54 23.36 27.91 27.525 21.205 55-59 23.081154057702886 27.901395069753487 27.92639631981599 21.091054552727638 60-64 22.73 28.335 27.705000000000002 21.23 65-69 23.06 27.905 27.525 21.51 70-74 22.906145307265362 27.881394069703486 27.78638931946597 21.426071303565177 75-79 22.665 27.735 28.470000000000002 21.13 80-84 23.181159057952897 28.191409570478527 27.716385819290963 20.911045552277614 85-89 23.25 28.18 27.555000000000003 21.015 90-94 22.932293229322934 27.582758275827583 28.532853285328535 20.95209520952095 95-99 22.61339200880132 27.62414362154323 28.484272640896137 21.278191728759314 100-104 23.29 28.43 27.41 20.87 105-109 22.89114455722786 27.78138906945347 28.0314015700785 21.29606480324016 110-114 23.643546531979798 27.524128619292892 27.759163874581187 21.07316097414612 115-119 23.055 27.894999999999996 27.865000000000002 21.185000000000002 120-124 23.255 27.810000000000002 27.939999999999998 20.995 125-129 23.705000000000002 27.85 27.529999999999998 20.915 130-134 23.94239423942394 27.772777277727773 27.377737773777376 20.907090709070907 135-139 24.055825121304586 27.73748186684008 27.272272522635188 20.934420489220148 140-144 23.60708212463739 28.21346403921176 27.348204461338398 20.831249374812444 145-149 24.092046023011505 27.963981990995496 27.228614307153578 20.715357678839418 150 24.50513655725382 27.060886995740418 26.960661488348787 21.473314958656978 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.0 18 2.0 19 1.0 20 1.5 21 2.0 22 3.0 23 3.5 24 2.0 25 2.5 26 4.5 27 6.5 28 9.0 29 11.0 30 14.0 31 21.5 32 30.5 33 38.0 34 45.0 35 67.0 36 86.5 37 92.0 38 125.5 39 158.0 40 184.0 41 235.5 42 246.0 43 261.5 44 284.5 45 283.5 46 284.0 47 256.5 48 218.5 49 189.5 50 158.0 51 127.0 52 111.5 53 102.0 54 85.0 55 65.5 56 50.5 57 34.0 58 24.0 59 19.0 60 13.5 61 8.0 62 5.0 63 5.5 64 4.5 65 4.0 66 3.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.01 95-99 0.015 100-104 0.0 105-109 0.005 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.045 140-144 0.03 145-149 0.05 150 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.38749999999999996 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1224071 spots for SRR3727111.sra Written 1224071 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra Read 1224053 spots for SRR3727111.sra Written 1224053 spots for SRR3727111.sra SRR ids: ['SRR3727111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_noe7_289 SRR3727111.sra spots: 24481078 blocks: [[1, 1224053], [1224054, 2448106], [2448107, 3672159], [3672160, 4896212], [4896213, 6120265], [6120266, 7344318], [7344319, 8568371], [8568372, 9792424], [9792425, 11016477], [11016478, 12240530], [12240531, 13464583], [13464584, 14688636], [14688637, 15912689], [15912690, 17136742], [17136743, 18360795], [18360796, 19584848], [19584849, 20808901], [20808902, 22032954], [22032955, 23257007], [23257008, 24481078]] SRR3727111 file size 8226319 SRR3727111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727111 SRR3727111_1.fastq SRR3727111_2.fastq Input file: SRR3727111_1.fastq Paired file: SRR3727111_2.fastq trimmed: SRR3727111-trimmed-pair1.fastq, SRR3727111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:35:19 2025 >> started Fri Feb 14 09:35:51 2025 >> done (32.878s) 24481078 read pairs processed; of these: 147776 ( 0.60%) short read pairs filtered out after trimming by size control 594617 ( 2.43%) empty read pairs filtered out after trimming by size control 23738685 (96.97%) read pairs available; of these: 12995900 (54.75%) trimmed read pairs available after processing 10742785 (45.