Starting /dee2/code/volunteer_pipeline.sh SRR3727119 current disk space = 3116950544384 free memory = 1580079952 SRR3727119 SRAfilesize 47a609329a9cc9950e2944ea1fd1c273 SRR3727119.sra SRR3727119.sra file validated SRR3727119 is paired end SRR3727119 is conventional basespace SRR3727119 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43275 34.0 31.0 34.0 31.0 34.0 2 32.78525 34.0 33.0 34.0 31.0 34.0 3 33.139 34.0 34.0 34.0 31.0 34.0 4 36.4635 37.0 37.0 37.0 35.0 37.0 5 36.417 37.0 37.0 37.0 35.0 37.0 6 36.48125 37.0 37.0 37.0 35.0 37.0 7 36.4935 37.0 37.0 37.0 35.0 37.0 8 36.429 37.0 37.0 37.0 35.0 37.0 9 38.35525 39.0 39.0 39.0 37.0 39.0 10-14 38.5518 39.4 39.2 39.4 36.8 39.4 15-19 39.845150000000004 41.0 40.0 41.0 38.0 41.0 20-24 39.813300000000005 41.0 40.0 41.0 37.8 41.0 25-29 39.6142 41.0 39.8 41.0 37.0 41.0 30-34 39.3366 41.0 39.0 41.0 36.2 41.0 35-39 39.30305 40.6 39.0 41.0 36.2 41.0 40-44 39.09855 40.2 38.8 41.0 35.4 41.0 45-49 39.3926 40.8 39.4 41.0 36.4 41.0 50-54 39.2221 41.0 39.0 41.0 35.6 41.0 55-59 38.8726 40.0 38.2 41.0 35.0 41.0 60-64 38.308499999999995 39.8 37.4 41.0 34.6 41.0 65-69 37.53545 38.8 36.0 40.6 33.6 41.0 70-74 36.6294 37.2 35.0 39.4 33.0 41.0 75-79 35.087 35.4 34.4 37.4 31.6 39.2 80-84 34.59895 35.0 34.8 36.4 31.8 37.6 85-89 34.11365 35.0 34.4 35.4 31.6 36.4 90-94 33.7548 35.0 34.0 35.0 31.0 36.0 95-99 33.4562 35.0 34.0 35.0 30.8 35.0 100-104 33.319900000000004 35.0 34.0 35.0 30.6 35.0 105-109 33.146699999999996 35.0 34.0 35.0 30.0 35.0 110-114 33.0164 35.0 34.0 35.0 29.8 35.0 115-119 32.71325 35.0 33.2 35.0 29.0 35.0 120-124 32.5008 35.0 33.0 35.0 28.6 35.0 125-129 31.744050000000005 34.0 32.0 35.0 25.8 35.0 130-134 31.1478 34.0 31.2 35.0 24.2 35.0 135-139 31.10575 34.0 31.0 35.0 24.4 35.0 140-144 30.5178 34.0 31.0 35.0 22.6 35.0 145-149 29.372950000000003 34.0 30.0 35.0 9.6 35.0 150 22.902 30.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 2.0 11 2.0 12 2.0 13 7.0 14 2.0 15 3.0 16 5.0 17 2.0 18 10.0 19 10.0 20 6.0 21 6.0 22 9.0 23 18.0 24 13.0 25 13.0 26 27.0 27 23.0 28 36.0 29 46.0 30 51.0 31 79.0 32 116.0 33 160.0 34 273.0 35 460.0 36 1241.0 37 1361.0 38 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.21144024514811 19.994892747701737 6.971399387129725 30.822267620020426 2 16.0 26.05 41.975 15.975 3 15.375 30.2 29.7 24.725 4 21.925 36.1 21.099999999999998 20.875 5 20.925 39.475 21.275 18.325 6 15.975 36.525 24.0 23.5 7 13.900000000000002 18.825 45.824999999999996 21.45 8 16.900000000000002 19.175 30.049999999999997 33.875 9 19.625 20.8 29.075 30.5 10-14 19.865 29.759999999999998 26.115 24.26 15-19 19.735 29.265 27.165 23.835 20-24 19.919999999999998 28.585 28.084999999999997 23.41 25-29 20.175 29.304999999999996 27.57 22.95 30-34 20.015 28.845 27.825 23.315 35-39 19.43 29.060000000000002 27.67 23.84 40-44 20.41 28.565 27.634999999999998 23.39 45-49 19.82 29.470000000000002 27.125 23.585 50-54 19.78 28.74 27.884999999999998 23.595 55-59 20.005 28.79 27.91 23.294999999999998 60-64 20.04 29.09 