Starting /dee2/code/volunteer_pipeline.sh SRR3727118 current disk space = 3116389097472 free memory = 1569124304 SRR3727118 SRAfilesize 54daf80c629ed3a8ad0ee868e89d99e3 SRR3727118.sra SRR3727118.sra file validated SRR3727118 is paired end SRR3727118 is conventional basespace SRR3727118 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35875 34.0 31.0 34.0 31.0 34.0 2 32.763 34.0 33.0 34.0 31.0 34.0 3 33.1345 34.0 34.0 34.0 31.0 34.0 4 36.47575 37.0 37.0 37.0 35.0 37.0 5 36.3765 37.0 37.0 37.0 35.0 37.0 6 36.437 37.0 37.0 37.0 35.0 37.0 7 36.4715 37.0 37.0 37.0 35.0 37.0 8 36.415 37.0 37.0 37.0 35.0 37.0 9 38.31775 39.0 39.0 39.0 37.0 39.0 10-14 38.4944 39.4 39.0 39.4 36.6 39.4 15-19 39.799699999999994 41.0 40.0 41.0 37.4 41.0 20-24 39.80465 41.0 40.0 41.0 37.8 41.0 25-29 39.586349999999996 41.0 39.8 41.0 36.8 41.0 30-34 39.339099999999995 41.0 39.0 41.0 36.4 41.0 35-39 39.27485 40.2 39.0 41.0 36.0 41.0 40-44 39.0292 40.0 38.8 41.0 35.2 41.0 45-49 39.33885 41.0 39.0 41.0 36.2 41.0 50-54 39.1599 41.0 39.0 41.0 35.6 41.0 55-59 38.75985 40.0 38.0 41.0 35.0 41.0 60-64 38.264300000000006 39.8 37.2 41.0 34.2 41.0 65-69 37.42755 38.8 35.6 40.6 33.6 41.0 70-74 36.592949999999995 37.2 35.0 39.4 33.0 41.0 75-79 35.071749999999994 35.4 34.4 37.4 31.2 39.2 80-84 34.59765 35.0 34.8 36.4 31.6 37.8 85-89 34.05825 35.0 34.4 35.4 31.4 36.4 90-94 33.66414999999999 35.0 34.0 35.0 31.0 36.0 95-99 33.39275 35.0 34.0 35.0 30.8 35.0 100-104 33.29075 35.0 34.0 35.0 30.6 35.0 105-109 33.12485 35.0 34.0 35.0 30.0 35.0 110-114 32.99275 35.0 34.0 35.0 29.8 35.0 115-119 32.7484 35.0 33.4 35.0 29.2 35.0 120-124 32.5176 35.0 33.0 35.0 28.6 35.0 125-129 31.659650000000006 34.2 32.0 35.0 25.4 35.0 130-134 31.15625 34.0 31.0 35.0 24.2 35.0 135-139 31.01205 34.0 31.0 35.0 24.2 35.0 140-144 30.53095 34.0 30.8 35.0 22.4 35.0 145-149 29.275349999999996 34.0 30.0 35.0 8.4 35.0 150 22.42375 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 4.0 11 5.0 12 0.0 13 5.0 14 3.0 15 4.0 16 7.0 17 6.0 18 5.0 19 10.0 20 9.0 21 7.0 22 13.0 23 10.0 24 9.0 25 14.0 26 16.0 27 33.0 28 50.0 29 46.0 30 65.0 31 82.0 32 113.0 33 147.0 34 244.0 35 469.0 36 1232.0 37 1378.0 38 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.78372152546711 19.887381622728437 11.389813155874071 33.939083695930385 2 18.275 27.075 38.275 16.375 3 16.0 31.8 27.700000000000003 24.5 4 20.4 36.7 21.925 20.974999999999998 5 20.05 38.475 22.8 18.675 6 16.325 36.3 24.925 22.45 7 13.325000000000001 19.25 45.6 21.825 8 17.95 21.325 28.349999999999998 32.375 9 17.65 22.825 29.25 30.275000000000002 10-14 20.165 30.595 25.825 23.415 15-19 20.21 29.505 27.04 23.244999999999997 20-24 19.655 29.035 27.275 24.035 25-29 19.985 29.42 26.99 23.605 30-34 20.22101105055253 29.42647132356618 27.44137206860343 22.911145557277866 35-39 20.005 29.78 26.66 23.555 40-44 19.975 28.849999999999998 27.395000000000003 23.78 45-49 20.605 29.005 27.235 23.155 50-54 19.67 28.95 27.11 24.27 55-59 20.235 28.83 27.32 23.615 60-64 19.68 29.42 27.435 23.465 65-69 20.07 28.87 27.38 23.68 70-74 20.655 28.51 27.425 23.41 75-79 20.306015300765036 28.94644732236612 27.151357567878392 