Starting /dee2/code/volunteer_pipeline.sh SRR3727124 current disk space = 3115935875072 free memory = 1579767152 SRR3727124 SRAfilesize bc08a4904781edf6874f4011c999ad02 SRR3727124.sra SRR3727124.sra file validated SRR3727124 is paired end SRR3727124 is conventional basespace SRR3727124 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4645 34.0 31.0 34.0 31.0 34.0 2 32.90975 34.0 33.0 34.0 31.0 34.0 3 33.13575 34.0 34.0 34.0 31.0 34.0 4 36.5005 37.0 37.0 37.0 35.0 37.0 5 36.488 37.0 37.0 37.0 35.0 37.0 6 36.4875 37.0 37.0 37.0 35.0 37.0 7 36.38875 37.0 37.0 37.0 35.0 37.0 8 36.4665 37.0 37.0 37.0 35.0 37.0 9 38.20025 39.0 39.0 39.0 37.0 39.0 10-14 38.54385 39.4 39.2 39.4 37.2 39.4 15-19 39.673 41.0 39.8 41.0 37.4 41.0 20-24 39.709199999999996 41.0 40.0 41.0 37.4 41.0 25-29 39.537400000000005 40.8 39.6 41.0 36.8 41.0 30-34 39.25295 40.0 39.0 41.0 36.4 41.0 35-39 39.0631 40.0 38.6 41.0 36.0 41.0 40-44 38.912349999999996 40.0 38.2 41.0 35.2 41.0 45-49 39.070299999999996 40.0 39.0 41.0 35.6 41.0 50-54 38.878 40.0 38.4 41.0 35.0 41.0 55-59 38.453050000000005 40.0 37.6 41.0 34.6 41.0 60-64 37.77605 39.4 36.6 41.0 33.8 41.0 65-69 36.91605 38.2 35.4 40.2 32.4 41.0 70-74 35.9504 36.6 35.0 39.0 31.8 40.8 75-79 34.71445 35.2 34.0 37.4 30.6 39.2 80-84 34.306349999999995 35.0 34.0 36.2 31.0 37.6 85-89 33.671949999999995 35.0 34.0 35.4 30.8 36.4 90-94 33.177299999999995 35.0 34.0 35.0 29.8 35.8 95-99 32.921499999999995 35.0 33.4 35.0 29.4 35.0 100-104 32.94665 35.0 33.8 35.0 29.4 35.0 105-109 32.820299999999996 35.0 33.6 35.0 29.0 35.0 110-114 32.54415 34.8 33.0 35.0 29.0 35.0 115-119 32.1509 34.4 32.6 35.0 27.4 35.0 120-124 31.830599999999997 34.0 32.0 35.0 25.0 35.0 125-129 31.39255 34.0 31.4 35.0 24.8 35.0 130-134 30.827049999999996 34.0 31.0 35.0 23.8 35.0 135-139 29.301 34.0 29.2 35.0 12.4 35.0 140-144 27.422950000000004 32.8 25.4 34.8 2.6 35.0 145-149 25.1578 31.8 15.6 34.0 2.0 35.0 150 18.84225 25.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 1.0 10 5.0 11 5.0 12 4.0 13 9.0 14 10.0 15 4.0 16 5.0 17 2.0 18 8.0 19 5.0 20 4.0 21 10.0 22 7.0 23 10.0 24 16.0 25 17.0 26 30.0 27 45.0 28 46.0 29 61.0 30 89.0 31 123.0 32 159.0 33 207.0 34 346.0 35 717.0 36 1252.0 37 795.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.096692111959285 18.880407124681934 10.305343511450381 36.717557251908396 2 17.925 27.725 38.224999999999994 16.125 3 16.475 31.5 27.950000000000003 24.075 4 19.900000000000002 37.55 22.35 20.200000000000003 5 20.65 39.025 22.175 18.15 6 16.55 35.55 24.65 23.25 7 13.225000000000001 20.1 44.275 22.400000000000002 8 17.724999999999998 20.65 27.775 33.85 9 18.3 21.125 30.825000000000003 29.75 10-14 19.939999999999998 29.475 26.540000000000003 24.044999999999998 15-19 20.04 28.575 26.945000000000004 24.44 20-24 19.96 29.080000000000002 27.42 23.54 25-29 19.61 28.985 27.35 24.055 30-34 19.83099154957748 29.286464323216162 26.836341817090855 24.046202310115504 35-39 20.035 29.015 27.034999999999997 23.915 40-44 20.945 28.585 27.07 23.400000000000002 45-49 20.49 29.285 26.86 23.365 50-54 20.330000000000002 28.575 27.295 23.799999999999997 55-59 20.95 28.845 26.840000000000003 23.365 60-64 20.365 28.139999999999997 27.345000000000002 24.15 65-69 20.025000000000002 28.505000000000003 27.834999999999997 23.635 70-74 19.99 29.175 26.97 23.865 75-79 21.0 28.13 27.1 23.77 80-84 20.419999999999998 28.17 27.825 23.585 85-89 20.555 28.24 27.334999999999997 23.87 90-94 20.687068706870686 28.322832283228323 