Starting /dee2/code/volunteer_pipeline.sh SRR3727123 current disk space = 3116774092800 free memory = 1334923676 SRR3727123 SRAfilesize 4153ee640a22c6a7cac18be54ec60682 SRR3727123.sra SRR3727123.sra file validated SRR3727123 is paired end SRR3727123 is conventional basespace SRR3727123 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0085 34.0 31.0 34.0 31.0 34.0 2 32.4825 34.0 31.0 34.0 31.0 34.0 3 32.83275 34.0 31.0 34.0 31.0 34.0 4 36.3515 37.0 37.0 37.0 35.0 37.0 5 36.286 37.0 37.0 37.0 35.0 37.0 6 36.2815 37.0 37.0 37.0 35.0 37.0 7 36.24425 37.0 37.0 37.0 35.0 37.0 8 36.295 37.0 37.0 37.0 35.0 37.0 9 38.0225 39.0 38.0 39.0 35.0 39.0 10-14 38.29985 39.4 38.2 39.4 35.2 39.4 15-19 39.206 40.8 38.8 41.0 35.8 41.0 20-24 39.24255 40.6 39.0 41.0 36.0 41.0 25-29 39.0305 40.0 38.6 41.0 35.8 41.0 30-34 38.82085 40.0 38.0 41.0 35.2 41.0 35-39 38.524950000000004 40.0 38.0 41.0 34.4 41.0 40-44 38.515750000000004 40.0 38.0 41.0 34.0 41.0 45-49 38.481849999999994 40.0 38.0 41.0 34.0 41.0 50-54 38.48219999999999 40.0 38.0 41.0 34.0 41.0 55-59 38.01105 40.0 37.2 41.0 33.2 41.0 60-64 37.60795 39.0 36.4 41.0 33.0 41.0 65-69 36.884550000000004 38.6 35.6 40.2 31.6 41.0 70-74 35.93615 36.8 34.8 39.2 31.2 40.6 75-79 34.50485 35.2 33.8 37.4 29.6 39.2 80-84 33.82475 35.0 34.0 36.2 29.2 37.4 85-89 33.33225 35.0 33.8 35.2 29.6 36.4 90-94 32.9555 35.0 33.0 35.0 29.0 35.6 95-99 32.666250000000005 35.0 33.0 35.0 28.8 35.0 100-104 32.223000000000006 34.6 32.6 35.0 27.0 35.0 105-109 31.9538 34.0 32.0 35.0 26.0 35.0 110-114 31.493900000000004 34.0 31.6 35.0 24.4 35.0 115-119 31.0594 34.0 31.0 35.0 24.2 35.0 120-124 30.5005 34.0 30.4 35.0 21.0 35.0 125-129 29.90935 34.0 29.6 35.0 18.2 35.0 130-134 28.961699999999997 33.2 28.2 34.8 13.2 35.0 135-139 28.827549999999995 33.4 28.6 35.0 9.8 35.0 140-144 27.008549999999996 32.2 25.4 34.0 2.0 35.0 145-149 24.464850000000002 31.8 13.0 34.0 2.0 35.0 150 18.2465 24.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 1.0 11 3.0 12 4.0 13 4.0 14 7.0 15 6.0 16 10.0 17 12.0 18 9.0 19 8.0 20 14.0 21 21.0 22 18.0 23 27.0 24 27.0 25 28.0 26 52.0 27 55.0 28 69.0 29 95.0 30 108.0 31 146.0 32 171.0 33 268.0 34 389.0 35 621.0 36 1101.0 37 721.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.35330419130882 19.20802262792492 11.596811519670865 34.84186166109539 2 17.7 27.575 38.224999999999994 16.5 3 16.05 32.125 26.825 25.0 4 21.05 37.6 21.575 19.775000000000002 5 22.0 38.224999999999994 21.3 18.475 6 15.975 35.949999999999996 24.7 23.375 7 12.825000000000001 19.05 46.375 21.75 8 17.8 20.525 28.799999999999997 32.875 9 17.375 20.625 31.374999999999996 30.625000000000004 10-14 20.14 29.98 25.765 24.115000000000002 15-19 19.915 28.95 27.235 23.9 20-24 19.400000000000002 29.785 26.924999999999997 23.89 25-29 20.01 28.865000000000002 27.275 23.849999999999998 30-34 19.23 29.299999999999997 27.485 23.985 35-39 19.1 29.275000000000002 27.855 23.77 40-44 20.09 29.439999999999998 27.215 