Starting /dee2/code/volunteer_pipeline.sh SRR3727122 current disk space = 3115023347712 free memory = 1561409244 SRR3727122 SRAfilesize ad8bc5f5f2c23f0ba17f3cf61500d8f9 SRR3727122.sra SRR3727122.sra file validated SRR3727122 is paired end SRR3727122 is conventional basespace SRR3727122 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60625 34.0 31.0 34.0 31.0 34.0 2 32.221 34.0 31.0 34.0 31.0 34.0 3 32.82525 34.0 31.0 34.0 31.0 34.0 4 36.31225 37.0 37.0 37.0 35.0 37.0 5 36.00575 37.0 35.0 37.0 35.0 37.0 6 36.23025 37.0 36.0 37.0 35.0 37.0 7 36.33225 37.0 37.0 37.0 35.0 37.0 8 36.21325 37.0 37.0 37.0 35.0 37.0 9 38.05525 39.0 39.0 39.0 35.0 39.0 10-14 38.18385 39.4 38.2 39.4 35.2 39.4 15-19 39.32015 40.8 38.8 41.0 36.2 41.0 20-24 39.216150000000006 40.4 39.0 41.0 36.0 41.0 25-29 38.8569 40.0 38.2 41.0 35.2 41.0 30-34 38.75750000000001 40.0 38.2 41.0 35.2 41.0 35-39 38.6903 40.0 38.0 41.0 34.8 41.0 40-44 38.71915 40.0 38.0 41.0 35.0 41.0 45-49 38.43204999999999 40.0 38.0 41.0 34.0 41.0 50-54 38.61615 40.0 38.0 41.0 34.4 41.0 55-59 38.211850000000005 40.0 37.4 41.0 33.6 41.0 60-64 37.72385 39.4 36.6 41.0 33.0 41.0 65-69 37.06945 38.6 35.6 40.4 32.2 41.0 70-74 35.97865 36.8 35.0 39.2 31.2 40.8 75-79 34.503049999999995 35.2 33.8 37.2 29.8 39.2 80-84 34.15925 35.0 34.0 36.4 30.2 37.6 85-89 33.28165 35.0 33.4 35.2 29.2 36.4 90-94 32.7884 35.0 33.0 35.0 28.8 35.8 95-99 32.545 35.0 33.0 35.0 28.8 35.0 100-104 32.43025 35.0 33.0 35.0 28.2 35.0 105-109 31.7406 34.0 32.0 35.0 25.0 35.0 110-114 31.732550000000003 34.0 32.0 35.0 25.4 35.0 115-119 31.2349 34.0 31.2 35.0 24.6 35.0 120-124 30.811 34.0 31.0 35.0 22.8 35.0 125-129 30.201800000000002 34.0 30.0 35.0 19.4 35.0 130-134 29.296499999999998 34.0 29.4 35.0 13.6 35.0 135-139 27.759149999999998 33.0 26.2 35.0 3.6 35.0 140-144 26.11115 32.0 22.6 34.2 2.0 35.0 145-149 23.1744 30.8 7.0 34.0 2.0 35.0 150 17.163 19.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 3.0 10 4.0 11 2.0 12 3.0 13 6.0 14 6.0 15 6.0 16 7.0 17 9.0 18 5.0 19 12.0 20 13.0 21 19.0 22 18.0 23 33.0 24 32.0 25 26.0 26 47.0 27 52.0 28 71.0 29 110.0 30 112.0 31 145.0 32 174.0 33 277.0 34 397.0 35 651.0 36 1059.0 37 693.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.88865764828304 18.10613943808533 10.874089490114464 34.13111342351717 2 17.1 27.250000000000004 38.1 17.549999999999997 3 16.400000000000002 30.925000000000004 26.8 25.874999999999996 4 20.25 37.8 20.674999999999997 21.275 5 20.549999999999997 38.175 22.375 18.9 6 15.8 36.925000000000004 24.575 22.7 7 13.225000000000001 19.025 47.55 20.200000000000003 8 17.525 19.0 29.425 34.050000000000004 9 17.95 21.099999999999998 30.099999999999998 30.85 10-14 19.91 29.995 26.590000000000003 23.505000000000003 15-19 19.683857735981192 28.537842028913012 28.122655194837677 23.65564504026812 20-24 19.485 27.875 28.689999999999998 23.95 25-29 19.67 28.945 27.694999999999997 23.69 30-34 19.865 28.794999999999998 27.810000000000002 23.53 35-39 20.035 28.299999999999997 28.115000000000002 23.549999999999997 40-44 19.919999999999998 28.970000000000002 27.750000000000004 23.36 45-49 20.535 28.22 27.400000000000002 23.845 50-54 20.119999999999997 28.42 28.04 23.419999999999998 55-59 20.54 28.994999999999997 27.400000000000002 23.064999999999998 60-64 20.080000000000002 28.939999999999998 