27.122712271227122 23.86738673867387 95-99 20.59205920592059 27.847784778477845 27.847784778477845 23.712371237123712 100-104 20.205000000000002 27.655 27.584999999999997 24.555 105-109 20.665 27.66 27.805000000000003 23.87 110-114 20.605 27.474999999999998 27.884999999999998 24.035 115-119 20.191009550477524 28.38641932096605 27.326366318315916 24.09620481024051 120-124 20.745 27.355 27.705000000000002 24.195 125-129 21.0 27.43 27.51 24.060000000000002 130-134 21.44607230361518 27.811390569528477 27.45137256862843 23.291164558227912 135-139 20.68 28.735 26.279999999999998 24.305 140-144 20.4 27.42 27.66 24.52 145-149 20.015 28.355000000000004 27.455000000000002 24.175 150 8.225 34.925 29.599999999999998 27.250000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 5.5 26 9.0 27 8.5 28 9.5 29 13.5 30 21.0 31 32.5 32 38.5 33 49.0 34 58.5 35 62.0 36 90.0 37 117.5 38 137.5 39 161.0 40 189.0 41 216.5 42 226.0 43 245.5 44 267.0 45 268.0 46 240.5 47 234.5 48 232.0 49 215.0 50 185.5 51 130.0 52 101.5 53 90.5 54 71.5 55 48.0 56 40.0 57 32.5 58 25.0 59 25.0 60 19.5 61 14.5 62 14.0 63 15.0 64 12.5 65 6.0 66 1.0 67 1.5 68 3.0 69 2.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.6499999999999999 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.9875 0.0 0.0 0.0 0.0 136-137 1.0499999999999998 0.0 0.0 0.0 0.0 138 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAACA 10 0.0069772652 143.975 2 >>END_MODULE SRR3727124 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6655 34.0 31.0 34.0 31.0 34.0 2 31.67525 34.0 31.0 34.0 30.0 34.0 3 31.69025 34.0 31.0 34.0 30.0 34.0 4 35.09875 37.0 37.0 37.0 35.0 37.0 5 35.17525 37.0 37.0 37.0 35.0 37.0 6 34.988 37.0 36.0 37.0 33.0 37.0 7 35.124 37.0 37.0 37.0 35.0 37.0 8 35.1635 37.0 37.0 37.0 35.0 37.0 9 36.8875 39.0 38.0 39.0 35.0 39.0 10-14 37.0869 39.2 38.0 39.4 34.8 39.4 15-19 38.0936 40.8 38.8 41.0 35.0 41.0 20-24 37.99675 40.8 39.0 41.0 34.4 41.0 25-29 37.85235 40.0 38.6 41.0 34.2 41.0 30-34 37.694750000000006 40.0 38.0 41.0 34.0 41.0 35-39 37.2581 40.0 38.0 41.0 32.6 41.0 40-44 37.093 40.0 38.0 41.0 32.4 41.0 45-49 36.84765 40.0 37.4 41.0 31.2 41.0 50-54 36.222049999999996 39.0 36.4 40.2 30.4 40.8 55-59 36.3058 39.0 36.2 41.0 30.6 41.0 60-64 36.205349999999996 39.0 35.6 41.0 31.0 41.0 65-69 35.469550000000005 37.8 35.0 40.0 30.0 41.0 70-74 34.51435 36.4 34.6 39.0 29.4 40.6 75-79 33.56145 35.2 34.0 37.0 29.0 39.0 80-84 32.57505 35.0 33.4 35.8 27.4 37.2 85-89 31.803999999999995 35.0 32.8 35.0 25.6 36.0 90-94 31.335949999999997 34.8 32.4 35.0 24.2 35.2 95-99 31.403450000000003 35.0 33.0 35.0 24.8 35.0 100-104 31.02015 34.0 32.0 35.0 23.2 35.0 105-109 30.72 34.0 31.6 35.0 21.2 35.0 110-114 30.5599 34.0 31.4 35.0 19.2 35.0 115-119 30.011000000000003 34.0 30.6 35.0 16.6 35.0 120-124 29.34525 34.0 29.6 35.0 12.2 35.0 125-129 28.895300000000002 34.0 29.0 35.0 7.0 35.0 130-134 28.6014 33.8 28.6 35.0 2.6 35.0 135-139 27.9005 33.0 27.0 34.8 2.0 35.0 140-144 27.009900000000005 32.6 25.4 34.0 2.0 35.0 145-149 25.8157 32.0 23.6 34.0 2.0 35.0 150 21.96 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 127.0 3 11.0 4 6.0 5 2.0 6 4.0 7 5.0 8 6.0 9 7.0 10 1.0 11 7.0 12 9.0 13 6.0 14 8.0 15 7.0 16 8.0 17 7.0 18 11.0 19 11.0 20 15.0 21 14.0 22 14.0 23 16.0 24 18.0 25 27.0 26 38.0 27 40.0 28 66.0 29 61.0 30 81.0 31 122.0 32 150.0 33 220.0 34 371.0 35 659.0 36 1154.0 37 684.0 38 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.4 14.75 12.1 34.75 2 21.975 23.325000000000003 