23.255 45-49 19.84 28.465 27.565 24.13 50-54 19.675 28.849999999999998 27.389999999999997 24.085 55-59 19.955000000000002 29.044999999999998 27.12 23.880000000000003 60-64 19.81 28.665000000000003 27.655 23.87 65-69 19.515 28.48 27.97 24.035 70-74 19.85 29.28 27.025 23.845 75-79 19.985 28.485 27.32 24.21 80-84 20.52 28.549999999999997 27.3 23.630000000000003 85-89 20.365 28.720000000000002 27.125 23.79 90-94 20.09 28.725 27.134999999999998 24.05 95-99 20.3 28.810000000000002 27.315 23.575 100-104 20.65 28.505000000000003 27.49 23.355 105-109 20.14 28.84 27.67 23.35 110-114 20.615 28.62 27.279999999999998 23.485 115-119 20.715 28.970000000000002 27.145000000000003 23.169999999999998 120-124 20.82 28.285 27.0 23.895 125-129 20.150000000000002 28.825 27.58 23.445 130-134 20.78 28.03 27.355 23.835 135-139 20.669999999999998 28.54 27.395000000000003 23.395 140-144 19.84 29.244999999999997 27.18 23.735 145-149 20.015 28.715000000000003 26.955000000000002 24.315 150 8.95 34.225 28.65 28.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 2.5 22 1.0 23 2.0 24 2.0 25 2.0 26 6.0 27 9.0 28 12.0 29 20.5 30 26.5 31 28.5 32 34.0 33 47.0 34 55.0 35 66.5 36 87.0 37 110.0 38 132.0 39 156.5 40 186.5 41 221.0 42 251.0 43 267.0 44 285.5 45 286.0 46 274.5 47 260.5 48 233.5 49 194.5 50 166.0 51 141.5 52 99.0 53 74.0 54 63.0 55 49.5 56 37.5 57 29.5 58 20.0 59 11.0 60 10.0 61 8.5 62 8.5 63 5.5 64 2.5 65 2.0 66 0.5 67 1.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.48750000000000004 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3727123 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.79775 33.0 31.0 34.0 27.0 34.0 2 30.9975 34.0 31.0 34.0 28.0 34.0 3 31.1385 34.0 31.0 34.0 28.0 34.0 4 34.579 37.0 35.0 37.0 33.0 37.0 5 34.536 37.0 35.0 37.0 32.0 37.0 6 34.54425 37.0 35.0 37.0 32.0 37.0 7 34.49475 37.0 35.0 37.0 32.0 37.0 8 34.50375 37.0 35.0 37.0 32.0 37.0 9 36.206 39.0 37.0 39.0 33.0 39.0 10-14 36.339200000000005 39.2 37.2 39.4 32.2 39.4 15-19 37.15175000000001 40.0 38.0 41.0 31.6 41.0 20-24 37.224599999999995 40.0 38.0 41.0 32.0 41.0 25-29 37.09645 40.0 38.0 41.0 32.0 41.0 30-34 36.7358 40.0 37.8 41.0 30.6 41.0 35-39 36.4347 40.0 37.2 41.0 30.0 41.0 40-44 35.90655 39.6 36.2 41.0 28.8 41.0 45-49 35.98965 39.8 36.8 41.0 29.0 41.0 50-54 35.33605 39.0 35.4 40.0 27.8 40.6 55-59 35.57165 39.0 35.8 41.0 28.0 41.0 60-64 35.46985 39.0 35.4 41.0 27.8 41.0 65-69 34.7838 37.8 35.0 40.0 27.4 41.0 70-74 33.66475 36.4 34.0 38.8 26.0 40.2 75-79 32.55400000000001 35.0 33.6 37.0 25.4 39.0 80-84 31.70555 35.0 32.8 35.8 23.0 37.0 85-89 30.57325 34.6 31.2 35.0 17.6 36.0 90-94 30.691950000000002 34.8 31.8 35.0 19.6 35.2 95-99 30.447899999999997 34.0 31.6 35.0 18.6 35.0 100-104 29.88285 34.0 30.6 35.0 13.2 35.0 105-109 29.8224 34.0 30.8 35.0 7.6 35.0 110-114 29.286250000000003 34.0 29.4 35.0 6.6 35.0 115-119 28.928199999999997 34.0 29.4 35.0 2.0 35.0 120-124 28.7608 34.0 29.0 35.0 2.0 35.0 125-129 28.116149999999998 