Starting /dee2/code/volunteer_pipeline.sh SRR3727117 current disk space = 3117047226368 free memory = 1577960700 SRR3727117 SRAfilesize bf01790a3f7ca2ce44c5390657d43f45 SRR3727117.sra SRR3727117.sra file validated SRR3727117 is paired end SRR3727117 is conventional basespace SRR3727117 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727117_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3315 34.0 31.0 34.0 31.0 34.0 2 32.76175 34.0 33.0 34.0 31.0 34.0 3 33.083 34.0 34.0 34.0 31.0 34.0 4 36.4595 37.0 37.0 37.0 35.0 37.0 5 36.38675 37.0 37.0 37.0 35.0 37.0 6 36.492 37.0 37.0 37.0 35.0 37.0 7 36.49325 37.0 37.0 37.0 35.0 37.0 8 36.39225 37.0 37.0 37.0 35.0 37.0 9 38.32425 39.0 39.0 39.0 37.0 39.0 10-14 38.4709 39.4 39.0 39.4 36.6 39.4 15-19 39.799350000000004 41.0 40.0 41.0 37.8 41.0 20-24 39.73995 41.0 40.0 41.0 37.4 41.0 25-29 39.547000000000004 41.0 39.8 41.0 37.0 41.0 30-34 39.2713 40.8 39.0 41.0 36.0 41.0 35-39 39.215199999999996 40.2 39.0 41.0 36.0 41.0 40-44 38.97935 40.0 38.6 41.0 35.4 41.0 45-49 39.30785 41.0 39.0 41.0 36.0 41.0 50-54 39.1535 40.8 39.0 41.0 35.4 41.0 55-59 38.78435 40.0 38.0 41.0 35.0 41.0 60-64 38.31175 39.8 37.2 41.0 34.2 41.0 65-69 37.43455 38.8 35.8 40.6 33.4 41.0 70-74 36.517649999999996 37.0 35.0 39.4 33.0 41.0 75-79 34.98565 35.4 34.0 37.4 31.2 39.2 80-84 34.5308 35.0 34.2 36.4 31.4 37.6 85-89 34.0615 35.0 34.0 35.4 31.4 36.4 90-94 33.624 35.0 34.0 35.0 31.0 36.0 95-99 33.31185 35.0 34.0 35.0 30.0 35.0 100-104 33.214150000000004 35.0 34.0 35.0 30.2 35.0 105-109 33.0342 35.0 34.0 35.0 29.6 35.0 110-114 32.88725 35.0 34.0 35.0 29.4 35.0 115-119 32.58390000000001 35.0 33.0 35.0 29.0 35.0 120-124 32.37755000000001 35.0 33.0 35.0 28.6 35.0 125-129 31.398950000000003 34.2 31.6 35.0 25.0 35.0 130-134 30.878800000000002 34.0 31.0 35.0 23.0 35.0 135-139 30.78465 34.0 31.0 35.0 23.2 35.0 140-144 30.285700000000002 34.0 30.8 35.0 20.0 35.0 145-149 28.8394 34.0 29.6 35.0 4.6 35.0 150 22.072 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 3.0 12 1.0 13 3.0 14 3.0 15 7.0 16 3.0 17 7.0 18 9.0 19 7.0 20 4.0 21 13.0 22 7.0 23 16.0 24 21.0 25 25.0 26 29.0 27 27.0 28 37.0 29 43.0 30 77.0 31 96.0 32 105.0 33 170.0 34 231.0 35 465.0 36 1248.0 37 1326.0 38 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.20399283337599 17.89096493473253 12.592782185820322 40.31226004607115 2 17.075000000000003 27.3 40.325 15.299999999999999 3 16.125 30.225 27.3 26.35 4 19.35 38.5 21.55 20.599999999999998 5 19.475 38.175 22.900000000000002 19.45 6 15.575 37.525 25.3 21.6 7 12.225 19.375 46.150000000000006 22.25 8 17.549999999999997 21.325 27.025 34.1 9 18.55 22.75 30.275000000000002 28.425 10-14 18.735 30.095 26.640000000000004 24.529999999999998 15-19 19.115 29.14 27.900000000000002 23.845 20-24 19.32 29.685 27.33 23.665 25-29 19.36 29.37 27.83 23.44 30-34 18.96 29.435 27.785 23.82 35-39 19.55 29.915000000000003 27.150000000000002 23.385 40-44 19.79 29.325000000000003 27.73 23.155 45-49 20.105 29.225 27.05 23.62 50-54 19.285 28.63 28.050000000000004 24.035 55-59 19.63 29.2 27.91 23.26 60-64 19.85 29.065 27.13 23.955000000000002 65-69 20.125 28.43 27.455000000000002 23.990000000000002 70-74 20.205000000000002 28.93 27.505000000000003 23.36 75-79 20.05 28.51 27.224999999999998 24.215 80-84 