28.060000000000002 22.81 65-69 20.05 28.42 27.544999999999998 23.985 70-74 20.145 28.555000000000003 27.565 23.735 75-79 20.355 28.65 27.605 23.39 80-84 20.064999999999998 28.105000000000004 28.255000000000003 23.575 85-89 19.8 28.749999999999996 27.700000000000003 23.75 90-94 20.173025953893085 29.179376906535982 27.13407011051658 23.513527029054355 95-99 20.342034203420344 27.83778377837784 28.20782078207821 23.612361236123615 100-104 20.630000000000003 28.255000000000003 27.435 23.68 105-109 20.44 28.1 28.065 23.395 110-114 20.505000000000003 29.34 26.865 23.29 115-119 20.349999999999998 28.57 27.02 24.060000000000002 120-124 20.369999999999997 28.349999999999998 27.71 23.57 125-129 20.325 28.294999999999998 28.075 23.305 130-134 20.85104255212761 28.33641682084104 27.496374818740936 23.316165808290414 135-139 20.794999999999998 28.38 27.500000000000004 23.325000000000003 140-144 21.305 28.57 26.75 23.375 145-149 20.77 28.58 26.700000000000003 23.95 150 8.25 31.55 29.799999999999997 30.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.0 24 3.5 25 5.0 26 5.0 27 8.5 28 8.5 29 13.5 30 24.0 31 28.5 32 38.5 33 47.5 34 58.0 35 69.5 36 87.5 37 114.0 38 155.5 39 176.5 40 186.5 41 232.5 42 254.0 43 264.0 44 293.0 45 294.5 46 265.0 47 235.0 48 214.5 49 188.5 50 171.0 51 140.5 52 103.5 53 77.0 54 50.5 55 42.5 56 38.5 57 26.0 58 14.5 59 13.0 60 10.5 61 8.5 62 4.5 63 3.0 64 7.0 65 6.5 66 2.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.36250000000000004 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTGA 10 0.006973645 144.0 9 >>END_MODULE SRR3727119 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3525 34.0 31.0 34.0 30.0 34.0 2 31.28975 34.0 31.0 34.0 30.0 34.0 3 31.45 34.0 31.0 34.0 30.0 34.0 4 34.6695 37.0 37.0 37.0 33.0 37.0 5 34.71775 37.0 37.0 37.0 33.0 37.0 6 34.687 37.0 37.0 37.0 33.0 37.0 7 34.64 37.0 37.0 37.0 33.0 37.0 8 34.63675 37.0 37.0 37.0 33.0 37.0 9 36.3575 39.0 38.0 39.0 33.0 39.0 10-14 36.564949999999996 39.4 38.4 39.4 33.4 39.4 15-19 37.65575 41.0 39.0 41.0 33.4 41.0 20-24 37.4443 40.8 38.6 41.0 33.0 41.0 25-29 37.3633 41.0 38.8 41.0 32.6 41.0 30-34 37.19494999999999 40.2 38.2 41.0 32.2 41.0 35-39 36.913850000000004 40.0 38.0 41.0 31.2 41.0 40-44 36.470150000000004 40.0 37.8 41.0 29.8 41.0 45-49 36.4602 40.0 37.6 41.0 30.0 41.0 50-54 35.79825 39.2 36.4 40.4 29.2 40.8 55-59 36.25205 40.0 36.8 41.0 29.8 41.0 60-64 36.16165 39.6 36.4 41.0 30.6 41.0 65-69 35.23605 38.2 35.2 40.6 28.8 41.0 70-74 34.157500000000006 36.6 35.0 39.0 27.4 40.8 75-79 33.33665 35.4 34.4 37.4 27.6 39.2 80-84 32.5126 35.0 34.0 36.2 26.4 37.4 85-89 31.923849999999998 35.0 34.0 35.2 26.0 36.2 90-94 31.606849999999998 35.0 33.8 35.0 25.2 35.8 95-99 31.318 35.0 33.0 35.0 24.0 35.0 100-104 31.045350000000003 35.0 33.0 35.0 22.2 35.0 105-109 30.8397 35.0 32.4 35.0 19.4 35.0 110-114 30.58325 35.0 32.0 35.0 17.8 35.0 115-119 30.277800000000003 34.0 31.4 35.0 16.6 35.0 120-124 29.740549999999995 34.0 30.6 35.0 11.0 35.0 125-129 28.9472 34.0 29.0 35.0 6.2 35.0 130-134 29.07695 34.0 29.6 35.0 2.0 35.0 135-139 28.452800000000003 34.0 29.0 35.0 2.0 35.0 140-144 28.214 34.0 29.0 35.0 2.0 35.0 145-149 27.0901 33.2 27.0 35.0 2.0 35.0 150 23.49325 29.