23.59617980899045 80-84 20.555 28.415000000000003 27.045 23.985 85-89 20.51 28.64 26.965 23.885 90-94 19.97599279783935 29.098729618885667 27.168150445133538 23.757127138141442 95-99 20.167058470464664 28.559995998599508 27.289551342970043 23.983394187965786 100-104 21.029999999999998 28.744999999999997 26.8 23.425 105-109 20.474999999999998 28.935 27.58 23.01 110-114 20.735 28.345 27.6 23.32 115-119 21.2 27.88 27.395000000000003 23.525 120-124 21.61 28.07 27.01 23.31 125-129 21.7 28.299999999999997 26.490000000000002 23.51 130-134 21.198179726959044 29.014352152822926 26.18892833925089 23.598539780967144 135-139 21.615000000000002 28.65 26.479999999999997 23.255 140-144 21.42 28.804999999999996 25.905 23.87 145-149 20.95 28.99 26.565 23.494999999999997 150 8.6 34.050000000000004 27.525 29.825000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 2.0 24 3.5 25 3.0 26 5.0 27 9.0 28 12.5 29 16.5 30 23.0 31 40.0 32 52.0 33 59.0 34 74.5 35 85.5 36 98.0 37 122.0 38 143.0 39 164.0 40 185.0 41 202.0 42 223.0 43 226.0 44 240.5 45 264.0 46 255.5 47 232.5 48 220.5 49 203.0 50 172.5 51 142.5 52 114.5 53 90.5 54 73.0 55 60.0 56 50.5 57 37.0 58 23.5 59 22.0 60 16.0 61 8.0 62 5.5 63 5.0 64 5.0 65 4.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.034999999999999996 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6294058408862034 1.25 3 0.0 0.0 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.85 0.0 0.0 0.0 0.0 136-137 4.3625 0.0 0.0 0.0 0.0 138 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3727118 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.558 34.0 31.0 34.0 30.0 34.0 2 31.5445 34.0 31.0 34.0 30.0 34.0 3 31.70725 34.0 31.0 34.0 30.0 34.0 4 34.87425 37.0 37.0 37.0 33.0 37.0 5 34.943 37.0 37.0 37.0 33.0 37.0 6 34.944 37.0 37.0 37.0 35.0 37.0 7 34.98625 37.0 37.0 37.0 35.0 37.0 8 34.93925 37.0 37.0 37.0 35.0 37.0 9 36.614 39.0 38.0 39.0 34.0 39.0 10-14 36.9014 39.4 38.4 39.4 34.6 39.4 15-19 37.92305 41.0 39.0 41.0 34.2 41.0 20-24 37.75895 41.0 38.8 41.0 33.6 41.0 25-29 37.6948 41.0 38.8 41.0 33.6 41.0 30-34 37.4693 40.4 38.4 41.0 33.0 41.0 35-39 37.2439 40.0 38.0 41.0 32.4 41.0 40-44 36.89995 40.0 37.8 41.0 31.6 41.0 45-49 36.7784 40.0 38.0 41.0 31.4 41.0 50-54 36.11285 39.2 36.8 40.4 30.0 41.0 55-59 36.4405 40.0 36.8 41.0 30.8 41.0 60-64 36.36245 39.6 36.2 41.0 31.2 41.0 65-69 35.49625 38.2 35.0 40.4 30.2 41.0 70-74 34.3558 36.4 35.0 39.0 28.6 40.8 75-79 33.48325 35.4 34.4 37.2 28.8 39.0 80-84 32.66635 35.0 34.0 36.2 28.0 37.4 85-89 32.12415 35.0 34.0 35.2 26.8 36.2 90-94 31.82955 35.0 34.0 35.0 26.6 35.8 95-99 31.494799999999998 35.0 33.2 35.0 24.6 35.0 100-104 31.2558 35.0 33.0 35.0 24.0 35.0 105-109 31.084899999999998 35.0 33.0 35.0 24.0 35.0 110-114 30.739299999999997 35.0 32.0 35.0 19.8 35.0 115-119 30.5126 34.0 31.8 35.0 18.6 35.0 120-124 29.91445 34.0 30.6 35.0 13.8 35.0 125-129 29.097550000000002 34.0 29.0 35.0 7.0 35.0 130-134 29.2211 34.0 29.8 35.0 6.0 35.0 135-139 28.690049999999996 34.0 29.0 35.0 2.0 35.0 140-144 28.2526 33.8 29.0 35.0 2.0 35.0 145-149 27.11455 33.0 26.2 35.0 2.0 35.0 150 23.607 29.