Starting /dee2/code/volunteer_pipeline.sh SRR3727115 current disk space = 3117345140736 free memory = 1581130688 SRR3727115 SRAfilesize 4e475ec950ad54fb08d228f5c162f2e5 SRR3727115.sra SRR3727115.sra file validated SRR3727115 is paired end SRR3727115 is conventional basespace SRR3727115 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.53 34.0 31.0 34.0 31.0 34.0 2 32.92575 34.0 33.0 34.0 31.0 34.0 3 33.16575 34.0 34.0 34.0 31.0 34.0 4 36.543 37.0 37.0 37.0 35.0 37.0 5 36.57625 37.0 37.0 37.0 35.0 37.0 6 36.50325 37.0 37.0 37.0 35.0 37.0 7 36.44225 37.0 37.0 37.0 35.0 37.0 8 36.52475 37.0 37.0 37.0 35.0 37.0 9 38.25175 39.0 39.0 39.0 37.0 39.0 10-14 38.59275 39.4 39.0 39.4 37.2 39.4 15-19 39.67505 41.0 40.0 41.0 37.2 41.0 20-24 39.76520000000001 41.0 40.0 41.0 38.0 41.0 25-29 39.6155 41.0 39.6 41.0 37.4 41.0 30-34 39.36465 40.0 39.0 41.0 36.6 41.0 35-39 39.14375 40.0 38.2 41.0 36.0 41.0 40-44 39.03335 40.0 38.2 41.0 35.8 41.0 45-49 39.200849999999996 40.0 39.0 41.0 36.0 41.0 50-54 39.00875 40.0 38.6 41.0 35.0 41.0 55-59 38.75105 40.0 38.0 41.0 34.8 41.0 60-64 38.040150000000004 39.6 37.0 41.0 33.8 41.0 65-69 37.26655 38.6 35.6 40.4 33.2 41.0 70-74 36.27435 36.8 35.0 39.0 32.2 40.8 75-79 34.9873 35.2 34.0 37.4 31.2 39.2 80-84 34.514149999999994 35.0 34.0 36.4 31.2 37.6 85-89 33.838350000000005 35.0 34.0 35.4 30.8 36.4 90-94 33.39615 35.0 34.0 35.0 30.2 35.8 95-99 33.07835 35.0 33.6 35.0 30.0 35.0 100-104 33.09115 35.0 33.8 35.0 29.8 35.0 105-109 32.95895 35.0 33.4 35.0 29.4 35.0 110-114 32.6322 35.0 33.0 35.0 28.6 35.0 115-119 32.25795 34.6 32.6 35.0 27.4 35.0 120-124 32.0163 34.0 32.0 35.0 27.0 35.0 125-129 31.55005 34.0 31.4 35.0 25.0 35.0 130-134 30.947750000000003 34.0 31.0 35.0 24.0 35.0 135-139 29.5452 34.0 29.4 35.0 15.4 35.0 140-144 27.70245 33.0 26.2 34.8 3.6 35.0 145-149 25.14025 31.6 15.6 34.0 2.0 35.0 150 18.30325 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 4.0 13 1.0 14 4.0 15 3.0 16 6.0 17 8.0 18 4.0 19 7.0 20 3.0 21 8.0 22 11.0 23 13.0 24 16.0 25 16.0 26 24.0 27 37.0 28 57.0 29 63.0 30 76.0 31 91.0 32 171.0 33 245.0 34 381.0 35 666.0 36 1266.0 37 811.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.711808212190764 18.54118847232849 10.63504208110176 41.11196123437899 2 17.549999999999997 26.75 40.775 14.924999999999999 3 16.225 29.825000000000003 27.6 26.35 4 19.175 38.05 20.674999999999997 22.1 5 19.2 38.675 21.95 20.175 6 15.375 36.199999999999996 24.7 23.724999999999998 7 11.825 19.55 46.150000000000006 22.475 8 20.200000000000003 19.475 27.725 32.6 9 17.525 21.375 30.349999999999998 30.75 10-14 18.795 29.74 26.545 24.92 15-19 19.794999999999998 27.975 27.41 24.82 20-24 19.57 28.660000000000004 27.634999999999998 24.135 25-29 19.185 28.410000000000004 28.599999999999998 23.805 30-34 19.395969798489922 29.41647082354118 27.26136306815341 23.926196309815488 35-39 20.055 28.87 27.24 23.835 40-44 19.869999999999997 28.655 27.894999999999996 23.580000000000002 45-49 20.44 27.965 27.425 24.169999999999998 50-54 20.43 28.005000000000003 