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 6 0.00% 21 20 0.00% 22 45 0.00% 23 56 0.00% 24 59 0.00% 25 94 0.00% 26 104 0.00% 27 122 0.00% 28 154 0.00% 29 192 0.00% 30 235 0.00% 31 263 0.00% 32 294 0.00% 33 376 0.00% 34 457 0.00% 35 507 0.00% 36 560 0.00% 37 642 0.00% 38 710 0.00% 39 860 0.00% 40 928 0.00% 41 1018 0.00% 42 1142 0.00% 43 1291 0.01% 44 1379 0.01% 45 1536 0.01% 46 1707 0.01% 47 1755 0.01% 48 1934 0.01% 49 1990 0.01% 50 2272 0.01% 51 2389 0.01% 52 2588 0.01% 53 2723 0.01% 54 2835 0.01% 55 3110 0.01% 56 3216 0.01% 57 3424 0.01% 58 3588 0.02% 59 3737 0.02% 60 4035 0.02% 61 4178 0.02% 62 4463 0.02% 63 4688 0.02% 64 4982 0.02% 65 5247 0.02% 66 5466 0.02% 67 5833 0.02% 68 6076 0.03% 69 6590 0.03% 70 6787 0.03% 71 7207 0.03% 72 7567 0.03% 73 8031 0.03% 74 8490 0.04% 75 9058 0.04% 76 9751 0.04% 77 10080 0.04% 78 10875 0.05% 79 11617 0.05% 80 12349 0.05% 81 12985 0.05% 82 14197 0.06% 83 15671 0.07% 84 21945 0.09% 85 22564 0.10% 86 23085 0.10% 87 24976 0.11% 88 25505 0.11% 89 26232 0.11% 90 27170 0.11% 91 29616 0.12% 92 29314 0.12% 93 29954 0.13% 94 31500 0.13% 95 32563 0.14% 96 33221 0.14% 97 34765 0.15% 98 35577 0.15% 99 35533 0.15% 100 35120 0.15% 101 40554 0.17% 102 39616 0.17% 103 39069 0.16% 104 41882 0.18% 105 46975 0.20% 106 42066 0.18% 107 45808 0.19% 108 46489 0.20% 109 52823 0.22% 110 49508 0.21% 111 57891 0.24% 112 61107 0.26% 113 54075 0.23% 114 51051 0.22% 115 72060 0.30% 116 57554 0.24% 117 54381 0.23% 118 55735 0.23% 119 57007 0.24% 120 64022 0.27% 121 72033 0.30% 122 64086 0.27% 123 63440 0.27% 124 65390 0.28% 125 74451 0.31% 126 77240 0.33% 127 76981 0.32% 128 81840 0.34% 129 107319 0.45% 130 106201 0.45% 131 102711 0.43% 132 131300 0.55% 133 150577 0.63% 134 149374 0.63% 135 142562 0.60% 136 166727 0.70% 137 183036 0.77% 138 223884 0.94% 139 251145 1.06% 140 269962 1.14% 141 300400 1.27% 142 340193 1.43% 143 390624 1.65% 144 466499 1.97% 145 565302 2.38% 146 710062 2.99% 147 970403 4.09% 148 1413999 5.96% 149 3503297 14.76% 150 10742785 45.25% 23738685 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=39 prefix-density=0.15 prefix-fanout=1.9 sequence=TCACTCCTGTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=458.19 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=37.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=2.1 sequence=ACCTACATAAACTCTTACGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=67.61 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=8.3 sequence=GCAGCAGCAGCAA SRR3727111 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:36:40 Started mapping on | Feb 14 09:36:41 Finished on | Feb 14 09:39:18 Mapping speed, Million of reads per hour | 544.33 Number of input reads | 23738685 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 22607468 Uniquely mapped reads % | 95.23% Average mapped length | 286.66 Number of splices: Total | 21767122 Number of splices: Annotated (sjdb) | 21377961 Number of splices: GT/AG | 21367579 Number of splices: GC/AG | 344545 Number of splices: AT/AC | 16844 Number of splices: Non-canonical | 38154 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700576 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 30420 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.63% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468893 468893 468893 N_multimapping 700576 700576 700576 N_noFeature 752361 22334766 919015 N_ambiguous 214802 1351 107799 UnstrandedReadsAssigned:21640305 PositiveStrandReadsAssigned:271351 NegativeStrandReadsAssigned:21580654 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR3727111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727111-trimmed-pair1.fastq SRR3727111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,738,685 reads, 21,893,369 reads pseudoaligned [quant] estimated average fragment length: 254.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR3727111.ke.tsv 34699 SRR3727111.se.tsv 87100 total ==> SRR3727111.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.41 537 13.8448 Potri.005G024800.1.v4.1 1035 781.405 65 3.78398 Potri.004G059700.1.v4.1 961 707.468 45 2.89346 Potri.007G009000.2.v4.1 1416 1162.41 3 0.117402 Potri.003G141000.2.v4.1 2943 2689.41 650 10.9943 Potri.016G087400.1.v4.1 270 71.0585 1419 908.402 Potri.015G069301.1.v4.1 564 316.248 0 0 Potri.010G195200.1.v4.1 1773 1519.41 22 0.658659 Potri.012G127500.1.v4.1 977 723.437 3771 237.12 ==> SRR3727111.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 111 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 300 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 729 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR3727111 completed mapping pipeline successfully