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 144.0 3 20.0 4 6.0 5 6.0 6 7.0 7 11.0 8 3.0 9 10.0 10 4.0 11 5.0 12 8.0 13 3.0 14 9.0 15 4.0 16 11.0 17 7.0 18 7.0 19 11.0 20 6.0 21 5.0 22 17.0 23 16.0 24 19.0 25 24.0 26 37.0 27 22.0 28 43.0 29 52.0 30 62.0 31 61.0 32 123.0 33 183.0 34 295.0 35 543.0 36 1206.0 37 999.0 38 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.875 16.025 14.249999999999998 30.85 2 22.925 23.0 35.949999999999996 18.125 3 19.05 26.075 32.6 22.275 4 23.9 35.05 21.025 20.025000000000002 5 22.225 37.974999999999994 21.75 18.05 6 19.375 36.775000000000006 23.575 20.275000000000002 7 17.974999999999998 15.45 42.975 23.599999999999998 8 20.3 20.875 28.675 30.15 9 22.125 23.7 28.475 25.7 10-14 22.975 27.58 27.025 22.42 15-19 23.185 27.315 28.360000000000003 21.14 20-24 23.145 27.955000000000002 26.935 21.965 25-29 22.81 27.944999999999997 27.375 21.87 30-34 23.66 26.88 28.060000000000002 21.4 35-39 23.285 27.279999999999998 27.884999999999998 21.55 40-44 22.939999999999998 27.52 28.27 21.27 45-49 23.294999999999998 27.150000000000002 28.03 21.525 50-54 23.52 27.325 27.57 21.584999999999997 55-59 23.11 27.950000000000003 27.825 21.115000000000002 60-64 22.915 27.325 28.02 21.740000000000002 65-69 23.025000000000002 27.744999999999997 28.199999999999996 21.029999999999998 70-74 23.544999999999998 27.04 27.975 21.44 75-79 23.74 27.26 28.134999999999998 20.865000000000002 80-84 23.32 27.37 27.775 21.535 85-89 23.745 27.450000000000003 27.810000000000002 20.995 90-94 23.14 27.839999999999996 27.82 21.2 95-99 23.400000000000002 26.715 28.515 21.37 100-104 23.419999999999998 27.534999999999997 28.185 20.86 105-109 23.810000000000002 27.48 27.855 20.855 110-114 23.61 27.565 28.33 20.495 115-119 23.36 27.38 28.67 20.59 120-124 23.71 27.675 28.305000000000003 20.31 125-129 24.23 27.495000000000005 27.560000000000002 20.715 130-134 23.849999999999998 27.605 28.48 20.064999999999998 135-139 24.175 27.655 28.02 20.150000000000002 140-144 24.7 27.88 27.315 20.105 145-149 25.224999999999998 26.525 27.88 20.369999999999997 150 26.200000000000003 28.025 26.150000000000002 19.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 1.0 12 2.5 13 2.0 14 1.0 15 1.0 16 0.5 17 1.0 18 2.0 19 1.5 20 0.5 21 1.0 22 2.5 23 3.0 24 2.0 25 2.5 26 5.0 27 7.0 28 8.5 29 11.5 30 12.5 31 15.0 32 28.0 33 39.0 34 42.0 35 48.5 36 74.5 37 96.0 38 117.5 39 151.5 40 160.0 41 193.5 42 229.5 43 230.0 44 238.5 45 271.0 46 282.5 47 260.5 48 247.0 49 223.0 50 190.0 51 160.5 52 131.5 53 111.5 54 89.5 55 62.5 56 51.5 57 42.5 58 34.0 59 22.0 60 17.0 61 19.5 62 12.5 63 10.0 64 5.5 65 0.5 66 1.5 67 3.0 68 3.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 2.0 76 2.