27.505000000000003 24.060000000000002 55-59 20.09 28.785 27.205000000000002 23.919999999999998 60-64 20.465 29.125 27.034999999999997 23.375 65-69 19.97 28.444999999999997 27.57 24.015 70-74 20.200000000000003 28.544999999999998 27.355 23.9 75-79 19.994999999999997 28.82 27.52 23.665 80-84 20.560000000000002 28.499999999999996 27.575 23.365 85-89 20.36 28.535 27.74 23.365 90-94 20.482048204820483 27.817781778177817 27.797779777977798 23.9023902390239 95-99 20.657065706570656 27.847784778477845 27.752775277527753 23.742374237423743 100-104 20.45 28.065 27.400000000000002 24.085 105-109 20.79 27.884999999999998 27.639999999999997 23.685000000000002 110-114 20.7 28.360000000000003 27.325 23.615 115-119 20.766038301915096 28.901445072253612 27.386369318465924 22.94614730736537 120-124 20.825 28.375 27.715 23.085 125-129 20.875 27.83 27.689999999999998 23.605 130-134 20.681034051702586 28.206410320516024 27.2063603180159 23.906195309765486 135-139 20.7 28.115000000000002 27.77 23.415 140-144 19.915 28.7 27.284999999999997 24.099999999999998 145-149 20.51 28.810000000000002 26.85 23.830000000000002 150 9.6 34.949999999999996 29.375 26.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 6.0 27 8.0 28 10.0 29 13.5 30 19.0 31 21.0 32 39.5 33 60.5 34 65.0 35 74.0 36 91.5 37 111.5 38 123.5 39 149.0 40 184.0 41 216.5 42 236.0 43 257.0 44 258.5 45 267.0 46 291.5 47 256.5 48 230.0 49 215.5 50 169.5 51 142.0 52 133.0 53 101.5 54 66.0 55 44.0 56 30.5 57 29.0 58 23.5 59 13.0 60 8.5 61 8.0 62 7.0 63 5.0 64 2.5 65 2.0 66 2.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.15000000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3727115 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.127 34.0 31.0 34.0 31.0 34.0 2 32.10725 34.0 31.0 34.0 31.0 34.0 3 32.10675 34.0 31.0 34.0 31.0 34.0 4 35.6185 37.0 37.0 37.0 35.0 37.0 5 35.63 37.0 37.0 37.0 35.0 37.0 6 35.476 37.0 37.0 37.0 35.0 37.0 7 35.612 37.0 37.0 37.0 35.0 37.0 8 35.6315 37.0 37.0 37.0 35.0 37.0 9 37.3785 39.0 38.0 39.0 35.0 39.0 10-14 37.54145 39.4 38.4 39.4 34.8 39.4 15-19 38.567150000000005 41.0 38.8 41.0 35.6 41.0 20-24 38.524350000000005 40.8 39.0 41.0 35.6 41.0 25-29 38.321999999999996 40.2 39.0 41.0 34.8 41.0 30-34 38.1653 40.0 38.0 41.0 34.6 41.0 35-39 37.79335 40.0 38.0 41.0 33.6 41.0 40-44 37.67209999999999 40.0 38.0 41.0 33.4 41.0 45-49 37.3378 40.0 37.8 41.0 32.6 41.0 50-54 36.78745000000001 39.2 37.0 40.2 31.6 40.8 55-59 36.816900000000004 39.8 36.8 41.0 31.6 41.0 60-64 36.74135 39.0 36.2 41.0 31.6 41.0 65-69 35.90535 38.2 35.0 40.0 31.0 41.0 70-74 34.976749999999996 36.6 35.0 39.0 30.4 40.6 75-79 33.8911 35.4 34.0 37.2 29.6 39.0 80-84 32.87675 35.0 33.6 36.0 28.0 37.0 85-89 32.004949999999994 35.0 32.8 35.0 25.8 36.0 90-94 31.558549999999997 34.8 32.4 35.0 25.0 35.4 95-99 31.7192 35.0 33.0 35.0 26.2 35.0 100-104 31.26925 34.4 32.0 35.0 24.6 35.0 105-109 31.0896 34.4 31.8 35.0 23.8 35.0 110-114 30.972 34.0 32.0 35.0 23.4 35.0 115-119 30.35485 34.0 31.0 35.0 20.2 35.0 120-124 29.575100000000003 34.0 29.6 35.0 15.4 35.0 125-129 29.1911 34.0 29.2 35.0 9.4 35.0 130-134 28.868149999999996 33.8 29.0 35.0 6.0 35.0 135-139 28.205399999999997 33.0 28.2 35.0 2.0 35.0 140-144 27.358900000000006 32.8 26.2 34.2 2.0 35.0 145-149 26.072300000000002 32.2 23.8 34.0 2.0 35.0 150 22.287 29.