33.6 27.8 35.0 2.0 35.0 130-134 26.832299999999996 32.4 25.0 34.4 2.0 35.0 135-139 26.856650000000002 32.8 25.0 34.8 2.0 35.0 140-144 26.372950000000003 32.0 24.6 34.0 2.0 35.0 145-149 24.4865 31.2 12.2 34.0 2.0 35.0 150 20.92675 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 165.0 3 12.0 4 3.0 5 6.0 6 9.0 7 13.0 8 6.0 9 9.0 10 10.0 11 8.0 12 14.0 13 17.0 14 9.0 15 6.0 16 9.0 17 11.0 18 12.0 19 17.0 20 12.0 21 20.0 22 16.0 23 22.0 24 29.0 25 39.0 26 44.0 27 50.0 28 50.0 29 81.0 30 104.0 31 139.0 32 185.0 33 252.0 34 342.0 35 602.0 36 1067.0 37 608.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.525 13.5 15.375 32.6 2 23.7 22.1 36.95 17.25 3 20.375 25.3 31.85 22.475 4 25.25 34.849999999999994 19.25 20.65 5 23.0 37.425000000000004 21.425 18.15 6 17.45 37.7 25.15 19.7 7 17.1 14.45 45.875 22.575 8 20.549999999999997 20.95 27.925 30.575000000000003 9 22.325 22.15 28.7 26.825 10-14 22.805 28.425 27.26 21.51 15-19 23.200000000000003 27.235 28.205000000000002 21.36 20-24 22.29 28.15 28.62 20.94 25-29 22.45 28.28 28.26 21.01 30-34 22.720000000000002 27.735 28.470000000000002 21.075 35-39 23.055 27.905 28.26 20.78 40-44 22.67 27.63 28.634999999999998 21.065 45-49 22.869999999999997 28.165000000000003 28.27 20.695 50-54 23.56 28.73 27.13 20.580000000000002 55-59 23.56 28.035 27.689999999999998 20.715 60-64 23.25 27.655 28.12 20.974999999999998 65-69 23.09 28.044999999999998 28.27 20.595 70-74 23.365 27.315 28.235 21.085 75-79 23.835 28.08 28.139999999999997 19.945 80-84 23.255 27.155 29.18 20.41 85-89 23.765 27.875 28.050000000000004 20.31 90-94 23.549999999999997 27.944999999999997 28.4 20.105 95-99 23.36 28.065 28.24 20.335 100-104 24.03 28.060000000000002 27.845 20.064999999999998 105-109 23.825 27.205000000000002 28.12 20.849999999999998 110-114 23.805 27.61 28.265 20.32 115-119 23.494999999999997 27.985 28.060000000000002 20.46 120-124 23.525 27.55 28.285 20.64 125-129 23.3 28.09 28.205000000000002 20.405 130-134 24.13 27.445000000000004 28.110000000000003 20.315 135-139 24.5 27.625 27.800000000000004 20.075000000000003 140-144 23.395 27.445000000000004 28.16 21.0 145-149 24.125 27.12 28.33 20.424999999999997 150 24.748490945674046 26.38329979879276 27.96780684104628 20.900402414486923 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 1.0 11 1.5 12 2.0 13 1.5 14 1.5 15 2.5 16 2.0 17 1.0 18 1.0 19 3.0 20 4.5 21 2.0 22 0.5 23 1.5 24 3.5 25 4.0 26 3.5 27 8.0 28 11.5 29 11.0 30 17.0 31 23.0 32 23.5 33 32.0 34 41.0 35 57.5 36 74.0 37 92.0 38 122.5 39 168.0 40 195.0 41 221.5 42 258.0 43 267.5 44 276.0 45 278.5 46 271.0 47 267.0 48 241.0 49 197.0 50 165.0 51 132.5 52 108.0 53 93.5 54 80.5 55 61.5 56 44.0 57 27.5 58 17.5 59 15.5 60 12.0 61 12.0 62 9.5 63 5.5 64 3.0 65 5.0 66 4.0 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138 2.