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.7874999999999996 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.9000000000000004 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGATT 10 0.006973645 144.0 1 >>END_MODULE Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943031 spots for SRR3727118.sra Written 943031 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra Read 943016 spots for SRR3727118.sra Written 943016 spots for SRR3727118.sra SRR ids: ['SRR3727118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bt92anl1 SRR3727118.sra spots: 18860335 blocks: [[1, 943016], [943017, 1886032], [1886033, 2829048], [2829049, 3772064], [3772065, 4715080], [4715081, 5658096], [5658097, 6601112], [6601113, 7544128], [7544129, 8487144], [8487145, 9430160], [9430161, 10373176], [10373177, 11316192], [11316193, 12259208], [12259209, 13202224], [13202225, 14145240], [14145241, 15088256], [15088257, 16031272], [16031273, 16974288], [16974289, 17917304], [17917305, 18860335]] SRR3727118 file size 6332611 SRR3727118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727118 SRR3727118_1.fastq SRR3727118_2.fastq Input file: SRR3727118_1.fastq Paired file: SRR3727118_2.fastq trimmed: SRR3727118-trimmed-pair1.fastq, SRR3727118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:44:16 2025 >> started Fri Feb 14 09:44:37 2025 >> done (21.455s) 18860335 read pairs processed; of these: 107284 ( 0.57%) short read pairs filtered out after trimming by size control 536007 ( 2.84%) empty read pairs filtered out after trimming by size control 18217044 (96.59%) read pairs available; of these: 7487249 (41.10%) trimmed read pairs available after processing 10729795 (58.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 9 0.00% 21 18 0.00% 22 29 0.00% 23 31 0.00% 24 38 0.00% 25 52 0.00% 26 59 0.00% 27 84 0.00% 28 74 0.00% 29 112 0.00% 30 120 0.00% 31 127 0.00% 32 163 0.00% 33 184 0.00% 34 236 0.00% 35 243 0.00% 36 274 0.00% 37 328 0.00% 38 329 0.00% 39 391 0.00% 40 390 0.00% 41 509 0.00% 42 503 0.00% 43 598 0.00% 44 596 0.00% 45 643 0.00% 46 742 0.00% 47 734 0.00% 48 781 0.00% 49 854 0.00% 50 932 0.01% 51 979 0.01% 52 1063 0.01% 53 1106 0.01% 54 1111 0.01% 55 1123 0.01% 56 1219 0.01% 57 1306 0.01% 58 1375 0.01% 59 1408 0.01% 60 1500 0.01% 61 1658 0.01% 62 1667 0.01% 63 1806 0.01% 64 1887 0.01% 65 2032 0.01% 66 2103 0.01% 67 2190 0.01% 68 2427 0.01% 69 2510 0.01% 70 2753 0.02% 71 2819 0.02% 72 3124 0.02% 73 3282 0.02% 74 3513 0.02% 75 3912 0.02% 76 4044 0.02% 77 4499 0.02% 78 4747 0.03% 79 4978 0.03% 80 5316 0.03% 81 5713 0.03% 82 6311 0.03% 83 7034 0.04% 84 12704 0.07% 85 12880 0.07% 86 13501 0.07% 87 14378 0.08% 88 14094 0.08% 89 14582 0.08% 90 15504 0.09% 91 15898 0.09% 92 15601 0.09% 93 16240 0.09% 94 17800 0.10% 95 18444 0.10% 96 18792 0.10% 97 20304 0.11% 98 18935 0.10% 99 19450 0.11% 100 18974 0.10% 101 21145 0.12% 102 22685 0.12% 103 22817 0.13% 104 23109 0.13% 105 29004 0.16% 106 24709 0.14% 107 32624 0.18% 108 31730 0.17% 109 35815 0.20% 110 33338 0.18% 111 36567 0.20% 112 31242 0.17% 113 31255 0.17% 114 31387 0.17% 115 46484 0.26% 116 34688 0.19% 117 31126 0.17% 118 34837 0.19% 119 33111 0.18% 120 41328 0.23% 121 42170 0.23% 122 56225 0.31% 123 48336 0.27% 124 40778 0.22% 125 49592 0.27% 126 51471 0.28% 127 63540 0.35% 128 57256 0.31% 129 62079 0.34% 130 64617 0.35% 131 64847 0.36% 132 77280 0.42% 133 79909 0.44% 134 84313 0.46% 135 89586 0.49% 136 95335 0.52% 137 101270 0.56% 138 108145 0.59% 139 114833 0.63% 140 120574 0.66% 141 131563 0.72% 142 146843 0.81% 143 165463 0.91% 144 195081 1.07% 145 235898 1.29% 