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 76.0 3 4.0 4 6.0 5 8.0 6 4.0 7 2.0 8 10.0 9 6.0 10 11.0 11 7.0 12 7.0 13 3.0 14 9.0 15 10.0 16 10.0 17 7.0 18 12.0 19 9.0 20 18.0 21 12.0 22 18.0 23 18.0 24 22.0 25 29.0 26 30.0 27 42.0 28 62.0 29 70.0 30 97.0 31 108.0 32 133.0 33 211.0 34 345.0 35 648.0 36 1210.0 37 719.0 38 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.324999999999996 13.850000000000001 14.099999999999998 38.725 2 21.325 24.025 39.775 14.875 3 19.975 24.525 30.725 24.775 4 22.900000000000002 35.225 20.225 21.65 5 22.225 37.925 21.8 18.05 6 16.275000000000002 39.475 23.724999999999998 20.525 7 16.650000000000002 14.2 46.225 22.925 8 19.75 18.8 30.725 30.725 9 21.2 21.7 30.15 26.950000000000003 10-14 22.759999999999998 27.71 27.205000000000002 22.325 15-19 22.264999999999997 26.905 28.54 22.29 20-24 22.21 27.884999999999998 28.835 21.07 25-29 22.67 27.705000000000002 28.48 21.145 30-34 22.955000000000002 27.894999999999996 27.755000000000003 21.395 35-39 22.884999999999998 27.63 28.015 21.47 40-44 22.759999999999998 28.110000000000003 28.384999999999998 20.745 45-49 23.01 27.925 28.299999999999997 20.765 50-54 22.99 27.61 28.16 21.240000000000002 55-59 22.919999999999998 28.02 28.044999999999998 21.015 60-64 23.135 27.6 28.355000000000004 20.91 65-69 22.75 28.105000000000004 28.035 21.11 70-74 22.900000000000002 27.445000000000004 28.73 20.925 75-79 23.46 27.79 27.91 20.84 80-84 23.28 28.105000000000004 27.55 21.065 85-89 23.49 27.529999999999998 28.035 20.945 90-94 23.015 27.500000000000004 28.79 20.695 95-99 23.580000000000002 27.794999999999998 27.555000000000003 21.07 100-104 23.419999999999998 27.415 28.59 20.575 105-109 23.39 27.955000000000002 27.99 20.665 110-114 23.395 27.79 27.805000000000003 21.01 115-119 23.865 27.77 27.37 20.995 120-124 23.505000000000003 27.534999999999997 28.515 20.445 125-129 23.530294691549507 27.507880122079353 27.698003702406567 21.263821483964577 130-134 23.615 27.97 27.55 20.865000000000002 135-139 23.515 28.115000000000002 27.705000000000002 20.665 140-144 23.955000000000002 27.705000000000002 27.92 20.419999999999998 145-149 24.705 27.405 27.57 20.32 150 24.8 27.675 26.1 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 2.0 23 2.0 24 2.5 25 3.5 26 5.0 27 6.5 28 8.5 29 10.5 30 14.0 31 19.5 32 24.0 33 31.0 34 41.0 35 57.0 36 71.5 37 87.5 38 124.5 39 169.0 40 200.0 41 211.5 42 251.5 43 283.0 44 273.0 45 280.5 46 289.5 47 279.0 48 230.5 49 200.0 50 182.5 51 144.0 52 116.5 53 96.0 54 77.0 55 52.0 56 33.0 57 23.5 58 16.5 59 13.0 60 14.5 61 11.5 62 4.5 63 4.0 64 4.5 65 2.5 66 2.0 67 2.5 68 2.0 69 1.