Starting /dee2/code/volunteer_pipeline.sh SRR3727121 current disk space = 3115312910336 free memory = 1567014300 SRR3727121 SRAfilesize 20e51d9743b941a33a41f94d80e3ed22 SRR3727121.sra SRR3727121.sra file validated SRR3727121 is paired end SRR3727121 is conventional basespace SRR3727121 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3695 34.0 33.0 34.0 31.0 34.0 2 32.86425 34.0 33.0 34.0 31.0 34.0 3 33.171 34.0 34.0 34.0 31.0 34.0 4 36.57725 37.0 37.0 37.0 35.0 37.0 5 36.52 37.0 37.0 37.0 35.0 37.0 6 36.54875 37.0 37.0 37.0 35.0 37.0 7 36.5375 37.0 37.0 37.0 35.0 37.0 8 36.5315 37.0 37.0 37.0 35.0 37.0 9 38.3235 39.0 39.0 39.0 37.0 39.0 10-14 38.64555 39.4 39.2 39.4 37.2 39.4 15-19 39.8928 41.0 40.0 41.0 38.0 41.0 20-24 39.751050000000006 41.0 40.0 41.0 38.0 41.0 25-29 39.5238 41.0 39.4 41.0 37.0 41.0 30-34 39.40335 40.0 39.0 41.0 36.8 41.0 35-39 39.2402 40.0 38.8 41.0 36.4 41.0 40-44 39.0922 40.0 38.4 41.0 36.0 41.0 45-49 39.39235 41.0 39.0 41.0 36.6 41.0 50-54 39.05499999999999 40.0 38.6 41.0 35.6 41.0 55-59 38.606 40.0 38.0 41.0 35.0 41.0 60-64 38.077 39.6 36.8 41.0 34.0 41.0 65-69 37.344449999999995 38.6 35.6 40.4 33.6 41.0 70-74 36.1995 36.8 35.0 39.2 32.4 40.8 75-79 34.86305 35.2 34.0 37.4 31.0 39.2 80-84 34.48285 35.0 34.0 36.4 31.6 37.6 85-89 33.840700000000005 35.0 34.0 35.4 31.0 36.4 90-94 33.2864 35.0 34.0 35.0 30.2 35.8 95-99 32.805949999999996 35.0 33.2 35.0 29.0 35.0 100-104 32.5202 35.0 33.0 35.0 28.6 35.0 105-109 32.215700000000005 34.6 32.6 35.0 27.2 35.0 110-114 31.3986 34.2 31.4 35.0 25.2 35.0 115-119 31.49835 34.0 31.8 35.0 24.4 35.0 120-124 31.172049999999995 34.0 31.2 35.0 24.6 35.0 125-129 30.504550000000002 34.0 30.6 35.0 21.8 35.0 130-134 30.063650000000003 34.0 30.2 35.0 19.4 35.0 135-139 27.809049999999996 33.0 26.2 35.0 5.6 35.0 140-144 27.1421 32.8 25.0 34.8 2.0 35.0 145-149 24.647 31.4 12.4 34.0 2.0 35.0 150 18.673 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 2.0 9 2.0 10 1.0 11 0.0 12 8.0 13 2.0 14 3.0 15 6.0 16 5.0 17 5.0 18 8.0 19 4.0 20 13.0 21 11.0 22 9.0 23 18.0 24 31.0 25 19.0 26 33.0 27 46.0 28 65.0 29 69.0 30 90.0 31 124.0 32 170.0 33 250.0 34 366.0 35 666.0 36 1174.0 37 789.0 38 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.230769230769226 18.69230769230769 12.743589743589745 36.333333333333336 2 19.15 27.275 37.325 16.25 3 16.775000000000002 30.349999999999998 27.950000000000003 24.925 4 20.825 37.3 21.4 20.474999999999998 5 20.3 39.925 21.875 17.9 6 16.575 36.375 25.224999999999998 21.825 7 13.700000000000001 19.625 44.574999999999996 22.1 8 18.55 20.200000000000003 28.65 32.6 9 18.075 21.55 31.525 28.849999999999998 10-14 19.445 30.705 25.564999999999998 24.285 15-19 19.81 28.804999999999996 27.224999999999998 24.16 20-24 20.200000000000003 28.915000000000003 27.325 23.56 25-29 20.51 28.925 27.310000000000002 23.255 30-34 20.18 29.160000000000004 26.935 23.724999999999998 35-39 20.085 29.585 26.840000000000003 23.49 40-44 20.419999999999998 29.215000000000003 27.11 23.255 45-49 20.125 28.994999999999997 27.584999999999997 23.294999999999998 