19.355 28.310000000000002 28.355000000000004 23.98 85-89 19.365 29.459999999999997 27.38 23.794999999999998 90-94 19.851985198519852 28.73287328732873 27.677767776777678 23.737373737373737 95-99 20.512051205120514 28.462846284628462 27.61776177617762 23.407340734073408 100-104 20.035 29.049999999999997 27.615000000000002 23.3 105-109 20.355 28.785 27.415 23.445 110-114 20.349999999999998 28.560000000000002 27.994999999999997 23.095 115-119 20.325 28.615000000000002 27.38 23.68 120-124 20.064999999999998 28.110000000000003 27.825 24.0 125-129 20.095 28.235 27.765 23.905 130-134 20.336016800840042 28.666433321666084 27.071353567678386 23.926196309815488 135-139 20.580000000000002 28.23 27.474999999999998 23.715 140-144 20.685000000000002 28.660000000000004 26.924999999999997 23.73 145-149 20.630000000000003 28.93 26.805 23.635 150 10.225 31.85 27.950000000000003 29.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 1.0 26 2.5 27 8.0 28 13.5 29 17.0 30 25.0 31 33.5 32 47.5 33 60.0 34 69.0 35 86.0 36 99.5 37 124.0 38 155.0 39 183.5 40 205.0 41 230.5 42 254.5 43 275.5 44 278.5 45 259.0 46 261.0 47 242.0 48 198.0 49 167.5 50 149.0 51 119.5 52 91.0 53 81.0 54 67.0 55 52.5 56 36.0 57 20.0 58 18.5 59 18.5 60 12.5 61 7.0 62 5.0 63 6.0 64 5.0 65 1.5 66 1.0 67 2.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.3624999999999998 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138 3.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCATG 10 0.006973645 144.0 9 >>END_MODULE SRR3727117 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727117_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09975 34.0 31.0 34.0 31.0 34.0 2 32.0315 34.0 31.0 34.0 30.0 34.0 3 32.26125 34.0 31.0 34.0 31.0 34.0 4 35.49775 37.0 37.0 37.0 35.0 37.0 5 35.566 37.0 37.0 37.0 35.0 37.0 6 35.57175 37.0 37.0 37.0 35.0 37.0 7 35.57325 37.0 37.0 37.0 35.0 37.0 8 35.55975 37.0 37.0 37.0 35.0 37.0 9 37.2755 39.0 39.0 39.0 35.0 39.0 10-14 37.527 39.4 38.6 39.4 35.2 39.4 15-19 38.61875 41.0 39.0 41.0 35.8 41.0 20-24 38.46535 41.0 39.0 41.0 35.0 41.0 25-29 38.437949999999994 41.0 39.0 41.0 34.8 41.0 30-34 38.207300000000004 40.2 38.6 41.0 34.4 41.0 35-39 37.89575 40.0 38.0 41.0 33.6 41.0 40-44 37.4553 40.0 37.8 41.0 32.2 41.0 45-49 37.46 40.0 38.0 41.0 32.6 41.0 50-54 36.71085 39.4 37.0 40.4 31.2 40.8 55-59 37.16074999999999 40.0 37.0 41.0 32.2 41.0 60-64 37.12555 39.6 36.6 41.0 32.8 41.0 65-69 36.15195 38.4 35.2 40.6 31.2 41.0 70-74 34.951499999999996 36.6 35.0 39.0 29.8 40.8 75-79 34.1528 35.4 34.6 37.4 30.2 39.2 80-84 33.32305 35.0 34.0 36.2 29.2 37.4 85-89 32.73995 35.0 34.0 35.2 29.0 36.2 90-94 32.46255 35.0 34.0 35.0 29.0 36.0 95-99 32.1853 35.0 33.8 35.0 28.2 35.0 100-104 31.902449999999998 35.0 33.0 35.0 26.2 35.0 105-109 31.66455 35.0 33.0 35.0 25.6 35.0 110-114 31.292450000000002 35.0 32.2 35.0 24.6 35.0 115-119 30.932799999999997 34.0 32.0 35.0 23.4 35.0 120-124 30.311199999999996 34.0 31.0 35.0 18.2 35.0 125-129 29.38535 34.0 29.2 35.0 12.6 35.0 130-134 29.63885 34.0 30.0 35.0 14.8 35.0 135-139 28.99855 34.0 29.0 35.0 5.0 35.0 140-144 28.58635 34.0 29.0 35.0 2.0 35.0 145-149 27.37795 33.0 27.4 35.0 2.0 35.0 150 23.6305 29.