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCTC 10 0.006973645 144.0 8 ACCAACT 10 0.006973645 144.0 7 >>END_MODULE Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049386 spots for SRR3727123.sra Written 1049386 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra Read 1049375 spots for SRR3727123.sra Written 1049375 spots for SRR3727123.sra SRR ids: ['SRR3727123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_prnht67a SRR3727123.sra spots: 20987511 blocks: [[1, 1049375], [1049376, 2098750], [2098751, 3148125], [3148126, 4197500], [4197501, 5246875], [5246876, 6296250], [6296251, 7345625], [7345626, 8395000], [8395001, 9444375], [9444376, 10493750], [10493751, 11543125], [11543126, 12592500], [12592501, 13641875], [13641876, 14691250], [14691251, 15740625], [15740626, 16790000], [16790001, 17839375], [17839376, 18888750], [18888751, 19938125], [19938126, 20987511]] SRR3727123 file size 7049287 SRR3727123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727123 SRR3727123_1.fastq SRR3727123_2.fastq Input file: SRR3727123_1.fastq Paired file: SRR3727123_2.fastq trimmed: SRR3727123-trimmed-pair1.fastq, SRR3727123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:30:16 2025 >> started Fri Feb 14 09:30:43 2025 >> done (27.387s) 20987511 read pairs processed; of these: 132764 ( 0.63%) short read pairs filtered out after trimming by size control 586110 ( 2.79%) empty read pairs filtered out after trimming by size control 20268637 (96.57%) read pairs available; of these: 10442502 (51.52%) trimmed read pairs available after processing 9826135 (48.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 10 0.00% 21 18 0.00% 22 19 0.00% 23 30 0.00% 24 41 0.00% 25 54 0.00% 26 76 0.00% 27 86 0.00% 28 96 0.00% 29 126 0.00% 30 130 0.00% 31 181 0.00% 32 219 0.00% 33 259 0.00% 34 299 0.00% 35 358 0.00% 36 427 0.00% 37 484 0.00% 38 547 0.00% 39 604 0.00% 40 665 0.00% 41 708 0.00% 42 777 0.00% 43 852 0.00% 44 1006 0.00% 45 1074 0.01% 46 1193 0.01% 47 1245 0.01% 48 1306 0.01% 49 1396 0.01% 50 1586 0.01% 51 1654 0.01% 52 1693 0.01% 53 1939 0.01% 54 2025 0.01% 55 2085 0.01% 56 2249 0.01% 57 2326 0.01% 58 2444 0.01% 59 2660 0.01% 60 2809 0.01% 61 2957 0.01% 62 3184 0.02% 63 3373 0.02% 64 3528 0.02% 65 3686 0.02% 66 3856 0.02% 67 4100 0.02% 68 4307 0.02% 69 4634 0.02% 70 4899 0.02% 71 5238 0.03% 72 5719 0.03% 73 5869 0.03% 74 6137 0.03% 75 6461 0.03% 76 6903 0.03% 77 7209 0.04% 78 7773 0.04% 79 8302 0.04% 80 8901 0.04% 81 9786 0.05% 82 10642 0.05% 83 11954 0.06% 84 17566 0.09% 85 18135 0.09% 86 19038 0.09% 87 19309 0.10% 88 19691 0.10% 89 20310 0.10% 90 21839 0.11% 91 22032 0.11% 92 22427 0.11% 93 23001 0.11% 94 23550 0.12% 95 24462 0.12% 96 25362 0.13% 97 26941 0.13% 98 26638 0.13% 99 26967 0.13% 100 28023 0.14% 101 26495 0.13% 102 28632 0.14% 103 29387 0.14% 104 33772 0.17% 105 31709 0.16% 106 30971 0.15% 107 34171 0.17% 108 34136 0.17% 109 33569 0.17% 110 35010 0.17% 111 35574 0.18% 112 37504 0.19% 113 38990 0.19% 114 43757 0.22% 115 60375 0.30% 116 42663 0.21% 117 44348 0.22% 118 42509 0.21% 119 46627 0.23% 120 55443 0.27% 121 52620 0.26% 