Starting /dee2/code/volunteer_pipeline.sh SRR3727116 current disk space = 3117166452736 free memory = 1581124212 SRR3727116 SRAfilesize ed0a4ba3a564a6e90c6bee682c0a4938 SRR3727116.sra SRR3727116.sra file validated SRR3727116 is paired end SRR3727116 is conventional basespace SRR3727116 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5635 34.0 31.0 34.0 31.0 34.0 2 32.77475 34.0 31.0 34.0 31.0 34.0 3 33.086 34.0 33.0 34.0 31.0 34.0 4 36.507 37.0 37.0 37.0 35.0 37.0 5 36.4755 37.0 37.0 37.0 35.0 37.0 6 35.96675 37.0 36.0 37.0 35.0 37.0 7 36.3115 37.0 37.0 37.0 35.0 37.0 8 36.45475 37.0 37.0 37.0 35.0 37.0 9 38.30675 39.0 39.0 39.0 37.0 39.0 10-14 38.58865 39.4 39.2 39.4 37.2 39.4 15-19 39.580650000000006 40.8 39.4 41.0 37.2 41.0 20-24 39.6045 41.0 39.4 41.0 37.2 41.0 25-29 39.281349999999996 40.0 39.0 41.0 36.0 41.0 30-34 39.275850000000005 40.0 39.0 41.0 36.4 41.0 35-39 38.75815 40.0 38.0 41.0 35.0 41.0 40-44 38.81875 40.0 38.0 41.0 35.2 41.0 45-49 39.0927 40.0 38.8 41.0 35.6 41.0 50-54 38.7729 40.0 38.4 41.0 34.8 41.0 55-59 38.49855 40.0 38.0 41.0 34.4 41.0 60-64 37.83415 39.4 36.4 41.0 33.6 41.0 65-69 37.2142 38.6 35.6 40.2 33.0 41.0 70-74 36.15665 36.8 35.0 39.0 32.0 40.6 75-79 34.88155 35.2 33.8 37.4 30.8 39.0 80-84 34.35055 35.0 34.0 36.4 31.0 37.6 85-89 33.64905 35.0 34.0 35.2 30.6 36.2 90-94 33.31699999999999 35.0 34.0 35.0 30.2 35.8 95-99 33.02405 35.0 33.8 35.0 29.2 35.0 100-104 32.8133 35.0 33.2 35.0 29.2 35.0 105-109 32.23605 34.4 32.4 35.0 27.4 35.0 110-114 32.160650000000004 34.0 32.4 35.0 27.4 35.0 115-119 31.84155 34.0 32.0 35.0 25.8 35.0 120-124 31.378499999999995 34.0 31.6 35.0 25.0 35.0 125-129 30.41035 34.0 30.4 35.0 20.8 35.0 130-134 29.614150000000002 34.0 29.8 35.0 15.8 35.0 135-139 27.12025 32.4 24.8 34.4 3.6 35.0 140-144 26.09605 32.0 23.0 34.0 2.0 35.0 145-149 20.464150000000004 28.2 2.0 34.0 2.0 35.0 150 15.0045 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 3.0 10 3.0 11 4.0 12 1.0 13 3.0 14 3.0 15 3.0 16 5.0 17 2.0 18 9.0 19 11.0 20 11.0 21 11.0 22 12.0 23 15.0 24 18.0 25 29.0 26 36.0 27 45.0 28 57.0 29 89.0 30 99.0 31 161.0 32 204.0 33 264.0 34 488.0 35 793.0 36 1106.0 37 511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.028600354340675 18.780055682105797 10.959250822576564 33.23209314097697 2 17.875 26.75 39.025 16.35 3 16.225 31.25 26.325 26.200000000000003 4 20.0 37.824999999999996 21.9 20.275000000000002 5 22.35 38.0 20.95 18.7 6 16.275000000000002 36.675000000000004 23.799999999999997 23.25 7 13.525 18.95 44.975 22.55 8 17.275 18.75 29.325000000000003 34.65 9 18.15 20.424999999999997 30.925000000000004 30.5 10-14 19.935 29.709999999999997 26.025 24.33 15-19 20.31 28.89 26.805 23.995 20-24 20.02 28.439999999999998 27.889999999999997 23.65 25-29 19.439999999999998 28.51 28.365000000000002 23.685000000000002 30-34 20.15701570157016 28.272827282728276 27.802780278027804 23.767376737673768 35-39 20.47602380119006 28.376418820941048 27.631381569078457 23.51617580879044 40-44 20.53 28.084999999999997 27.605 23.78 45-49 