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 77.0 3 9.0 4 4.0 5 4.0 6 4.0 7 6.0 8 2.0 9 6.0 10 3.0 11 10.0 12 6.0 13 13.0 14 10.0 15 8.0 16 4.0 17 7.0 18 10.0 19 12.0 20 11.0 21 15.0 22 16.0 23 20.0 24 16.0 25 31.0 26 32.0 27 29.0 28 43.0 29 46.0 30 85.0 31 87.0 32 117.0 33 164.0 34 321.0 35 570.0 36 1211.0 37 971.0 38 20.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.8 14.174999999999999 14.674999999999999 35.35 2 23.05 24.65 36.275 16.025 3 20.424999999999997 26.55 29.925 23.1 4 24.05 34.75 20.974999999999998 20.225 5 23.875 37.824999999999996 20.974999999999998 17.325 6 17.825 38.675 25.124999999999996 18.375 7 16.85 14.6 46.45 22.1 8 21.575 21.575 27.125 29.725 9 22.55 23.825 29.15 24.474999999999998 10-14 23.35 28.59 26.8 21.26 15-19 23.115 27.755000000000003 28.37 20.76 20-24 23.085 28.025 27.634999999999998 21.255 25-29 22.465 27.775 28.299999999999997 21.46 30-34 22.855 28.02 28.110000000000003 21.015 35-39 23.175 28.405 28.065 20.355 40-44 23.235 28.105000000000004 27.905 20.755000000000003 45-49 22.845 27.644999999999996 28.754999999999995 20.755000000000003 50-54 23.26 28.000000000000004 28.305000000000003 20.435 55-59 23.494999999999997 27.794999999999998 28.050000000000004 20.66 60-64 23.425 28.15 27.994999999999997 20.43 65-69 23.695 28.044999999999998 27.37 20.89 70-74 23.455000000000002 27.785 28.005000000000003 20.755000000000003 75-79 23.69 27.55 28.34 20.419999999999998 80-84 23.03 28.084999999999997 28.345 20.54 85-89 22.994999999999997 27.794999999999998 28.955 20.255000000000003 90-94 23.195 28.225 28.175 20.405 95-99 23.544999999999998 27.1 28.37 20.985 100-104 23.724999999999998 28.044999999999998 28.205000000000002 20.025000000000002 105-109 23.599999999999998 27.115000000000002 29.189999999999998 20.095 110-114 23.630000000000003 27.315 28.87 20.185 115-119 23.405 27.865000000000002 28.389999999999997 20.34 120-124 23.855 27.544999999999998 28.595 20.005 125-129 24.315 28.585 27.565 19.535 130-134 24.02 28.110000000000003 27.865000000000002 20.005 135-139 24.43 27.644999999999996 27.855 20.07 140-144 24.645 28.16 27.24 19.955000000000002 145-149 24.58 27.87 28.305000000000003 19.245 150 25.575 27.875 26.424999999999997 20.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 1.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 3.5 25 3.0 26 5.0 27 7.0 28 8.5 29 14.0 30 20.0 31 22.0 32 26.0 33 39.0 34 55.5 35 63.0 36 82.5 37 112.5 38 127.5 39 159.5 40 196.5 41 223.5 42 246.0 43 270.0 44 282.5 45 272.0 46 257.0 47 244.0 48 230.0 49 209.5 50 177.0 51 139.0 52 111.5 53 90.0 54 68.5 55 45.0 56 35.0 57 33.0 58 25.0 59 22.0 60 18.0 61 12.0 62 10.5 63 6.5 64 3.0 65 3.0 66 3.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0125 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0125 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.037500000000000006 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.0625 0.0 0.0 0.025 0.0 90-91 0.125 0.0 0.0 0.025 0.0 92-93 0.125 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.16249999999999998 0.0 0.0 0.025 0.0 102-103 0.225 0.0 0.0 0.025 0.0 104-105 0.3375 0.0 0.0 0.025 0.0 106-107 0.44999999999999996 0.0 0.0 0.025 0.0 108-109 0.625 0.0 0.0 0.025 0.0 110-111 0.725 0.0 0.0 0.025 0.0 112-113 0.775 0.0 0.0 0.025 0.0 114-115 0.9125000000000001 0.0 0.0 0.025 0.0 116-117 1.075 0.0 0.0 0.025 0.0 118-119 1.25 