37.75 16.950000000000003 3 20.65 26.575 29.225 23.549999999999997 4 25.424999999999997 34.475 19.7 20.4 5 22.85 37.425000000000004 21.275 18.45 6 17.849999999999998 37.325 24.9 19.925 7 16.475 14.95 45.275 23.3 8 21.2 20.375 28.799999999999997 29.625 9 22.75 23.150000000000002 26.974999999999998 27.125 10-14 22.865 28.17 26.985 21.98 15-19 23.085 27.66 27.66 21.595 20-24 22.85 27.900000000000002 27.839999999999996 21.41 25-29 23.215 28.055000000000003 27.405 21.325 30-34 23.07 28.205000000000002 27.185 21.54 35-39 23.265 27.615000000000002 27.87 21.25 40-44 23.990000000000002 27.01 27.994999999999997 21.005 45-49 23.32 27.46 28.015 21.205 50-54 23.485 27.52 27.810000000000002 21.185000000000002 55-59 22.835 27.47 28.09 21.605 60-64 23.365 27.665 27.46 21.51 65-69 23.14 27.755000000000003 27.800000000000004 21.305 70-74 23.544999999999998 27.1 27.845 21.51 75-79 23.25 27.505000000000003 28.29 20.955 80-84 23.845 27.284999999999997 27.700000000000003 21.17 85-89 23.915 27.46 27.384999999999998 21.240000000000002 90-94 23.21 27.26 28.01 21.52 95-99 23.82 27.529999999999998 27.725 20.925 100-104 23.799999999999997 27.57 27.425 21.205 105-109 23.805 27.495000000000005 27.615000000000002 21.085 110-114 23.76 27.400000000000002 27.779999999999998 21.060000000000002 115-119 24.035 27.245 27.655 21.065 120-124 23.62 27.3 28.144999999999996 20.935000000000002 125-129 23.530294691549507 27.452844348826737 27.90814029118927 21.108720668434483 130-134 24.349999999999998 27.35 27.675 20.625 135-139 23.51 28.165000000000003 27.474999999999998 20.849999999999998 140-144 23.825 27.58 27.534999999999997 21.060000000000002 145-149 24.265 27.884999999999998 27.37 20.48 150 24.875 27.900000000000002 26.474999999999998 20.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 1.5 16 1.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 2.0 23 3.0 24 3.0 25 3.5 26 5.0 27 5.0 28 5.5 29 10.5 30 15.5 31 18.0 32 22.5 33 35.5 34 44.5 35 59.0 36 85.5 37 110.0 38 122.0 39 145.0 40 174.0 41 204.0 42 250.5 43 256.0 44 240.0 45 248.5 46 257.5 47 237.5 48 220.5 49 207.5 50 166.0 51 149.5 52 137.5 53 107.0 54 86.5 55 60.5 56 50.5 57 42.5 58 34.5 59 35.0 60 24.5 61 22.0 62 20.0 63 12.0 64 9.5 65 9.5 66 5.5 67 2.5 68 2.5 69 3.0 70 3.0 71 2.5 72 3.0 73 2.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.065 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.48750000000000004 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTATC 10 0.006973645 144.0 2 CCATATG 10 0.006973645 144.0 9 AAGTTAA 10 0.006973645 144.0 5 >>END_MODULE Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762519 spots for SRR3727124.sra Written 762519 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra Read 762502 spots for SRR3727124.sra Written 762502 spots for SRR3727124.sra SRR ids: ['SRR3727124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cyxlm_9n SRR3727124.sra spots: 15250057 blocks: [[1, 762502], [762503, 1525004], [1525005, 2287506], [2287507, 3050008], [3050009, 3812510], [3812511, 4575012], [4575013, 5337514], [5337515, 6100016], [6100017, 6862518], [6862519, 7625020], [7625021, 8387522], [8387523, 9150024], [9150025, 9912526], [9912527, 10675028], [10675029, 11437530], [11437531, 12200032], [12200033, 12962534], [12962535, 13725036], [13725037, 14487538], [14487539, 15250057]] SRR3727124 file size 5116258 SRR3727124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727124 SRR3727124_1.fastq SRR3727124_2.fastq Input file: SRR3727124_1.fastq