122 46623 0.23% 123 47085 0.23% 124 50841 0.25% 125 55607 0.27% 126 59327 0.29% 127 66746 0.33% 128 81648 0.40% 129 75714 0.37% 130 83062 0.41% 131 96909 0.48% 132 112109 0.55% 133 108988 0.54% 134 124697 0.62% 135 132892 0.66% 136 146114 0.72% 137 158817 0.78% 138 176099 0.87% 139 193776 0.96% 140 207867 1.03% 141 232818 1.15% 142 260833 1.29% 143 297620 1.47% 144 355541 1.75% 145 433076 2.14% 146 569626 2.81% 147 788178 3.89% 148 1168314 5.76% 149 2930838 14.46% 150 9826135 48.48% 20268637 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=33 prefix-density=0.18 prefix-fanout=2.3 sequence=GATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=370.52 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=35.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=13.31 fanout-score-rank=13 prefix-density=0.29 prefix-fanout=6.4 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=294.86 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=24.9 sequence=AGAAGAAGAGAGG SRR3727123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:31:36 Started mapping on | Feb 14 09:31:40 Finished on | Feb 14 09:34:06 Mapping speed, Million of reads per hour | 499.77 Number of input reads | 20268637 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19577246 Uniquely mapped reads % | 96.59% Average mapped length | 287.95 Number of splices: Total | 19815713 Number of splices: Annotated (sjdb) | 19531678 Number of splices: GT/AG | 19521325 Number of splices: GC/AG | 245272 Number of splices: AT/AC | 14041 Number of splices: Non-canonical | 35075 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425194 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 39874 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296225 296225 296225 N_multimapping 425194 425194 425194 N_noFeature 513837 19362592 639012 N_ambiguous 166859 1363 76298 UnstrandedReadsAssigned:18896550 PositiveStrandReadsAssigned:213291 NegativeStrandReadsAssigned:18861936 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR3727123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727123-trimmed-pair1.fastq SRR3727123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,268,637 reads, 18,928,366 reads pseudoaligned [quant] estimated average fragment length: 250.495 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR3727123.ke.tsv 34699 SRR3727123.se.tsv 87100 total ==> SRR3727123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.5 698 19.5702 Potri.005G024800.1.v4.1 1035 785.505 179 11.2993 Potri.004G059700.1.v4.1 961 711.594 50 3.48405 Potri.007G009000.2.v4.1 1416 1166.5 0 0 Potri.003G141000.2.v4.1 2943 2693.5 522.246 9.61398 Potri.016G087400.1.v4.1 270 73.753 1631.46 1096.84 Potri.015G069301.1.v4.1 564 320.743 0 0 Potri.010G195200.1.v4.1 1773 1523.5 72 2.34334 Potri.012G127500.1.v4.1 977 727.541 2209 150.551 ==> SRR3727123.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 55 SRR3727123 completed mapping pipeline successfully