19.885 28.425 27.55 24.14 50-54 20.575 28.255000000000003 27.42 23.75 55-59 20.465 28.199999999999996 27.515 23.82 60-64 20.355 28.17 27.235 24.240000000000002 65-69 20.055 28.205000000000002 27.905 23.835 70-74 21.175 28.64 27.175 23.01 75-79 20.28 28.615000000000002 27.49 23.615 80-84 20.64 28.910000000000004 27.18 23.27 85-89 21.0 28.28 26.729999999999997 23.990000000000002 90-94 20.32101605080254 28.266413320666032 27.85639281964098 23.556177808890443 95-99 20.87 28.005000000000003 27.860000000000003 23.265 100-104 20.835 28.01 27.815 23.34 105-109 20.985 28.76 26.805 23.45 110-114 20.966289886966088 27.838351505451637 27.748324497349202 23.44703411023307 115-119 21.279255851170234 28.305661132226444 27.470494098819763 22.944588917783555 120-124 21.161058052902646 27.366368318415923 27.67138356917846 23.801190059502975 125-129 20.575 27.605 27.779999999999998 24.04 130-134 20.96 27.24 28.07 23.73 135-139 20.226011300565027 28.351417570878546 28.23641182059103 23.186159307965397 140-144 20.48 28.08 27.465 23.974999999999998 145-149 18.805 29.2 27.435 24.560000000000002 150 8.975 35.775 27.975 27.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.5 23 2.5 24 1.5 25 1.0 26 2.5 27 8.5 28 12.0 29 12.5 30 17.5 31 27.5 32 35.0 33 41.5 34 48.5 35 65.0 36 86.5 37 107.5 38 136.0 39 161.5 40 189.0 41 218.0 42 245.5 43 267.0 44 264.0 45 261.0 46 266.5 47 258.5 48 239.5 49 203.5 50 172.0 51 148.0 52 120.0 53 96.0 54 66.5 55 46.5 56 41.5 57 36.0 58 22.5 59 14.5 60 12.5 61 8.0 62 6.5 63 5.0 64 4.0 65 2.0 66 2.0 67 2.5 68 3.5 69 2.5 70 1.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.02 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.35 0.0 0.0 0.0 0.0 134-135 0.4375 0.0 0.0 0.0 0.0 136-137 0.6499999999999999 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAGC 10 0.0069754543 143.9875 7 AAAAAAA 65 2.1596095E-5 17.721539 100-104 >>END_MODULE SRR3727116 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9655 33.0 31.0 34.0 28.0 34.0 2 31.22325 34.0 31.0 34.0 30.0 34.0 3 31.422 34.0 31.0 34.0 30.0 34.0 4 34.728 37.0 35.0 37.0 33.0 37.0 5 34.73725 37.0 35.0 37.0 33.0 37.0 6 34.73875 37.0 36.0 37.0 33.0 37.0 7 34.7835 37.0 36.0 37.0 35.0 37.0 8 34.83175 37.0 37.0 37.0 35.0 37.0 9 36.56275 39.0 38.0 39.0 35.0 39.0 10-14 36.73199999999999 39.4 38.2 39.4 34.6 39.4 15-19 37.59325 40.6 38.4 41.0 33.2 41.0 20-24 37.7274 41.0 39.0 41.0 34.0 41.0 25-29 37.4294 40.0 38.6 41.0 33.2 41.0 30-34 37.3189 40.0 38.0 41.0 33.2 41.0 35-39 37.0919 40.0 38.0 41.0 32.6 41.0 40-44 36.7274 40.0 38.0 41.0 31.2 41.0 45-49 36.567899999999995 40.0 37.8 41.0 30.8 41.0 50-54 35.99405 39.0 36.6 40.2 30.4 40.6 55-59 36.02255 39.0 36.0 41.0 29.8 41.0 60-64 36.03685 39.0 36.0 41.0 30.4 41.0 65-69 35.307700000000004 38.0 35.0 40.0 29.6 41.0 70-74 34.31025 36.6 34.8 39.0 28.8 40.6 75-79 33.25835 35.2 34.0 37.0 28.2 39.0 80-84 32.19915 35.0 33.2 35.8 26.0 37.2 85-89 31.70825 35.0 33.0 35.0 25.2 36.2 90-94 31.34565 35.0 33.0 35.0 24.6 35.4 95-99 30.952250000000003 34.6 32.2 35.0 22.6 35.0 100-104 