0.0 0.0 0.025 0.0 120-121 1.275 0.0 0.0 0.025 0.0 122-123 1.3125 0.0 0.0 0.025 0.0 124-125 1.4625 0.0 0.0 0.025 0.0 126-127 1.7 0.0 0.0 0.025 0.0 128-129 1.85 0.0 0.0 0.025 0.0 130-131 2.05 0.0 0.0 0.025 0.0 132-133 2.375 0.0 0.0 0.025 0.0 134-135 2.75 0.0 0.0 0.025 0.0 136-137 3.125 0.0 0.0 0.025 0.0 138 3.4 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAG 10 0.006973645 144.0 7 TTAATTC 10 0.006973645 144.0 2 >>END_MODULE Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083277 spots for SRR3727117.sra Written 1083277 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra Read 1083261 spots for SRR3727117.sra Written 1083261 spots for SRR3727117.sra SRR ids: ['SRR3727117.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t76m6i0x SRR3727117.sra spots: 21665236 blocks: [[1, 1083261], [1083262, 2166522], [2166523, 3249783], [3249784, 4333044], [4333045, 5416305], [5416306, 6499566], [6499567, 7582827], [7582828, 8666088], [8666089, 9749349], [9749350, 10832610], [10832611, 11915871], [11915872, 12999132], [12999133, 14082393], [14082394, 15165654], [15165655, 16248915], [16248916, 17332176], [17332177, 18415437], [18415438, 19498698], [19498699, 20581959], [20581960, 21665236]] SRR3727117 file size 7277622 SRR3727117 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727117 SRR3727117_1.fastq SRR3727117_2.fastq Input file: SRR3727117_1.fastq Paired file: SRR3727117_2.fastq trimmed: SRR3727117-trimmed-pair1.fastq, SRR3727117-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:19:03 2025 >> started Fri Feb 14 09:19:26 2025 >> done (22.900s) 21665236 read pairs processed; of these: 91101 ( 0.42%) short read pairs filtered out after trimming by size control 307557 ( 1.42%) empty read pairs filtered out after trimming by size control 21266578 (98.16%) read pairs available; of these: 8386508 (39.44%) trimmed read pairs available after processing 12880070 (60.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 8 0.00% 21 12 0.00% 22 16 0.00% 23 26 0.00% 24 32 0.00% 25 55 0.00% 26 45 0.00% 27 90 0.00% 28 85 0.00% 29 88 0.00% 30 133 0.00% 31 149 0.00% 32 166 0.00% 33 193 0.00% 34 220 0.00% 35 251 0.00% 36 287 0.00% 37 328 0.00% 38 330 0.00% 39 408 0.00% 40 401 0.00% 41 482 0.00% 42 496 0.00% 43 587 0.00% 44 644 0.00% 45 661 0.00% 46 775 0.00% 47 802 0.00% 48 800 0.00% 49 883 0.00% 50 948 0.00% 51 980 0.00% 52 1107 0.01% 53 1128 0.01% 54 1168 0.01% 55 1212 0.01% 56 1360 0.01% 57 1362 0.01% 58 1484 0.01% 59 1556 0.01% 60 1595 0.01% 61 1651 0.01% 62 1738 0.01% 63 1904 0.01% 64 1931 0.01% 65 2049 0.01% 66 2276 0.01% 67 2279 0.01% 68 2436 0.01% 69 2483 0.01% 70 2724 0.01% 71 2824 0.01% 72 3176 0.01% 73 3313 0.02% 74 3636 0.02% 75 3845 0.02% 76 4134 0.02% 77 4485 0.02% 78 4699 0.02% 79 4880 0.02% 80 5312 0.02% 81 5702 0.03% 82 6264 0.03% 83 7021 0.03% 84 12462 0.06% 85 13024 0.06% 86 13713 0.06% 87 14736 0.07% 88 15053 0.07% 89 15633 0.07% 90 16549 0.08% 91 17103 0.08% 92 17613 0.08% 93 18610 0.09% 94 20013 0.09% 95 21225 0.10% 96 20394 0.10% 97 20540 0.10% 98 20574 0.10% 99 21533 0.10% 100 22365 0.11% 101 27385 0.13% 102 28108 0.13% 103 25265 0.12% 104 25848 0.12% 105 30814 0.14% 106 28532 0.13% 107 33864 0.16% 108 36529 0.17% 109 36433 0.17% 110 35146 0.17% 111 35038 0.16% 112 37125 0.17% 113 35132 