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.065 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.15000000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATCC 10 0.006973645 144.0 9 TTGTAGA 10 0.006973645 144.0 6 >>END_MODULE Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897040 spots for SRR3727115.sra Written 897040 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra Read 897030 spots for SRR3727115.sra Written 897030 spots for SRR3727115.sra SRR ids: ['SRR3727115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_laom5lh8 SRR3727115.sra spots: 17940610 blocks: [[1, 897030], [897031, 1794060], [1794061, 2691090], [2691091, 3588120], [3588121, 4485150], [4485151, 5382180], [5382181, 6279210], [6279211, 7176240], [7176241, 8073270], [8073271, 8970300], [8970301, 9867330], [9867331, 10764360], [10764361, 11661390], [11661391, 12558420], [12558421, 13455450], [13455451, 14352480], [14352481, 15249510], [15249511, 16146540], [16146541, 17043570], [17043571, 17940610]] SRR3727115 file size 6022743 SRR3727115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727115 SRR3727115_1.fastq SRR3727115_2.fastq Input file: SRR3727115_1.fastq Paired file: SRR3727115_2.fastq trimmed: SRR3727115-trimmed-pair1.fastq, SRR3727115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:54:05 2025 >> started Fri Feb 14 08:54:25 2025 >> done (20.011s) 17940610 read pairs processed; of these: 74470 ( 0.42%) short read pairs filtered out after trimming by size control 290769 ( 1.62%) empty read pairs filtered out after trimming by size control 17575371 (97.96%) read pairs available; of these: 7488316 (42.61%) trimmed read pairs available after processing 10087055 (57.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 5 0.00% 22 13 0.00% 23 13 0.00% 24 20 0.00% 25 36 0.00% 26 47 0.00% 27 49 0.00% 28 78 0.00% 29 61 0.00% 30 89 0.00% 31 107 0.00% 32 116 0.00% 33 143 0.00% 34 151 0.00% 35 183 0.00% 36 199 0.00% 37 239 0.00% 38 270 0.00% 39 328 0.00% 40 348 0.00% 41 419 0.00% 42 387 0.00% 43 433 0.00% 44 501 0.00% 45 545 0.00% 46 559 0.00% 47 577 0.00% 48 664 0.00% 49 681 0.00% 50 730 0.00% 51 883 0.01% 52 891 0.01% 53 856 0.00% 54 961 0.01% 55 1027 0.01% 56 1020 0.01% 57 1116 0.01% 58 1194 0.01% 59 1296 0.01% 60 1373 0.01% 61 1398 0.01% 62 1435 0.01% 63 1614 0.01% 64 1645 0.01% 65 1785 0.01% 66 1856 0.01% 67 1908 0.01% 68 2096 0.01% 69 2178 0.01% 70 2429 0.01% 71 2455 0.01% 72 2584 0.01% 73 2981 0.02% 74 3186 0.02% 75 3345 0.02% 76 3741 0.02% 77 3895 0.02% 78 4124 0.02% 79 4380 0.02% 80 4607 0.03% 81 4560 0.03% 82 5171 0.03% 83 5972 0.03% 84 10026 0.06% 85 10313 0.06% 86 11174 0.06% 87 11860 0.07% 88 11803 0.07% 89 12175 0.07% 90 12626 0.07% 91 13529 0.08% 92 13902 0.08% 93 14416 0.08% 94 14735 0.08% 95 15184 0.09% 96 16331 0.09% 97 16846 0.10% 98 17404 0.10% 99 17629 0.10% 100 17560 0.10% 101 19126 0.11% 102 18967 0.11% 103 18430 0.10% 104 19630 0.11% 105 23556 0.13% 106 20853 0.12% 107 21296 0.12% 108 23837 0.14% 109 24845 0.14% 110 21348 0.12% 111 21372 0.12% 112 31409 0.18% 113 22257 0.13% 114 22147 0.13% 115 37147 0.21% 116 23799 0.14% 117 25109 0.14% 118 24663 0.14% 119 27637 0.16% 120 29951 0.17% 