Starting /dee2/code/volunteer_pipeline.sh SRR3727120 current disk space = 3117604491264 free memory = 1391498008 SRR3727120 SRAfilesize 0e20473a46787d4fa60de0d3e1135a23 SRR3727120.sra SRR3727120.sra file validated SRR3727120 is paired end SRR3727120 is conventional basespace SRR3727120 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8295 34.0 31.0 34.0 31.0 34.0 2 32.442 34.0 31.0 34.0 31.0 34.0 3 32.974 34.0 31.0 34.0 31.0 34.0 4 36.38125 37.0 37.0 37.0 35.0 37.0 5 36.105 37.0 37.0 37.0 35.0 37.0 6 36.331 37.0 37.0 37.0 35.0 37.0 7 36.43075 37.0 37.0 37.0 35.0 37.0 8 36.365 37.0 37.0 37.0 35.0 37.0 9 38.258 39.0 39.0 39.0 37.0 39.0 10-14 38.398849999999996 39.4 38.6 39.4 35.8 39.4 15-19 39.535199999999996 41.0 39.6 41.0 36.6 41.0 20-24 39.481700000000004 41.0 39.0 41.0 36.6 41.0 25-29 39.10475 40.0 38.6 41.0 35.6 41.0 30-34 38.970600000000005 40.0 38.6 41.0 35.4 41.0 35-39 38.9142 40.0 38.0 41.0 35.4 41.0 40-44 38.941950000000006 40.0 38.2 41.0 35.0 41.0 45-49 38.721000000000004 40.0 38.2 41.0 34.8 41.0 50-54 38.85635 40.0 38.4 41.0 35.0 41.0 55-59 38.41475 40.0 37.6 41.0 34.4 41.0 60-64 37.954 39.6 36.6 41.0 33.8 41.0 65-69 37.27025 38.6 35.6 40.4 33.0 41.0 70-74 36.182900000000004 36.8 35.0 39.2 32.4 40.8 75-79 34.6642 35.2 33.8 37.2 30.4 39.2 80-84 34.2864 35.0 34.0 36.4 31.0 37.6 85-89 33.5437 35.0 34.0 35.4 30.0 36.4 90-94 33.114850000000004 35.0 33.8 35.0 29.4 36.0 95-99 32.82155 35.0 33.2 35.0 29.0 35.0 100-104 32.72685 35.0 33.0 35.0 29.0 35.0 105-109 32.0714 34.8 32.6 35.0 26.2 35.0 110-114 32.1589 34.8 32.8 35.0 26.8 35.0 115-119 31.71075 34.0 32.0 35.0 25.4 35.0 120-124 31.235500000000002 34.0 31.4 35.0 24.4 35.0 125-129 30.507550000000002 34.0 30.8 35.0 20.8 35.0 130-134 29.75195 34.0 29.6 35.0 16.8 35.0 135-139 28.397399999999998 33.8 28.2 35.0 6.2 35.0 140-144 26.92085 32.6 24.8 34.8 2.0 35.0 145-149 23.87455 31.4 11.2 34.0 2.0 35.0 150 17.0395 19.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 3.0 10 3.0 11 6.0 12 5.0 13 1.0 14 10.0 15 1.0 16 3.0 17 6.0 18 9.0 19 10.0 20 14.0 21 10.0 22 19.0 23 21.0 24 20.0 25 40.0 26 40.0 27 47.0 28 62.0 29 69.0 30 95.0 31 129.0 32 166.0 33 265.0 34 357.0 35 636.0 36 1184.0 37 763.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.01373412801244 20.886239958538482 11.55739828971236 34.54262762373672 2 18.85 27.325 38.074999999999996 15.75 3 15.875 31.75 27.375 25.0 4 19.425 37.675 23.05 19.85 5 19.575 38.224999999999994 22.675 19.525000000000002 6 16.400000000000002 37.175000000000004 23.5 22.925 7 12.3 20.275000000000002 45.925 21.5 8 18.625 20.9 27.224999999999998 33.25 9 16.375 22.3 30.5 30.825000000000003 10-14 19.21 30.220000000000002 26.479999999999997 24.09 15-19 19.98799519807923 29.246698679471788 27.145858343337338 23.619447779111642 20-24 19.645000000000003 29.099999999999998 27.33 23.925 25-29 19.794999999999998 29.404999999999998 27.465 23.335 30-34 19.900000000000002 29.720000000000002 27.62 22.759999999999998 35-39 19.91 29.485 26.85 23.755000000000003 40-44 20.005 29.04 27.615000000000002 23.34 45-49 20.015 29.34 27.01 23.635 50-54 19.915 28.965000000000003 27.185 23.935000000000002 55-59 20.119999999999997 28.744999999999997 27.560000000000002 23.575 60-64 19.97 29.575000000000003 27.05 23.405 65-69 20.06 28.9 27.49 23.549999999999997 70-74 