30.738350000000004 34.0 32.0 35.0 20.4 35.0 105-109 30.574999999999996 34.0 31.8 35.0 19.6 35.0 110-114 30.06945 34.0 30.8 35.0 16.6 35.0 115-119 29.588150000000002 34.0 30.2 35.0 10.4 35.0 120-124 29.305400000000002 34.0 29.6 35.0 7.6 35.0 125-129 28.76775 33.8 29.0 35.0 3.0 35.0 130-134 28.117 33.4 27.8 35.0 2.0 35.0 135-139 27.5945 33.0 26.6 35.0 2.0 35.0 140-144 26.622200000000003 32.0 25.0 34.0 2.0 35.0 145-149 24.50575 31.2 15.4 34.0 2.0 35.0 150 20.787 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 169.0 3 11.0 4 5.0 5 1.0 6 7.0 7 3.0 8 4.0 9 7.0 10 2.0 11 4.0 12 7.0 13 7.0 14 9.0 15 9.0 16 5.0 17 4.0 18 10.0 19 15.0 20 10.0 21 17.0 22 12.0 23 23.0 24 24.0 25 33.0 26 34.0 27 44.0 28 52.0 29 64.0 30 81.0 31 120.0 32 161.0 33 188.0 34 348.0 35 685.0 36 1205.0 37 613.0 38 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.0 15.275 12.125 31.6 2 21.45 22.725 38.15 17.675 3 20.549999999999997 25.3 29.849999999999998 24.3 4 24.6 35.199999999999996 19.875 20.325 5 22.875 38.675 21.425 17.025000000000002 6 17.0 37.974999999999994 23.849999999999998 21.175 7 15.7 15.85 45.875 22.575 8 19.625 20.1 28.575 31.7 9 21.375 22.775000000000002 28.65 27.200000000000003 10-14 22.215 28.575 26.700000000000003 22.509999999999998 15-19 22.470000000000002 27.425 27.939999999999998 22.165000000000003 20-24 22.225 28.325 27.61 21.84 25-29 22.27 27.975 27.935 21.82 30-34 22.470000000000002 28.08 27.73 21.72 35-39 22.515 28.189999999999998 27.92 21.375 40-44 22.775000000000002 27.93 28.065 21.23 45-49 22.745 27.875 28.09 21.29 50-54 22.43 28.33 28.175 21.065 55-59 22.685 27.700000000000003 27.839999999999996 21.775 60-64 23.26 27.474999999999998 28.060000000000002 21.205 65-69 22.185 28.050000000000004 28.49 21.275 70-74 22.295 28.34 28.28 21.085 75-79 22.59 28.09 27.97 21.349999999999998 80-84 22.8 28.389999999999997 27.500000000000004 21.310000000000002 85-89 22.935 28.1 27.37 21.595 90-94 22.770000000000003 28.110000000000003 27.689999999999998 21.43 95-99 23.235 28.144999999999996 27.72 20.9 100-104 23.580000000000002 28.265 27.24 20.915 105-109 22.625 27.6 28.53 21.245 110-114 22.884999999999998 27.915 28.144999999999996 21.055 115-119 23.365 27.82 27.705000000000002 21.11 120-124 23.265 27.794999999999998 27.584999999999997 21.355 125-129 22.814999999999998 27.925 28.04 21.22 130-134 23.785 27.46 27.265 21.490000000000002 135-139 23.880000000000003 27.305 27.525 21.29 140-144 23.525 28.03 26.985 21.46 145-149 23.87 27.99 27.0 21.14 150 23.575 27.525 28.749999999999996 20.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.0 7 1.0 8 0.5 9 1.5 10 1.0 11 0.5 12 1.0 13 0.5 14 1.0 15 2.0 16 2.5 17 3.0 18 1.5 19 1.5 20 2.5 21 1.5 22 3.0 23 4.0 24 3.0 25 5.0 26 7.0 27 4.5 28 6.0 29 12.0 30 14.0 31 17.0 32 23.5 33 28.5 34 40.0 35 59.5 36 68.0 37 94.0 38 120.5 39 154.5 40 216.0 41 248.0 42 247.0 43 252.5 44 254.0 45 249.5 46 258.5 47 263.0 48 244.5 49 216.5 50 181.0 51 150.0 52 125.5 53 100.0 54 85.5 55 58.5 56 36.5 57 33.5 58 26.0 59 14.0 60 9.5 61 8.0 62 5.5 63 4.0 64 4.0 65 2.0 66 0.5 67 0.0 68 2.0 69 3.5 70 1.5 71 0.