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 181.0 3 10.0 4 9.0 5 8.0 6 3.0 7 5.0 8 5.0 9 5.0 10 4.0 11 9.0 12 5.0 13 9.0 14 6.0 15 10.0 16 8.0 17 7.0 18 9.0 19 6.0 20 16.0 21 7.0 22 14.0 23 12.0 24 21.0 25 20.0 26 27.0 27 32.0 28 38.0 29 51.0 30 66.0 31 84.0 32 120.0 33 176.0 34 294.0 35 507.0 36 1144.0 37 1056.0 38 16.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 18.025 9.049999999999999 28.65 2 18.325 24.349999999999998 41.125 16.2 3 20.75 23.525 33.2 22.525000000000002 4 25.3 34.050000000000004 19.8 20.849999999999998 5 24.099999999999998 38.224999999999994 20.7 16.975 6 17.675 38.925 23.400000000000002 20.0 7 17.175 14.899999999999999 46.625 21.3 8 18.475 18.9 31.35 31.275 9 23.05 22.400000000000002 27.575 26.974999999999998 10-14 22.765 28.42 27.22 21.595 15-19 22.86 27.185 28.53 21.425 20-24 22.785 28.235 27.825 21.154999999999998 25-29 22.725 27.650000000000002 28.634999999999998 20.990000000000002 30-34 22.445 28.384999999999998 28.03 21.14 35-39 22.64 28.549999999999997 27.965 20.845 40-44 22.275 27.87 28.59 21.265 45-49 23.27 27.595 28.439999999999998 20.695 50-54 22.655 27.439999999999998 29.185 20.72 55-59 23.085 27.650000000000002 28.485 20.78 60-64 22.919999999999998 27.605 29.14 20.335 65-69 23.105 27.875 28.665000000000003 20.355 70-74 23.145 27.595 28.470000000000002 20.79 75-79 23.125 27.595 28.74 20.54 80-84 23.68 27.55 28.005000000000003 20.765 85-89 22.939999999999998 28.51 28.144999999999996 20.405 90-94 23.685000000000002 27.534999999999997 28.49 20.29 95-99 22.985 27.939999999999998 28.189999999999998 20.885 100-104 23.49 28.275 27.925 20.31 105-109 23.405 28.244999999999997 27.700000000000003 20.65 110-114 23.200000000000003 27.725 28.999999999999996 20.075000000000003 115-119 23.56 28.09 28.03 20.32 120-124 24.01 27.62 28.134999999999998 20.235 125-129 23.244999999999997 27.229999999999997 28.18 21.345 130-134 23.425 28.08 27.915 20.580000000000002 135-139 23.845 27.42 28.499999999999996 20.235 140-144 23.64 27.644999999999996 28.110000000000003 20.605 145-149 24.515 27.625 27.27 20.59 150 23.974999999999998 28.65 27.125 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 2.0 20 2.5 21 3.0 22 3.5 23 2.0 24 5.5 25 6.5 26 8.0 27 10.5 28 10.0 29 14.0 30 16.5 31 19.5 32 29.5 33 40.0 34 53.5 35 66.0 36 80.5 37 104.0 38 127.5 39 155.0 40 188.0 41 230.5 42 258.5 43 267.0 44 274.0 45 279.0 46 268.5 47 257.5 48 231.5 49 194.0 50 170.0 51 138.0 52 101.0 53 72.5 54 57.0 55 52.5 56 48.0 57 32.0 58 26.5 59 18.0 60 7.5 61 7.0 62 8.5 63 10.0 64 5.5 65 4.0 66 5.0 67 3.0 68 1.5 69 2.5 70 3.