50-54 20.810000000000002 28.384999999999998 26.974999999999998 23.830000000000002 55-59 20.255000000000003 28.73 27.36 23.655 60-64 20.78 28.884999999999998 27.345000000000002 22.99 65-69 20.715 28.165000000000003 27.22 23.9 70-74 20.96 28.09 27.505000000000003 23.445 75-79 20.919999999999998 28.1 27.365000000000002 23.615 80-84 20.46 29.13 27.215 23.195 85-89 20.93 28.875 27.08 23.115 90-94 20.95 28.49 27.195000000000004 23.365 95-99 21.23 28.410000000000004 27.22 23.14 100-104 21.17 28.199999999999996 26.729999999999997 23.9 105-109 21.36 27.965 27.005000000000003 23.669999999999998 110-114 21.015 28.475 27.355 23.155 115-119 21.015 28.23 27.175 23.580000000000002 120-124 21.465 27.775 27.265 23.494999999999997 125-129 20.87 27.93 27.235 23.965 130-134 21.055 27.96 27.860000000000003 23.125 135-139 20.515 28.544999999999998 27.655 23.285 140-144 21.6 28.07 26.86 23.47 145-149 21.485000000000003 28.615000000000002 26.16 23.74 150 9.15 37.0 26.775 27.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 4.5 25 5.0 26 6.5 27 9.0 28 12.0 29 18.0 30 20.0 31 32.0 32 43.5 33 43.0 34 62.0 35 78.5 36 89.0 37 119.5 38 135.5 39 155.0 40 179.0 41 201.0 42 231.0 43 241.5 44 255.0 45 263.0 46 261.5 47 254.0 48 235.5 49 202.0 50 171.5 51 151.0 52 119.0 53 92.0 54 71.5 55 58.0 56 43.5 57 32.5 58 27.5 59 18.5 60 12.0 61 11.0 62 9.0 63 4.5 64 6.0 65 4.5 66 0.0 67 0.5 68 0.5 69 0.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0125 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.575 0.0 0.0 0.0 0.0 132-133 0.6499999999999999 0.0 0.0 0.0 0.0 134-135 0.8999999999999999 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAAAA 10 0.0064622764 147.66667 1 GCCCAGG 10 0.0069772652 143.975 9 >>END_MODULE SRR3727121 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94575 34.0 31.0 34.0 31.0 34.0 2 32.108 34.0 31.0 34.0 31.0 34.0 3 32.12175 34.0 31.0 34.0 31.0 34.0 4 35.5025 37.0 37.0 37.0 35.0 37.0 5 35.49125 37.0 37.0 37.0 35.0 37.0 6 35.3985 37.0 37.0 37.0 35.0 37.0 7 35.49125 37.0 37.0 37.0 35.0 37.0 8 35.50875 37.0 37.0 37.0 35.0 37.0 9 37.214 39.0 38.0 39.0 35.0 39.0 10-14 37.48649999999999 39.4 38.6 39.4 35.2 39.4 15-19 38.65185 41.0 39.8 41.0 36.0 41.0 20-24 38.58475 41.0 39.0 41.0 36.0 41.0 25-29 38.2742 40.6 38.8 41.0 35.0 41.0 30-34 38.042649999999995 40.0 38.4 41.0 34.6 41.0 35-39 37.775400000000005 40.0 38.0 41.0 33.6 41.0 40-44 37.47145 40.0 38.0 41.0 33.0 41.0 45-49 37.08645 40.0 37.2 41.0 32.0 41.0 50-54 36.457899999999995 39.0 36.8 40.2 31.0 40.6 55-59 36.56095 39.0 36.2 40.8 31.4 41.0 60-64 36.5347 39.0 36.0 41.0 31.8 41.0 65-69 35.864850000000004 38.0 35.0 40.4 31.2 41.0 70-74 34.5143 36.4 34.4 38.8 29.2 40.4 75-79 33.582899999999995 35.2 34.0 37.2 28.6 39.0 80-84 32.549400000000006 35.0 33.6 35.8 26.8 37.2 85-89 32.24745 35.0 33.6 35.0 27.4 36.2 90-94 31.880450000000003 35.0 33.0 35.0 27.0 35.4 95-99 31.340750000000003 35.0 32.2 35.0 24.8 35.0 100-104 31.3022 35.0 32.4 35.0 24.6 35.0 105-109 31.00065 34.4 32.2 35.0 24.0 35.0 110-114 30.0554 34.0 30.8 35.0 18.2 35.0 115-119 29.833599999999997 34.0 30.2 35.0 17.4 35.0 120-124 29.4617 34.0 29.8 35.0 12.4 35.0 125-129 28.5962 33.2 28.6 35.0 6.6 35.0 130-134 28.624399999999998 33.8 29.0 35.0 2.0 35.0 135-139 27.21015 32.4 25.0 34.2 2.0 35.0 140-144 26.3154 31.6 24.2 34.0 2.0 35.0 145-149 24.97635 31.0 19.8 34.0 2.0 35.0 150 21.53625 27.