146 304790 1.67% 147 424306 2.33% 148 667180 3.66% 149 2734176 15.01% 150 10729795 58.90% 18217044 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=9.35 fanout-score-rank=10 prefix-density=0.41 prefix-fanout=5.5 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=37.30 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=8.5 sequence=TTTTTTTTTCGCATATAACCACATTCAAATTGACCTCCCTCAGGAAGCTAAGAAATACTATCTCGGCAATAGGATTGTAGCCCAGGATGAGTCCCTCAGCGTGACGCAGTAAACTAGTAGCATCCCGATCTTTTCCCTATCTAATTCACCTCCTATTAGGAGCCGATCGTGCTTGTGCGCCGGCAAAACTTTTCAGGCGAATTTCCGCCCCTGGCGCTCTAGGCTACTACGTGCGCGATATGACAAGTTAACAAGACGGCGCAGGTTGATGCTTCCAATAAACATGATCTTTCTGCTCCGCTGAGAAGTACACCTTTTTGCTAGCATCTCGCACGGCAAGAGCGATTGCCGAGCTTAGAGCGTATCTTCCGGGATCGGGCAAAGGGGCAACTCGAGCTAATCTCCCCAGCGGCTAGCATGTGTAGTGCGCCATATCATATCCAAGATAGTGTAGGACTCGTCGCATTGGATGACGATGCCTAGTACTGTGCGCCAATTAGGTCGTCATTGC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=23 prefix-density=0.30 prefix-fanout=3.2 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=124.43 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR3727118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:46:03 Started mapping on | Feb 14 09:46:06 Finished on | Feb 14 09:48:44 Mapping speed, Million of reads per hour | 415.07 Number of input reads | 18217044 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16942838 Uniquely mapped reads % | 93.01% Average mapped length | 290.38 Number of splices: Total | 15432121 Number of splices: Annotated (sjdb) | 15177952 Number of splices: GT/AG | 15122953 Number of splices: GC/AG | 264817 Number of splices: AT/AC | 10463 Number of splices: Non-canonical | 33888 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411047 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 22486 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.57% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 888472 888472 888472 N_multimapping 411047 411047 411047 N_noFeature 483194 16725284 567495 N_ambiguous 234713 816 100981 UnstrandedReadsAssigned:16224931 PositiveStrandReadsAssigned:216738 NegativeStrandReadsAssigned:16274362 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727118-trimmed-pair1.fastq SRR3727118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,217,044 reads, 16,458,185 reads pseudoaligned [quant] estimated average fragment length: 245.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR3727118.ke.tsv 34699 SRR3727118.se.tsv 87100 total ==> SRR3727118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.76 473 14.9729 Potri.005G024800.1.v4.1 1035 790.761 232 16.4733 Potri.004G059700.1.v4.1 961 716.806 9 0.704985 Potri.007G009000.2.v4.1 1416 1171.76 0 0 Potri.003G141000.2.v4.1 2943 2698.76 369 7.67717 Potri.016G087400.1.v4.1 270 78.0438 785 564.768 Potri.015G069301.1.v4.1 564 325.679 0 0 Potri.010G195200.1.v4.1 1773 1528.76 14 0.514195 Potri.012G127500.1.v4.1 977 732.781 2259 173.094 ==> SRR3727118.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 142 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 260 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3727118 completed mapping pipeline successfully