27.525 23.455000000000002 65-69 20.330000000000002 28.110000000000003 27.665 23.895 70-74 20.62 28.765 27.145000000000003 23.47 75-79 20.48 28.075 28.205000000000002 23.24 80-84 20.32 28.389999999999997 27.675 23.615 85-89 20.544999999999998 28.134999999999998 27.839999999999996 23.48 90-94 20.235 28.294999999999998 28.04 23.43 95-99 20.665 28.449999999999996 27.58 23.305 100-104 21.07 28.24 27.3 23.39 105-109 20.715 28.904999999999998 27.36 23.02 110-114 20.65 28.26 27.560000000000002 23.53 115-119 20.605 29.125 27.084999999999997 23.185 120-124 21.029999999999998 28.105000000000004 27.46 23.405 125-129 21.39 28.134999999999998 27.405 23.07 130-134 20.849999999999998 28.4 27.54 23.21 135-139 19.8 28.685 27.389999999999997 24.125 140-144 19.715 28.470000000000002 27.889999999999997 23.925 145-149 18.69 28.655 28.265 24.39 150 8.225 33.15 28.925 29.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 2.0 23 2.5 24 1.5 25 3.0 26 7.5 27 10.5 28 9.5 29 16.5 30 21.5 31 20.5 32 30.5 33 46.5 34 58.5 35 74.0 36 93.5 37 115.0 38 135.0 39 161.0 40 207.5 41 237.0 42 251.0 43 265.5 44 270.0 45 265.0 46 255.5 47 254.0 48 241.0 49 204.0 50 157.5 51 127.0 52 111.0 53 78.5 54 60.5 55 59.5 56 43.0 57 26.5 58 19.5 59 14.0 60 11.5 61 9.0 62 7.5 63 7.5 64 2.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.045 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 3.0 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAACC 10 0.0069772652 143.975 2 >>END_MODULE SRR3727122 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.224 33.0 31.0 34.0 30.0 34.0 2 31.3255 34.0 31.0 34.0 30.0 34.0 3 31.482 34.0 31.0 34.0 30.0 34.0 4 34.8655 37.0 35.0 37.0 33.0 37.0 5 34.8045 37.0 35.0 37.0 33.0 37.0 6 34.6055 37.0 35.0 37.0 32.0 37.0 7 34.815 37.0 35.0 37.0 33.0 37.0 8 34.76725 37.0 35.0 37.0 33.0 37.0 9 36.44425 39.0 38.0 39.0 33.0 39.0 10-14 36.5988 39.2 37.4 39.4 33.0 39.4 15-19 37.663349999999994 40.8 38.2 41.0 33.0 41.0 20-24 37.706100000000006 40.2 38.4 41.0 33.6 41.0 25-29 37.544349999999994 40.0 38.0 41.0 33.4 41.0 30-34 37.2216 40.0 38.0 41.0 32.4 41.0 35-39 36.8981 40.0 38.0 41.0 31.2 41.0 40-44 36.4354 40.0 37.0 41.0 30.2 41.0 45-49 36.19735000000001 39.6 36.8 41.0 30.0 41.0 50-54 35.727549999999994 39.0 35.8 40.0 29.2 40.6 55-59 35.683800000000005 39.0 35.6 40.2 28.2 41.0 60-64 35.8801 39.0 35.8 41.0 29.2 41.0 65-69 35.05645 37.8 35.0 40.2 28.4 41.0 70-74 34.1262 36.4 34.4 39.0 27.8 40.6 75-79 32.9548 35.2 33.8 37.0 26.0 39.0 80-84 32.1683 35.0 33.0 36.0 25.8 37.2 85-89 31.538249999999998 35.0 32.6 35.0 24.6 36.2 90-94 31.085900000000002 35.0 32.0 35.0 23.6 35.4 95-99 30.707299999999996 34.2 31.6 35.0 20.2 35.0 100-104 30.418950000000002 34.0 31.2 35.0 18.6 35.0 105-109 30.165749999999996 34.0 31.0 35.0 17.6 35.0 110-114 29.813800000000004 34.0 30.4 35.0 13.2 35.0 115-119 29.350299999999997 34.0 29.6 35.0 6.6 35.0 120-124 28.86605 34.0 29.0 35.0 2.6 35.0 125-129 28.034100000000002 33.0 27.8 35.0 2.0 35.0 130-134 27.4338 33.0 26.6 35.0 2.0 35.0 135-139 26.25755 32.0 24.2 34.0 2.0 35.0 140-144 25.3752 31.4 20.8 34.0 2.0 35.0 145-149 23.79275 31.0 8.0 34.0 2.0 35.0 150 19.75675 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 146.0 3 9.0 4 9.0 5 9.0 6 3.0 7 5.0 8 2.0 9 8.0 10 10.0 11 9.0 12 8.0 13 12.0 14 7.0 15 4.0 16 9.0 17 14.0 18 10.0 19 10.0 