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 97.0 3 8.0 4 5.0 5 2.0 6 2.0 7 2.0 8 7.0 9 6.0 10 4.0 11 6.0 12 7.0 13 9.0 14 11.0 15 15.0 16 11.0 17 12.0 18 13.0 19 12.0 20 10.0 21 14.0 22 24.0 23 19.0 24 16.0 25 31.0 26 36.0 27 36.0 28 53.0 29 66.0 30 98.0 31 125.0 32 163.0 33 239.0 34 352.0 35 713.0 36 1142.0 37 629.0 38 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 15.85 13.225000000000001 32.65 2 22.275 22.2 38.125 17.4 3 19.55 25.624999999999996 31.95 22.875 4 23.3 36.199999999999996 20.625 19.875 5 23.525 36.4 20.45 19.625 6 16.025 37.325 24.8 21.85 7 17.1 15.4 44.6 22.900000000000002 8 20.025000000000002 21.025 27.450000000000003 31.5 9 21.475 23.525 28.275 26.724999999999998 10-14 21.935 29.005 27.125 21.935 15-19 22.869999999999997 27.565 27.815 21.75 20-24 22.765 28.105000000000004 26.900000000000002 22.23 25-29 22.439999999999998 28.165000000000003 27.495000000000005 21.9 30-34 22.475 27.634999999999998 27.029999999999998 22.86 35-39 22.59 28.12 27.27 22.02 40-44 23.1 27.779999999999998 27.3 21.82 45-49 23.055 27.785 27.725 21.435000000000002 50-54 23.135 27.175 27.834999999999997 21.855 55-59 23.150000000000002 27.250000000000004 27.49 22.11 60-64 22.759999999999998 27.515 27.77 21.955 65-69 22.37 28.15 27.485 21.995 70-74 22.85 27.500000000000004 27.700000000000003 21.95 75-79 22.71 27.67 27.860000000000003 21.759999999999998 80-84 23.425 27.694999999999997 27.355 21.525 85-89 22.67 27.639999999999997 27.955000000000002 21.735 90-94 23.150000000000002 28.249999999999996 27.889999999999997 20.71 95-99 23.205000000000002 27.775 28.189999999999998 20.830000000000002 100-104 23.34 27.605 27.685 21.37 105-109 23.285 27.605 28.055000000000003 21.055 110-114 23.255 27.944999999999997 27.3 21.5 115-119 23.525 27.52 27.71 21.245 120-124 23.155 27.485 27.91 21.45 125-129 23.659195517310387 27.04622773664199 28.031819091454874 21.262757654592757 130-134 23.06 27.21 28.675 21.055 135-139 23.265 27.63 28.175 20.93 140-144 23.61 28.355000000000004 27.485 20.549999999999997 145-149 24.25 27.955000000000002 27.155 20.64 150 24.025 28.625 26.400000000000002 20.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.5 8 1.0 9 1.0 10 0.5 11 1.0 12 1.5 13 1.0 14 1.0 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 2.0 21 3.5 22 2.0 23 2.5 24 3.5 25 4.0 26 4.0 27 4.5 28 8.5 29 14.5 30 17.5 31 18.0 32 20.5 33 29.5 34 36.5 35 52.5 36 78.5 37 97.0 38 116.0 39 140.5 40 169.5 41 204.5 42 219.0 43 230.0 44 262.0 45 293.5 46 294.0 47 264.5 48 241.0 49 213.0 50 175.5 51 146.5 52 125.5 53 105.0 54 91.0 55 71.0 56 48.5 57 42.0 58 36.5 59 24.0 60 19.5 61 16.5 62 9.0 63 6.0 64 4.5 65 3.0 66 2.5 67 2.0 68 2.0 69 2.0 70 1.