20.45 29.335 27.305 22.91 75-79 20.255000000000003 29.470000000000002 27.189999999999998 23.085 80-84 20.294999999999998 28.73 27.395000000000003 23.580000000000002 85-89 20.665 29.165000000000003 27.075 23.095 90-94 20.485 28.52 27.229999999999997 23.765 95-99 20.145 28.7 27.355 23.799999999999997 100-104 20.305 28.975 27.250000000000004 23.47 105-109 20.455000000000002 28.360000000000003 27.860000000000003 23.325000000000003 110-114 20.674999999999997 28.035 27.525 23.765 115-119 20.16 28.315 27.85 23.674999999999997 120-124 20.76 28.904999999999998 27.255000000000003 23.080000000000002 125-129 20.645 28.754999999999995 27.255000000000003 23.345 130-134 20.5 28.79 27.48 23.23 135-139 19.695 28.139999999999997 28.060000000000002 24.104999999999997 140-144 19.63 28.555000000000003 27.365000000000002 24.45 145-149 19.305 29.544999999999998 27.21 23.94 150 9.525 34.825 29.45 26.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 1.5 23 2.5 24 4.0 25 3.0 26 5.5 27 9.5 28 10.0 29 14.5 30 16.5 31 32.0 32 51.5 33 57.5 34 59.5 35 76.5 36 110.0 37 121.5 38 145.5 39 176.5 40 187.5 41 221.5 42 254.5 43 262.5 44 262.5 45 259.0 46 268.5 47 251.0 48 214.0 49 185.5 50 153.5 51 130.0 52 109.5 53 91.5 54 67.0 55 45.0 56 36.5 57 23.5 58 16.0 59 14.5 60 11.5 61 9.0 62 5.0 63 4.0 64 3.5 65 4.0 66 2.0 67 2.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.5499999999999998 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTACA 10 0.0064622764 147.66667 1 AGCAGGG 10 0.0069772652 143.975 6 AAAACCT 10 0.0069772652 143.975 3 AAAAAAA 25 5.1887287E-4 28.795002 110-114 >>END_MODULE SRR3727120 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65175 34.0 31.0 34.0 30.0 34.0 2 31.771 34.0 31.0 34.0 30.0 34.0 3 31.87425 34.0 31.0 34.0 30.0 34.0 4 35.243 37.0 37.0 37.0 35.0 37.0 5 35.19525 37.0 37.0 37.0 35.0 37.0 6 35.04025 37.0 36.0 37.0 33.0 37.0 7 35.19525 37.0 37.0 37.0 35.0 37.0 8 35.14625 37.0 37.0 37.0 35.0 37.0 9 36.83025 39.0 38.0 39.0 35.0 39.0 10-14 37.00035 39.4 38.0 39.4 33.8 39.4 15-19 38.1653 41.0 39.0 41.0 34.8 41.0 20-24 38.14275 41.0 39.0 41.0 34.4 41.0 25-29 37.998850000000004 40.6 39.0 41.0 34.2 41.0 30-34 37.713100000000004 40.0 38.0 41.0 33.6 41.0 35-39 37.44279999999999 40.0 38.0 41.0 33.0 41.0 40-44 37.055099999999996 40.0 38.0 41.0 31.8 41.0 45-49 36.734500000000004 40.0 37.0 41.0 30.8 41.0 50-54 36.3096 39.2 36.8 40.2 30.8 40.6 55-59 36.2127 39.0 36.0 41.0 29.6 41.0 60-64 36.38485 39.0 36.0 41.0 31.2 41.0 65-69 35.558800000000005 38.0 35.0 40.4 29.8 41.0 70-74 34.6352 36.6 35.0 39.0 29.4 40.6 75-79 33.52835 35.4 34.0 37.2 28.8 39.0 80-84 32.60935 35.0 34.0 36.0 26.8 37.2 85-89 31.907050000000005 35.0 33.4 35.2 25.6 36.2 90-94 31.5512 35.0 33.0 35.0 25.0 35.6 95-99 31.170949999999998 34.8 32.6 35.0 23.6 35.0 100-104 30.92935 34.8 32.0 35.0 22.0 35.0 105-109 30.6729 34.0 32.0 35.0 19.6 35.0 110-114 30.375800000000005 34.0 31.2 35.0 18.4 35.0 115-119 29.950149999999997 34.0 30.8 35.0 15.2 35.0 120-124 29.47815 34.0 30.0 35.0 8.2 35.0 125-129 28.645699999999998 33.8 29.0 35.0 2.6 35.0 130-134 28.26985 34.0 28.6 35.0 2.0 35.0 135-139 27.326100000000004 33.0 25.8 35.0 2.0 35.0 140-144 26.52155 32.4 24.6 34.2 2.0 35.0 145-149 25.099 32.0 17.2 34.0 2.0 35.0 150 21.198 27.