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.36250000000000004 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.8374999999999999 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.55 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGCAT 10 0.006973645 144.0 8 TTGACCC 10 0.006973645 144.0 3 ATTTGGG 10 0.006973645 144.0 6 GGGATGT 10 0.006973645 144.0 1 TCTCTCT 35 0.0036813593 20.571428 75-79 >>END_MODULE Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907932 spots for SRR3727119.sra Written 907932 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra Read 907929 spots for SRR3727119.sra Written 907929 spots for SRR3727119.sra SRR ids: ['SRR3727119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ennjzue SRR3727119.sra spots: 18158583 blocks: [[1, 907929], [907930, 1815858], [1815859, 2723787], [2723788, 3631716], [3631717, 4539645], [4539646, 5447574], [5447575, 6355503], [6355504, 7263432], [7263433, 8171361], [8171362, 9079290], [9079291, 9987219], [9987220, 10895148], [10895149, 11803077], [11803078, 12711006], [12711007, 13618935], [13618936, 14526864], [14526865, 15434793], [15434794, 16342722], [16342723, 17250651], [17250652, 18158583]] SRR3727119 file size 6096181 SRR3727119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727119 SRR3727119_1.fastq SRR3727119_2.fastq Input file: SRR3727119_1.fastq Paired file: SRR3727119_2.fastq trimmed: SRR3727119-trimmed-pair1.fastq, SRR3727119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:27:49 2025 >> started Fri Feb 14 09:28:09 2025 >> done (20.601s) 18158583 read pairs processed; of these: 123934 ( 0.68%) short read pairs filtered out after trimming by size control 641398 ( 3.53%) empty read pairs filtered out after trimming by size control 17393251 (95.79%) read pairs available; of these: 6660867 (38.30%) trimmed read pairs available after processing 10732384 (61.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 8 0.00% 22 22 0.00% 23 20 0.00% 24 37 0.00% 25 48 0.00% 26 54 0.00% 27 62 0.00% 28 69 0.00% 29 85 0.00% 30 99 0.00% 31 115 0.00% 32 135 0.00% 33 170 0.00% 34 194 0.00% 35 228 0.00% 36 225 0.00% 37 283 0.00% 38 324 0.00% 39 313 0.00% 40 360 0.00% 41 401 0.00% 42 440 0.00% 43 468 0.00% 44 503 0.00% 45 590 0.00% 46 601 0.00% 47 630 0.00% 48 733 0.00% 49 688 0.00% 50 758 0.00% 51 832 0.00% 52 924 0.01% 53 951 0.01% 54 1019 0.01% 55 984 0.01% 56 1124 0.01% 57 1145 0.01% 58 1232 0.01% 59 1208 0.01% 60 1261 0.01% 61 1376 0.01% 62 1460 0.01% 63 1513 0.01% 64 1607 0.01% 65 1684 0.01% 66 1816 0.01% 67 1899 0.01% 68 1980 0.01% 69 2146 0.01% 70 2241 0.01% 71 2360 0.01% 72 2523 0.01% 73 2804 0.02% 74 2836 0.02% 75 3056 0.02% 76 3473 0.02% 77 3674 0.02% 78 4007 0.02% 79 4296 0.02% 80 4517 0.03% 81 5110 0.03% 82 5620 0.03% 83 6777 0.04% 84 13521 0.08% 85 13723 0.08% 86 13783 0.08% 87 14017 0.08% 88 13667 0.08% 89 13576 0.08% 90 14034 0.08% 91 13977 0.08% 92 15014 0.09% 93 15221 0.09% 94 15874 0.09% 95 16626 0.10% 96 16930 0.10% 97 17289 0.10% 98 17093 0.10% 99 17537 0.10% 100 16484 0.09% 101 17186 0.10% 102 18992 0.11% 103 19219 0.11% 104 19328 0.11% 105 24452 0.14% 106 21382 0.12% 107 21834 0.13% 108 23762 0.14% 109 26648 0.15% 110 26129 0.15% 111 26627 0.15% 112 27694 0.16% 113 28390 0.16% 114 29210 0.17% 115 