121 40819 0.23% 122 29595 0.17% 123 28412 0.16% 124 29092 0.17% 125 31165 0.18% 126 37695 0.21% 127 33488 0.19% 128 36659 0.21% 129 59737 0.34% 130 46288 0.26% 131 52385 0.30% 132 61874 0.35% 133 76628 0.44% 134 75028 0.43% 135 67029 0.38% 136 89464 0.51% 137 99690 0.57% 138 112273 0.64% 139 127613 0.73% 140 132034 0.75% 141 148627 0.85% 142 163817 0.93% 143 187641 1.07% 144 226179 1.29% 145 275362 1.57% 146 354533 2.02% 147 502642 2.86% 148 790075 4.50% 149 2769622 15.76% 150 10087055 57.39% 17575371 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.11 prefix-fanout=1.9 sequence=TGCCAACGGTGACATTAAGCAATGAACCGAGCAAATCAGCACATACACCTAATTTAAGTGCATCCTTTGGGCACTTTCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=7 fanout-score=394.13 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=36.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=9.90 fanout-score-rank=19 prefix-density=0.30 prefix-fanout=5.4 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=288.81 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.5 sequence=GAAGAAGAAGAAA SRR3727115 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:55:08 Started mapping on | Feb 14 08:55:08 Finished on | Feb 14 08:56:34 Mapping speed, Million of reads per hour | 735.71 Number of input reads | 17575371 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17019928 Uniquely mapped reads % | 96.84% Average mapped length | 291.42 Number of splices: Total | 17798691 Number of splices: Annotated (sjdb) | 17549412 Number of splices: GT/AG | 17538049 Number of splices: GC/AG | 219483 Number of splices: AT/AC | 12109 Number of splices: Non-canonical | 29050 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375507 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 25661 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 196830 196830 196830 N_multimapping 375507 375507 375507 N_noFeature 420361 16843453 524800 N_ambiguous 139574 1188 66577 UnstrandedReadsAssigned:16459993 PositiveStrandReadsAssigned:175287 NegativeStrandReadsAssigned:16428551 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727115-trimmed-pair1.fastq SRR3727115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,575,371 reads, 16,487,102 reads pseudoaligned [quant] estimated average fragment length: 256.539 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR3727115.ke.tsv 34699 SRR3727115.se.tsv 87100 total ==> SRR3727115.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.46 683 22.5368 Potri.005G024800.1.v4.1 1035 779.461 176 13.1314 Potri.004G059700.1.v4.1 961 705.505 60 4.94587 Potri.007G009000.2.v4.1 1416 1160.46 0 0 Potri.003G141000.2.v4.1 2943 2687.46 471.311 10.199 Potri.016G087400.1.v4.1 270 71.404 1509 1229.02 Potri.015G069301.1.v4.1 564 315.112 0 0 Potri.010G195200.1.v4.1 1773 1517.46 55.4692 2.12582 Potri.012G127500.1.v4.1 977 721.48 1893 152.587 ==> SRR3727115.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 162 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 52 SRR3727115 completed mapping pipeline successfully