20 21.0 21 12.0 22 17.0 23 29.0 24 32.0 25 46.0 26 52.0 27 48.0 28 61.0 29 87.0 30 91.0 31 139.0 32 177.0 33 261.0 34 364.0 35 613.0 36 1052.0 37 609.0 38 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.56978489244622 15.057528764382191 13.081540770385192 32.2911455727864 2 21.475 23.45 38.25 16.825000000000003 3 19.925 25.424999999999997 31.525 23.125 4 25.124999999999996 35.75 19.375 19.75 5 22.400000000000002 38.675 22.225 16.7 6 17.53376688344172 39.14457228614307 23.186593296648326 20.135067533766886 7 15.85 14.299999999999999 46.45 23.400000000000002 8 19.2 20.674999999999997 28.849999999999998 31.275 9 22.425 22.1 28.725 26.75 10-14 22.13 28.854999999999997 27.474999999999998 21.54 15-19 22.220000000000002 27.965 28.18 21.634999999999998 20-24 22.314999999999998 28.084999999999997 28.215 21.385 25-29 22.175 28.035 28.494999999999997 21.295 30-34 22.31 28.625 27.860000000000003 21.205 35-39 23.04 27.894999999999996 28.685 20.380000000000003 40-44 22.415 27.894999999999996 28.405 21.285 45-49 22.03 28.249999999999996 28.425 21.295 50-54 22.33 28.110000000000003 28.705000000000002 20.855 55-59 22.797279727972796 28.457845784578456 27.87778777877788 20.86708670867087 60-64 22.41 28.194999999999997 28.544999999999998 20.849999999999998 65-69 23.11 28.73 27.439999999999998 20.72 70-74 23.111933580074023 28.20846253876163 27.518255476642995 21.16134840452136 75-79 23.042304230423042 28.02280228022802 28.372837283728376 20.562056205620564 80-84 23.117311731173118 28.332833283328334 28.227822782278228 20.32203220322032 85-89 22.85 28.050000000000004 28.33 20.77 90-94 23.37402441464879 28.131879127476484 27.78166900140084 20.712427456473883 95-99 23.138883329998 27.84170502301381 27.86672003201921 21.152691614968983 100-104 23.23 27.79 27.68 21.3 105-109 23.49 27.560000000000002 27.889999999999997 21.060000000000002 110-114 23.42436974789916 28.181272509003602 27.896158463385355 20.498199279711883 115-119 23.365 28.110000000000003 27.815 20.71 120-124 23.674999999999997 28.74 27.150000000000002 20.435 125-129 23.46 28.02 27.529999999999998 20.990000000000002 130-134 23.466319165998396 28.759021651964716 27.03488372093023 20.739775461106653 135-139 23.82575567697629 28.768359316256454 27.294601233144515 20.111283773622738 140-144 24.571428571428573 27.909774436090224 27.468671679197993 20.050125313283207 145-149 24.771884087034994 28.22119723252782 26.7422039506668 20.26471472977038 150 25.495111556781147 27.475557783905742 26.77362747555778 20.255703183755326 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.0 8 1.5 9 1.5 10 0.5 11 0.5 12 1.0 13 2.5 14 3.0 15 1.0 16 0.5 17 1.5 18 1.0 19 0.5 20 1.5 21 2.5 22 5.0 23 8.0 24 6.5 25 4.0 26 4.5 27 6.0 28 6.5 29 12.0 30 17.0 31 23.0 32 31.5 33 31.5 34 44.0 35 61.0 36 79.0 37 108.0 38 140.0 39 174.0 40 210.0 41 248.5 42 277.0 43 270.0 44 257.0 45 257.0 46 254.5 47 247.5 48 216.0 49 183.0 50 157.5 51 131.0 52 106.0 53 84.5 54 69.0 55 60.5 56 48.0 57 33.5 58 25.5 59 22.0 60 17.0 61 8.0 62 7.0 63 7.0 64 6.0 65 3.5 66 1.0 67 0.5 68 0.5 69 2.5 70 2.