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 115.0 3 12.0 4 8.0 5 3.0 6 5.0 7 5.0 8 8.0 9 6.0 10 3.0 11 5.0 12 5.0 13 11.0 14 12.0 15 8.0 16 12.0 17 11.0 18 18.0 19 10.0 20 9.0 21 11.0 22 21.0 23 20.0 24 25.0 25 33.0 26 45.0 27 63.0 28 48.0 29 81.0 30 87.0 31 105.0 32 131.0 33 227.0 34 336.0 35 572.0 36 1153.0 37 769.0 38 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.72090112640801 16.77096370463079 14.618272841051313 31.889862327909885 2 22.25 22.6 38.525 16.625 3 20.275000000000002 25.3 32.324999999999996 22.1 4 23.75 34.949999999999996 22.425 18.875 5 22.725 37.724999999999994 21.55 18.0 6 18.525 37.8 24.5 19.175 7 16.900000000000002 15.15 45.425 22.525000000000002 8 20.65 21.05 27.625 30.675 9 23.0 21.95 29.2 25.85 10-14 22.384999999999998 27.52 27.889999999999997 22.205 15-19 22.455 27.465 28.694999999999997 21.385 20-24 22.770000000000003 27.51 27.955000000000002 21.765 25-29 22.8 27.384999999999998 28.634999999999998 21.18 30-34 22.525000000000002 28.005000000000003 28.605000000000004 20.865000000000002 35-39 23.080000000000002 27.43 28.634999999999998 20.855 40-44 22.805 27.575 28.665000000000003 20.955 45-49 23.385 27.589999999999996 28.225 20.8 50-54 22.86 27.755000000000003 28.410000000000004 20.974999999999998 55-59 23.43 27.155 28.27 21.145 60-64 22.79 27.279999999999998 28.82 21.11 65-69 22.919999999999998 27.725 28.425 20.93 70-74 23.044999999999998 27.565 28.68 20.71 75-79 22.994999999999997 27.42 28.83 20.755000000000003 80-84 22.830000000000002 27.965 28.32 20.885 85-89 23.43 28.32 28.025 20.225 90-94 22.98229822982298 27.817781778177817 28.582858285828582 20.617061706170617 95-99 23.332333233323332 27.322732273227324 28.85788578857886 20.487048704870485 100-104 23.46 28.044999999999998 28.305000000000003 20.19 105-109 23.285 27.115000000000002 28.775000000000002 20.825 110-114 23.355 27.61 28.655 20.380000000000003 115-119 23.375 27.644999999999996 28.235 20.745 120-124 23.055 28.365000000000002 27.975 20.605 125-129 23.93 27.605 28.139999999999997 20.325 130-134 24.15795005254992 27.20584555327561 28.326910565036783 20.30929382913768 135-139 23.54531797696545 27.931897846770156 27.926890335503256 20.595893840761143 140-144 24.168836370919287 27.688764269977966 28.149409172841978 19.992990186260766 145-149 24.545591107105302 28.08572430023534 27.590005507986582 19.778679084672778 150 25.61342013019529 26.91537305958938 26.489734601902853 20.981472208312468 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.5 14 1.0 15 1.5 16 2.5 17 1.5 18 3.0 19 3.5 20 1.5 21 3.0 22 3.5 23 5.0 24 5.0 25 3.0 26 4.5 27 6.5 28 10.0 29 14.5 30 15.0 31 20.0 32 29.0 33 42.5 34 60.0 35 67.5 36 72.0 37 94.0 38 130.0 39 160.0 40 181.5 41 209.5 42 255.5 43 260.0 44 251.0 45 276.5 46 269.5 47 245.0 48 252.5 49 227.5 50 175.0 51 134.5 52 108.5 53 93.0 54 71.5 55 54.0 56 40.5 57 31.5 58 25.0 59 21.5 60 11.0 61 7.5 62 9.5 63 7.0 64 5.0 65 2.5 66 2.0 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.095 135-139 0.15 140-144 0.13999999999999999 145-149 0.145 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9625 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCTT 10 0.0070045046 143.7875 9 CTGGAAA 10 0.0070045046 143.7875 6 TGAAAAT 20 3.7096016E-4 107.84063 1 >>END_MODULE Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266461 spots for SRR3727120.sra Written 