34460 0.20% 116 27393 0.16% 117 21803 0.13% 118 21827 0.13% 119 23343 0.13% 120 25963 0.15% 121 26110 0.15% 122 33593 0.19% 123 33785 0.19% 124 31736 0.18% 125 33867 0.19% 126 37473 0.22% 127 36992 0.21% 128 36623 0.21% 129 45516 0.26% 130 49851 0.29% 131 47857 0.28% 132 52913 0.30% 133 61051 0.35% 134 65170 0.37% 135 69268 0.40% 136 75799 0.44% 137 82795 0.48% 138 89128 0.51% 139 95281 0.55% 140 102445 0.59% 141 112836 0.65% 142 126522 0.73% 143 144453 0.83% 144 172072 0.99% 145 212214 1.22% 146 276990 1.59% 147 395571 2.27% 148 630780 3.63% 149 2650041 15.24% 150 10732384 61.70% 17393251 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.18 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=60.88 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=16.2 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.70 fanout-score-rank=8 prefix-density=0.36 prefix-fanout=4.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=43.05 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.0 sequence=TGGTGCTGAGAATGGCTGCAAGTG SRR3727119 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:29:12 Started mapping on | Feb 14 09:29:12 Finished on | Feb 14 09:30:58 Mapping speed, Million of reads per hour | 590.71 Number of input reads | 17393251 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16639447 Uniquely mapped reads % | 95.67% Average mapped length | 291.55 Number of splices: Total | 16346638 Number of splices: Annotated (sjdb) | 16090888 Number of splices: GT/AG | 16103373 Number of splices: GC/AG | 206140 Number of splices: AT/AC | 11818 Number of splices: Non-canonical | 25307 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376033 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 25306 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411105 411105 411105 N_multimapping 376033 376033 376033 N_noFeature 480085 16462240 579363 N_ambiguous 161362 1081 82634 UnstrandedReadsAssigned:15998000 PositiveStrandReadsAssigned:176126 NegativeStrandReadsAssigned:15977450 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727119-trimmed-pair1.fastq SRR3727119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,393,251 reads, 16,030,953 reads pseudoaligned [quant] estimated average fragment length: 263.363 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR3727119.ke.tsv 34699 SRR3727119.se.tsv 87100 total ==> SRR3727119.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.64 901 33.3423 Potri.005G024800.1.v4.1 1035 772.637 230 19.3401 Potri.004G059700.1.v4.1 961 698.726 36 3.34735 Potri.007G009000.2.v4.1 1416 1153.64 0 0 Potri.003G141000.2.v4.1 2943 2680.64 747.168 18.1087 Potri.016G087400.1.v4.1 270 71.1644 679 619.887 Potri.015G069301.1.v4.1 564 310.59 0 0 Potri.010G195200.1.v4.1 1773 1510.64 116.891 5.02722 Potri.012G127500.1.v4.1 977 714.695 2416 219.625 ==> SRR3727119.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 388 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 90 SRR3727119 completed mapping pipeline successfully