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.06 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0125 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.037500000000000006 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAA 10 0.006973645 144.0 6 TACAAGA 10 0.006973645 144.0 9 CACTCAG 10 0.006973645 144.0 4 TCACTCA 10 0.006973645 144.0 3 >>END_MODULE Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533314 spots for SRR3727121.sra Written 533314 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra Read 533311 spots for SRR3727121.sra Written 533311 spots for SRR3727121.sra SRR ids: ['SRR3727121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__a7dbkxn SRR3727121.sra spots: 10666223 blocks: [[1, 533311], [533312, 1066622], [1066623, 1599933], [1599934, 2133244], [2133245, 2666555], [2666556, 3199866], [3199867, 3733177], [3733178, 4266488], [4266489, 4799799], [4799800, 5333110], [5333111, 5866421], [5866422, 6399732], [6399733, 6933043], [6933044, 7466354], [7466355, 7999665], [7999666, 8532976], [8532977, 9066287], [9066288, 9599598], [9599599, 10132909], [10132910, 10666223]] SRR3727121 file size 3571900 SRR3727121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727121 SRR3727121_1.fastq SRR3727121_2.fastq Input file: SRR3727121_1.fastq Paired file: SRR3727121_2.fastq trimmed: SRR3727121-trimmed-pair1.fastq, SRR3727121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:41:02 2025 >> started Fri Feb 14 10:41:13 2025 >> done (11.279s) 10666223 read pairs processed; of these: 42781 ( 0.40%) short read pairs filtered out after trimming by size control 215139 ( 2.02%) empty read pairs filtered out after trimming by size control 10408303 (97.58%) read pairs available; of these: 4469018 (42.94%) trimmed read pairs available after processing 5939285 (57.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 15 0.00% 23 14 0.00% 24 14 0.00% 25 13 0.00% 26 26 0.00% 27 27 0.00% 28 34 0.00% 29 46 0.00% 30 48 0.00% 31 62 0.00% 32 73 0.00% 33 81 0.00% 34 80 0.00% 35 102 0.00% 36 97 0.00% 37 126 0.00% 38 130 0.00% 39 150 0.00% 40 142 0.00% 41 168 0.00% 42 189 0.00% 43 227 0.00% 44 193 0.00% 45 248 0.00% 46 267 0.00% 47 266 0.00% 48 291 0.00% 49 289 0.00% 50 344 0.00% 51 357 0.00% 52 366 0.00% 53 393 0.00% 54 435 0.00% 55 430 0.00% 56 468 0.00% 57 476 0.00% 58 518 0.00% 59 529 0.01% 60 527 0.01% 61 566 0.01% 62 620 0.01% 63 682 0.01% 64 783 0.01% 65 758 0.01% 66 832 0.01% 67 868 0.01% 68 896 0.01% 69 999 0.01% 70 977 0.01% 71 1131 0.01% 72 1168 0.01% 73 1216 0.01% 74 1256 0.01% 75 1403 0.01% 76 1470 0.01% 77 1580 0.02% 78 1788 0.02% 79 1828 0.02% 80 2078 0.02% 81 2118 0.02% 82 2449 0.02% 83 3001 0.03% 84 5656 0.05% 85 5779 0.06% 86 6035 0.06% 87 6556 0.06% 88 6326 0.06% 89 6561 0.06% 90 6915 0.07% 91 7116 0.07% 92 7332 0.07% 93 7491 0.07% 94 7707 0.07% 95 8033 0.08% 96 8001 0.08% 97 8158 0.08% 98 8249 0.08% 99 8839 0.08% 100 8370 0.08% 101 8553 0.08% 102 8970 0.09% 103 8879 0.09% 104 9232 0.09% 105 9950 0.10% 106 9772 0.09% 107 11168 0.11% 108 12272 0.12% 109 13315 0.13% 110 11542 0.11% 111 11819 0.11% 112 14478 0.14% 113 13157 0.13% 114 14792 0.14% 115 31160 0.30% 