0.17% 114 36895 0.17% 115 47822 0.22% 116 40125 0.19% 117 30829 0.14% 118 29078 0.14% 119 30853 0.15% 120 30053 0.14% 121 32225 0.15% 122 41205 0.19% 123 46790 0.22% 124 50831 0.24% 125 59179 0.28% 126 54489 0.26% 127 48377 0.23% 128 48998 0.23% 129 56780 0.27% 130 59174 0.28% 131 63957 0.30% 132 76241 0.36% 133 86799 0.41% 134 90001 0.42% 135 96092 0.45% 136 104436 0.49% 137 111268 0.52% 138 118351 0.56% 139 126560 0.60% 140 134354 0.63% 141 147108 0.69% 142 164451 0.77% 143 185632 0.87% 144 220302 1.04% 145 268914 1.26% 146 348946 1.64% 147 490235 2.31% 148 778511 3.66% 149 3210160 15.09% 150 12880070 60.56% 21266578 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=502.09 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=34.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=40 prefix-density=0.10 prefix-fanout=2.2 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=491.59 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=31.8 sequence=TGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGGACTATCTCCCAGACCACAATGAAAGCATATCTGTTGTTCTTGACAGGTTTGCTTCCATGGGTATTGACACCCCTGGACTGGTTGCCTTGCTAGGA SRR3727117 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:20:36 Started mapping on | Feb 14 09:20:36 Finished on | Feb 14 09:23:11 Mapping speed, Million of reads per hour | 493.93 Number of input reads | 21266578 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20196831 Uniquely mapped reads % | 94.97% Average mapped length | 291.28 Number of splices: Total | 18138401 Number of splices: Annotated (sjdb) | 17744102 Number of splices: GT/AG | 17808846 Number of splices: GC/AG | 277185 Number of splices: AT/AC | 15566 Number of splices: Non-canonical | 36804 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 502770 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 50674 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587643 587643 587643 N_multimapping 502770 502770 502770 N_noFeature 818937 19949914 929146 N_ambiguous 249350 1302 111975 UnstrandedReadsAssigned:19128544 PositiveStrandReadsAssigned:245615 NegativeStrandReadsAssigned:19155710 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727117 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727117-trimmed-pair1.fastq SRR3727117-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,266,578 reads, 19,334,034 reads pseudoaligned [quant] estimated average fragment length: 249.87 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR3727117.ke.tsv 34699 SRR3727117.se.tsv 87100 total ==> SRR3727117.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.13 728 19.0439 Potri.005G024800.1.v4.1 1035 786.13 287 16.8956 Potri.004G059700.1.v4.1 961 712.179 115 7.47297 Potri.007G009000.2.v4.1 1416 1167.13 0 0 Potri.003G141000.2.v4.1 2943 2694.13 775.191 13.316 Potri.016G087400.1.v4.1 270 74.8412 2040.59 1261.83 Potri.015G069301.1.v4.1 564 321.219 0 0 Potri.010G195200.1.v4.1 1773 1524.13 198 6.01213 Potri.012G127500.1.v4.1 977 728.16 6193 393.604 ==> SRR3727117.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 402 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 445 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 308 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR3727117 completed mapping pipeline successfully