1266461 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra Read 1266447 spots for SRR3727120.sra Written 1266447 spots for SRR3727120.sra SRR ids: ['SRR3727120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e8tbnvh8 SRR3727120.sra spots: 25328954 blocks: [[1, 1266447], [1266448, 2532894], [2532895, 3799341], [3799342, 5065788], [5065789, 6332235], [6332236, 7598682], [7598683, 8865129], [8865130, 10131576], [10131577, 11398023], [11398024, 12664470], [12664471, 13930917], [13930918, 15197364], [15197365, 16463811], [16463812, 17730258], [17730259, 18996705], [18996706, 20263152], [20263153, 21529599], [21529600, 22796046], [22796047, 24062493], [24062494, 25328954]] SRR3727120 file size 8511980 SRR3727120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727120 SRR3727120_1.fastq SRR3727120_2.fastq Input file: SRR3727120_1.fastq Paired file: SRR3727120_2.fastq trimmed: SRR3727120-trimmed-pair1.fastq, SRR3727120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:45:22 2025 >> started Fri Feb 14 08:45:57 2025 >> done (34.430s) 25328954 read pairs processed; of these: 133502 ( 0.53%) short read pairs filtered out after trimming by size control 594641 ( 2.35%) empty read pairs filtered out after trimming by size control 24600811 (97.13%) read pairs available; of these: 12219163 (49.67%) trimmed read pairs available after processing 12381648 (50.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 6 0.00% 21 15 0.00% 22 31 0.00% 23 32 0.00% 24 49 0.00% 25 66 0.00% 26 75 0.00% 27 108 0.00% 28 128 0.00% 29 159 0.00% 30 188 0.00% 31 210 0.00% 32 259 0.00% 33 298 0.00% 34 358 0.00% 35 381 0.00% 36 425 0.00% 37 488 0.00% 38 578 0.00% 39 643 0.00% 40 748 0.00% 41 764 0.00% 42 863 0.00% 43 905 0.00% 44 980 0.00% 45 1154 0.00% 46 1237 0.01% 47 1232 0.01% 48 1389 0.01% 49 1455 0.01% 50 1564 0.01% 51 1693 0.01% 52 1749 0.01% 53 1876 0.01% 54 2022 0.01% 55 2162 0.01% 56 2182 0.01% 57 2333 0.01% 58 2375 0.01% 59 2606 0.01% 60 2746 0.01% 61 2861 0.01% 62 3106 0.01% 63 3221 0.01% 64 3529 0.01% 65 3552 0.01% 66 3802 0.02% 67 3941 0.02% 68 4268 0.02% 69 4358 0.02% 70 4779 0.02% 71 5078 0.02% 72 5231 0.02% 73 5489 0.02% 74 6024 0.02% 75 6364 0.03% 76 6822 0.03% 77 7132 0.03% 78 7712 0.03% 79 8319 0.03% 80 8988 0.04% 81 9901 0.04% 82 10597 0.04% 83 12115 0.05% 84 18377 0.07% 85 18975 0.08% 86 20232 0.08% 87 20686 0.08% 88 21333 0.09% 89 22295 0.09% 90 23026 0.09% 91 23915 0.10% 92 24707 0.10% 93 24999 0.10% 94 26217 0.11% 95 27557 0.11% 96 29146 0.12% 97 30735 0.12% 98 29880 0.12% 99 30846 0.13% 100 31749 0.13% 101 30823 0.13% 102 33768 0.14% 103 36203 0.15% 104 41518 0.17% 105 36396 0.15% 106 35603 0.14% 107 38440 0.16% 108 41720 0.17% 109 40041 0.16% 110 41279 0.17% 111 41871 0.17% 112 41567 0.17% 113 39621 0.16% 114 43432 0.18% 115 65466 0.27% 116 51067 0.21% 117 49265 0.20% 118 49928 0.20% 119 57578 0.23% 120 71808 0.29% 121 64380 0.26% 122 56542 0.23% 123 57680 0.23% 124 61909 0.25% 125 69865 0.28% 126 71412 0.29% 127 79502 0.32% 128 106869 0.43% 129 95707 0.39% 130 95182 0.39% 131 109478 0.45% 132 122159 0.50% 133 125327 0.51% 134 144659 0.59% 135 151248 0.61% 136 173704 0.71% 137 185796 0.76% 138 208827 0.85% 139 230678 0.94% 140 242941 0.99% 141 264017 1.07% 142 300763 1.22% 143 349210 1.42% 144 408180 1.66% 145 488992 