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.03 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.06 95-99 0.06 100-104 0.0 105-109 0.0 110-114 0.04 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.24 135-139 0.255 140-144 0.25 145-149 0.27 150 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.65 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.5375 0.0 0.0 0.0 0.0 134-135 3.9 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCAA 10 0.006973645 144.0 8 >>END_MODULE Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217874 spots for SRR3727122.sra Written 1217874 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra Read 1217865 spots for SRR3727122.sra Written 1217865 spots for SRR3727122.sra SRR ids: ['SRR3727122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w5jeua0y SRR3727122.sra spots: 24357309 blocks: [[1, 1217865], [1217866, 2435730], [2435731, 3653595], [3653596, 4871460], [4871461, 6089325], [6089326, 7307190], [7307191, 8525055], [8525056, 9742920], [9742921, 10960785], [10960786, 12178650], [12178651, 13396515], [13396516, 14614380], [14614381, 15832245], [15832246, 17050110], [17050111, 18267975], [18267976, 19485840], [19485841, 20703705], [20703706, 21921570], [21921571, 23139435], [23139436, 24357309]] SRR3727122 file size 8184619 SRR3727122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727122 SRR3727122_1.fastq SRR3727122_2.fastq Input file: SRR3727122_1.fastq Paired file: SRR3727122_2.fastq trimmed: SRR3727122-trimmed-pair1.fastq, SRR3727122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:22:14 2025 >> started Fri Feb 14 11:22:42 2025 >> done (27.598s) 24357309 read pairs processed; of these: 174048 ( 0.71%) short read pairs filtered out after trimming by size control 785692 ( 3.23%) empty read pairs filtered out after trimming by size control 23397569 (96.06%) read pairs available; of these: 12212259 (52.19%) trimmed read pairs available after processing 11185310 (47.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 13 0.00% 20 14 0.00% 21 22 0.00% 22 35 0.00% 23 39 0.00% 24 64 0.00% 25 88 0.00% 26 94 0.00% 27 125 0.00% 28 178 0.00% 29 197 0.00% 30 235 0.00% 31 313 0.00% 32 342 0.00% 33 408 0.00% 34 445 0.00% 35 505 0.00% 36 624 0.00% 37 680 0.00% 38 814 0.00% 39 874 0.00% 40 977 0.00% 41 1108 0.00% 42 1195 0.01% 43 1267 0.01% 44 1388 0.01% 45 1554 0.01% 46 1689 0.01% 47 1789 0.01% 48 1932 0.01% 49 2011 0.01% 50 2147 0.01% 51 2372 0.01% 52 2411 0.01% 53 2610 0.01% 54 2779 0.01% 55 2970 0.01% 56 3080 0.01% 57 3227 0.01% 58 3407 0.01% 59 3713 0.02% 60 3773 0.02% 61 4020 0.02% 62 4364 0.02% 63 4516 0.02% 64 4730 0.02% 65 4928 0.02% 66 5302 0.02% 67 5413 0.02% 68 5784 0.02% 69 6189 0.03% 70 6574 0.03% 71 6975 0.03% 72 7314 0.03% 73 7755 0.03% 74 8357 0.04% 75 8791 0.04% 76 9434 0.04% 77 9952 0.04% 78 10661 0.05% 79 11513 0.05% 80 12537 0.05% 81 13296 0.06% 82 14208 0.06% 83 15517 0.07% 84 23071 0.10% 85 23548 0.10% 86 24573 0.11% 87 26198 0.11% 88 26970 0.12% 89 27575 0.12% 90 28206 0.12% 91 29068 0.12% 92 30379 0.13% 93 31142 0.13% 94 32396 0.14% 95 33266 0.14% 96 34168 0.15% 97 35160 0.15% 98 36804 0.16% 99 38650 0.17% 100 38027 0.16% 101 39752 0.17% 102 41789 0.18% 103 39552 0.17% 104 41048 0.18% 105 47942 0.20% 106 53634 0.23% 107 52763 0.23% 108 54181 0.23% 109 52686 0.23% 110 53244 0.23% 111 52981 0.23% 112 52062 0.22% 113 54730 0.23% 114 60646 0.26% 115 71609 0.31% 116 62626 0.27% 117 56962 0.24% 118 57210 0.24% 119 56867 0.24% 120 59140 0.25% 121 70993 0.30% 122 82286 0.35% 123 83139 0.36% 124 81908 0.35% 125 