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 1.0 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.4 0.0 0.0 0.0 0.0 134-135 0.4875 0.0 0.0 0.0 0.0 136-137 0.7625 0.0 0.0 0.0 0.0 138 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579742 spots for SRR3727116.sra Written 579742 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra Read 579731 spots for SRR3727116.sra Written 579731 spots for SRR3727116.sra SRR ids: ['SRR3727116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmdm0nxh SRR3727116.sra spots: 11594631 blocks: [[1, 579731], [579732, 1159462], [1159463, 1739193], [1739194, 2318924], [2318925, 2898655], [2898656, 3478386], [3478387, 4058117], [4058118, 4637848], [4637849, 5217579], [5217580, 5797310], [5797311, 6377041], [6377042, 6956772], [6956773, 7536503], [7536504, 8116234], [8116235, 8695965], [8695966, 9275696], [9275697, 9855427], [9855428, 10435158], [10435159, 11014889], [11014890, 11594631]] SRR3727116 file size 3884693 SRR3727116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727116 SRR3727116_1.fastq SRR3727116_2.fastq Input file: SRR3727116_1.fastq Paired file: SRR3727116_2.fastq trimmed: SRR3727116-trimmed-pair1.fastq, SRR3727116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:01:55 2025 >> started Fri Feb 14 09:02:34 2025 >> done (38.217s) 11594631 read pairs processed; of these: 63295 ( 0.55%) short read pairs filtered out after trimming by size control 373849 ( 3.22%) empty read pairs filtered out after trimming by size control 11157487 (96.23%) read pairs available; of these: 4745533 (42.53%) trimmed read pairs available after processing 6411954 (57.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 5 0.00% 21 6 0.00% 22 5 0.00% 23 14 0.00% 24 21 0.00% 25 28 0.00% 26 19 0.00% 27 28 0.00% 28 49 0.00% 29 39 0.00% 30 64 0.00% 31 62 0.00% 32 80 0.00% 33 90 0.00% 34 91 0.00% 35 122 0.00% 36 122 0.00% 37 127 0.00% 38 157 0.00% 39 162 0.00% 40 181 0.00% 41 193 0.00% 42 219 0.00% 43 224 0.00% 44 259 0.00% 45 292 0.00% 46 286 0.00% 47 319 0.00% 48 301 0.00% 49 371 0.00% 50 413 0.00% 51 433 0.00% 52 425 0.00% 53 472 0.00% 54 516 0.00% 55 545 0.00% 56 526 0.00% 57 545 0.00% 58 610 0.01% 59 626 0.01% 60 694 0.01% 61 684 0.01% 62 751 0.01% 63 794 0.01% 64 855 0.01% 65 866 0.01% 66 910 0.01% 67 1009 0.01% 68 1028 0.01% 69 1171 0.01% 70 1194 0.01% 71 1269 0.01% 72 1391 0.01% 73 1480 0.01% 74 1564 0.01% 75 1753 0.02% 76 1816 0.02% 77 1964 0.02% 78 2131 0.02% 79 2265 0.02% 80 2467 0.02% 81 2656 0.02% 82 3046 0.03% 83 3653 0.03% 84 7071 0.06% 85 7232 0.06% 86 7559 0.07% 87 8139 0.07% 88 7718 0.07% 89 7886 0.07% 90 8039 0.07% 91 8168 0.07% 92 8774 0.08% 93 9023 0.08% 94 9284 0.08% 95 9544 0.09% 96 9718 0.09% 97 9952 0.09% 98 10079 0.09% 99 10300 0.09% 100 9977 0.09% 101 9909 0.09% 102 10246 0.09% 103 10321 0.09% 104 10293 0.09% 105 11579 0.10% 106 11590 0.10% 107 12967 0.12% 108 11994 0.11% 109 13318 0.12% 110 12670 0.11% 111 14325 0.13% 112 13924 0.12% 113 17522 0.16% 114 15554 