1.99% 146 638500 2.60% 147 883242 3.59% 148 1325863 5.39% 149 3618735 14.71% 150 12381648 50.33% 24600811 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.5 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=173.59 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=21.6 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=14.24 fanout-score-rank=11 prefix-density=0.30 prefix-fanout=6.5 sequence=GAGCTTGAAGCTGATCTCCTCATCTTTAATGATGAACTGTCGCCAAGTCAGCTGAAGTCATTGGCAACAGCAATTGAAGTGAAGATGATTGACCGCACGCAATTGATATTAGATATTTTTGCAAAGCGGGCGAGAACGAGAGAAGGCAAACTTCAAATTGAGCTGGCTCAGCTGCAATATGCACTGCCGCGTCTGACGGGACAAGGGATCAACCTTTCCCGGCAAGGCGGAGGAATTGGGGCAAGAGGTCCCGGGGAAACGAAACTGGAAACCGACCGCCGCCATATCAGAAATCGCATTCATGAAATCAACACACAGCTTTCCACTGTCATTCGCCATAGAAGCCGATACCGTGAAAGAAGAAAGAAAAACGGTGTGCTTCAAATTGCGCTTGTCGGCTATACAAACGCAGGGAAATCAACATGGTTCAACCGCCTGACGAGTGCTGACAGCTATGAAGAAGAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=417.32 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=30.0 sequence=TGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGGACTATCTCCCAGACCACAATGAAAGCATATCTGTTGTTCTTGACAGGTTTGCTTCCATGGGTATTGACACCCCTGGACTGGTTGCCTTGCTAGGA SRR3727120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:46:42 Started mapping on | Feb 14 08:46:42 Finished on | Feb 14 08:50:56 Mapping speed, Million of reads per hour | 348.67 Number of input reads | 24600811 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 23413830 Uniquely mapped reads % | 95.18% Average mapped length | 288.79 Number of splices: Total | 20858012 Number of splices: Annotated (sjdb) | 20450123 Number of splices: GT/AG | 20515870 Number of splices: GC/AG | 284561 Number of splices: AT/AC | 17864 Number of splices: Non-canonical | 39717 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522790 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 37335 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 694953 694953 694953 N_multimapping 522790 522790 522790 N_noFeature 879932 23121209 1004667 N_ambiguous 295309 1422 126738 UnstrandedReadsAssigned:22238589 PositiveStrandReadsAssigned:291199 NegativeStrandReadsAssigned:22282425 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR3727120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727120-trimmed-pair1.fastq SRR3727120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,600,811 reads, 22,451,928 reads pseudoaligned [quant] estimated average fragment length: 245.087 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR3727120.ke.tsv 34699 SRR3727120.se.tsv 87100 total ==> SRR3727120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.91 632 13.9926 Potri.005G024800.1.v4.1 1035 790.913 362 17.976 Potri.004G059700.1.v4.1 961 716.947 54 2.95815 Potri.007G009000.2.v4.1 1416 1171.91 0 0 Potri.003G141000.2.v4.1 2943 2698.91 838.148 12.1968 Potri.016G087400.1.v4.1 270 74.7985 2104 1104.76 Potri.015G069301.1.v4.1 564 324.456 0 0 Potri.010G195200.1.v4.1 1773 1528.91 57 1.46422 Potri.012G127500.1.v4.1 977 732.933 8030 430.293 ==> SRR3727120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 865 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 584 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 417 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3727120 completed mapping pipeline successfully