116 14571 0.14% 117 15339 0.15% 118 13903 0.13% 119 14121 0.14% 120 13697 0.13% 121 13849 0.13% 122 13745 0.13% 123 14731 0.14% 124 16490 0.16% 125 17203 0.17% 126 17297 0.17% 127 17547 0.17% 128 18709 0.18% 129 20454 0.20% 130 21877 0.21% 131 24181 0.23% 132 29824 0.29% 133 40532 0.39% 134 42937 0.41% 135 43604 0.42% 136 63789 0.61% 137 68191 0.66% 138 69492 0.67% 139 77867 0.75% 140 81236 0.78% 141 94697 0.91% 142 107457 1.03% 143 125217 1.20% 144 146039 1.40% 145 173338 1.67% 146 224120 2.15% 147 311783 3.00% 148 477590 4.59% 149 1672669 16.07% 150 5939285 57.06% 10408303 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.4 sequence=AACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACT criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=384.56 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=35.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.22 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=106.64 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.7 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCT SRR3727121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:42:03 Started mapping on | Feb 14 10:42:03 Finished on | Feb 14 10:43:16 Mapping speed, Million of reads per hour | 513.29 Number of input reads | 10408303 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 9813588 Uniquely mapped reads % | 94.29% Average mapped length | 292.14 Number of splices: Total | 9106405 Number of splices: Annotated (sjdb) | 8942939 Number of splices: GT/AG | 8941066 Number of splices: GC/AG | 140278 Number of splices: AT/AC | 6979 Number of splices: Non-canonical | 18082 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307833 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 20609 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298852 298852 298852 N_multimapping 307833 307833 307833 N_noFeature 260305 9693852 318184 N_ambiguous 112990 616 50716 UnstrandedReadsAssigned:9440293 PositiveStrandReadsAssigned:119120 NegativeStrandReadsAssigned:9444688 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727121-trimmed-pair1.fastq SRR3727121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,408,303 reads, 9,595,889 reads pseudoaligned [quant] estimated average fragment length: 249.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR3727121.ke.tsv 34699 SRR3727121.se.tsv 87100 total ==> SRR3727121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.07 211 10.5306 Potri.005G024800.1.v4.1 1035 786.073 33 3.70653 Potri.004G059700.1.v4.1 961 712.119 21 2.60366 Potri.007G009000.2.v4.1 1416 1167.07 5 0.378259 Potri.003G141000.2.v4.1 2943 2694.07 219 7.17714 Potri.016G087400.1.v4.1 270 74.7455 746 881.192 Potri.015G069301.1.v4.1 564 321.087 0 0 Potri.010G195200.1.v4.1 1773 1524.07 3 0.173793 Potri.012G127500.1.v4.1 977 728.109 1726 209.296 ==> SRR3727121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 161 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 235 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3727121 completed mapping pipeline successfully