0.14% 115 28300 0.25% 116 17367 0.16% 117 15791 0.14% 118 14119 0.13% 119 14026 0.13% 120 14390 0.13% 121 15021 0.13% 122 16121 0.14% 123 18390 0.16% 124 18068 0.16% 125 18026 0.16% 126 18786 0.17% 127 20061 0.18% 128 20928 0.19% 129 22496 0.20% 130 24617 0.22% 131 26633 0.24% 132 28553 0.26% 133 33908 0.30% 134 47043 0.42% 135 46068 0.41% 136 58955 0.53% 137 67340 0.60% 138 69415 0.62% 139 79271 0.71% 140 84449 0.76% 141 98214 0.88% 142 111453 1.00% 143 130363 1.17% 144 150432 1.35% 145 187286 1.68% 146 243045 2.18% 147 350196 3.14% 148 532601 4.77% 149 1732664 15.53% 150 6411954 57.47% 11157487 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.3 sequence=GATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=7 fanout-score=356.12 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=35.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=10.39 fanout-score-rank=19 prefix-density=0.32 prefix-fanout=5.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=269.38 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=28.7 sequence=GAAGAAGAAGAAA SRR3727116 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:03:48 Started mapping on | Feb 14 09:03:48 Finished on | Feb 14 09:04:44 Mapping speed, Million of reads per hour | 717.27 Number of input reads | 11157487 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10689714 Uniquely mapped reads % | 95.81% Average mapped length | 291.85 Number of splices: Total | 11096627 Number of splices: Annotated (sjdb) | 10938597 Number of splices: GT/AG | 10932807 Number of splices: GC/AG | 136975 Number of splices: AT/AC | 7722 Number of splices: Non-canonical | 19123 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234137 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 18178 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 252802 252802 252802 N_multimapping 234137 234137 234137 N_noFeature 255106 10572241 326464 N_ambiguous 89917 1053 42899 UnstrandedReadsAssigned:10344691 PositiveStrandReadsAssigned:116420 NegativeStrandReadsAssigned:10320351 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727116-trimmed-pair1.fastq SRR3727116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,157,487 reads, 10,346,197 reads pseudoaligned [quant] estimated average fragment length: 260.738 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR3727116.ke.tsv 34699 SRR3727116.se.tsv 87100 total ==> SRR3727116.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.26 403 20.9194 Potri.005G024800.1.v4.1 1035 775.262 106 12.4792 Potri.004G059700.1.v4.1 961 701.384 28 3.64359 Potri.007G009000.2.v4.1 1416 1156.26 0 0 Potri.003G141000.2.v4.1 2943 2683.26 302 10.2724 Potri.016G087400.1.v4.1 270 71.8165 775.449 985.501 Potri.015G069301.1.v4.1 564 312.401 0 0 Potri.010G195200.1.v4.1 1773 1513.26 28.4475 1.71576 Potri.012G127500.1.v4.1 977 717.346 1267 161.204 ==> SRR3727116.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 117 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3727116 completed mapping pipeline successfully