83316 0.36% 126 93291 0.40% 127 91628 0.39% 128 91448 0.39% 129 104251 0.45% 130 113833 0.49% 131 124961 0.53% 132 128549 0.55% 133 139050 0.59% 134 150137 0.64% 135 157037 0.67% 136 172708 0.74% 137 187046 0.80% 138 204085 0.87% 139 226859 0.97% 140 240409 1.03% 141 264795 1.13% 142 299720 1.28% 143 344854 1.47% 144 402637 1.72% 145 490356 2.10% 146 629783 2.69% 147 858160 3.67% 148 1262300 5.40% 149 3210450 13.72% 150 11185310 47.81% 23397569 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=10.26 fanout-score-rank=10 prefix-density=0.21 prefix-fanout=5.9 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=37.70 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.0 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.87 fanout-score-rank=10 prefix-density=0.30 prefix-fanout=4.8 sequence=GTGGTGTTGCTGGTGTCAAACTGGCAACACTGGACTTATGGAAAGGCTGTACCTCAAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=245.92 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.8 sequence=GATGGCAAGGAGTTACGTTTGTGTTGTGTTAGTGCTTGCTCTTGCAGCAGTGCACACTAGTGCTAGAGACGTGCCTACTGAAAAGAACATGCATGTTGCTAGCACCAAAAATGCGCCAAGTGATGCTGGTCTCACTGACCAAAAGAACTTTGTTTCATATGGTGGTGTTGGTG SRR3727122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:23:58 Started mapping on | Feb 14 11:23:58 Finished on | Feb 14 11:26:06 Mapping speed, Million of reads per hour | 658.06 Number of input reads | 23397569 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 22187253 Uniquely mapped reads % | 94.83% Average mapped length | 286.41 Number of splices: Total | 20762817 Number of splices: Annotated (sjdb) | 20381198 Number of splices: GT/AG | 20387643 Number of splices: GC/AG | 322996 Number of splices: AT/AC | 15949 Number of splices: Non-canonical | 36229 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 672781 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 28635 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579867 579867 579867 N_multimapping 672781 672781 672781 N_noFeature 802926 21914778 970625 N_ambiguous 215849 1131 110309 UnstrandedReadsAssigned:21168478 PositiveStrandReadsAssigned:271344 NegativeStrandReadsAssigned:21106319 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR3727122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727122-trimmed-pair1.fastq SRR3727122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,397,569 reads, 21,440,098 reads pseudoaligned [quant] estimated average fragment length: 250.047 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR3727122.ke.tsv 34699 SRR3727122.se.tsv 87100 total ==> SRR3727122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.95 594 16.8082 Potri.005G024800.1.v4.1 1035 785.953 54 3.43913 Potri.004G059700.1.v4.1 961 712.018 33 2.31993 Potri.007G009000.2.v4.1 1416 1166.95 7 0.300259 Potri.003G141000.2.v4.1 2943 2693.95 577.258 10.7258 Potri.016G087400.1.v4.1 270 75.732 1236 816.941 Potri.015G069301.1.v4.1 564 321.588 0 0 Potri.010G195200.1.v4.1 1773 1523.95 16 0.525533 Potri.012G127500.1.v4.1 977 727.992 1912 131.466 ==> SRR3727122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 90 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 52 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 657 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR3727122 completed mapping pipeline successfully