Paired file: SRR3727124_2.fastq trimmed: SRR3727124-trimmed-pair1.fastq, SRR3727124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:13:31 2025 >> started Fri Feb 14 10:13:48 2025 >> done (16.793s) 15250057 read pairs processed; of these: 85947 ( 0.56%) short read pairs filtered out after trimming by size control 382775 ( 2.51%) empty read pairs filtered out after trimming by size control 14781335 (96.93%) read pairs available; of these: 6455347 (43.67%) trimmed read pairs available after processing 8325988 (56.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 5 0.00% 21 14 0.00% 22 21 0.00% 23 38 0.00% 24 35 0.00% 25 49 0.00% 26 65 0.00% 27 77 0.00% 28 96 0.00% 29 106 0.00% 30 141 0.00% 31 146 0.00% 32 173 0.00% 33 218 0.00% 34 213 0.00% 35 273 0.00% 36 323 0.00% 37 328 0.00% 38 394 0.00% 39 452 0.00% 40 447 0.00% 41 550 0.00% 42 609 0.00% 43 593 0.00% 44 652 0.00% 45 696 0.00% 46 769 0.01% 47 882 0.01% 48 884 0.01% 49 917 0.01% 50 978 0.01% 51 1002 0.01% 52 1100 0.01% 53 1186 0.01% 54 1265 0.01% 55 1293 0.01% 56 1330 0.01% 57 1386 0.01% 58 1521 0.01% 59 1521 0.01% 60 1573 0.01% 61 1690 0.01% 62 1859 0.01% 63 1850 0.01% 64 1918 0.01% 65 2053 0.01% 66 2172 0.01% 67 2223 0.02% 68 2388 0.02% 69 2558 0.02% 70 2631 0.02% 71 2828 0.02% 72 2950 0.02% 73 3168 0.02% 74 3182 0.02% 75 3547 0.02% 76 3762 0.03% 77 4057 0.03% 78 4385 0.03% 79 4658 0.03% 80 4969 0.03% 81 5522 0.04% 82 5884 0.04% 83 6515 0.04% 84 10862 0.07% 85 11478 0.08% 86 11621 0.08% 87 12422 0.08% 88 12594 0.09% 89 12791 0.09% 90 13488 0.09% 91 14233 0.10% 92 14601 0.10% 93 15026 0.10% 94 15823 0.11% 95 16445 0.11% 96 16900 0.11% 97 16953 0.11% 98 17053 0.12% 99 17284 0.12% 100 17877 0.12% 101 18214 0.12% 102 19786 0.13% 103 18317 0.12% 104 18682 0.13% 105 20457 0.14% 106 21914 0.15% 107 22831 0.15% 108 24124 0.16% 109 26253 0.18% 110 23249 0.16% 111 24748 0.17% 112 24152 0.16% 113 24392 0.17% 114 25441 0.17% 115 32681 0.22% 116 26850 0.18% 117 25464 0.17% 118 24765 0.17% 119 26141 0.18% 120 27111 0.18% 121 29628 0.20% 122 30250 0.20% 123 31658 0.21% 124 37316 0.25% 125 45598 0.31% 126 41375 0.28% 127 37880 0.26% 128 37610 0.25% 129 42665 0.29% 130 45876 0.31% 131 48691 0.33% 132 54515 0.37% 133 67525 0.46% 134 69097 0.47% 135 70600 0.48% 136 82560 0.56% 137 90958 0.62% 138 95262 0.64% 139 103955 0.70% 140 110485 0.75% 141 123038 0.83% 142 139907 0.95% 143 162384 1.10% 144 194363 1.31% 145 239349 1.62% 146 312883 2.12% 147 438010 2.96% 148 677343 4.58% 149 2170448 14.68% 150 8325988 56.33% 14781335 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=24.76 fanout-score-rank=9 prefix-density=0.37 prefix-fanout=9.5 sequence=ACACCAGCAATGATTGTCTGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=526.65 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=35.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=33 prefix-density=0.15 prefix-fanout=2.1 sequence=ATGTACCCAGACTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=409.22 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=34.7 sequence=AAGAAGAAGAAA SRR3727124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:15:56 Started mapping on | Feb 14 10:15:56 Finished on | Feb 14 10:19:07 Mapping speed, Million of reads per hour | 278.60 Number of input reads | 14781335 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13144926 Uniquely mapped reads % | 88.93% Average mapped length | 290.36 Number of splices: Total | 11910737 Number of splices: Annotated (sjdb) | 11686364 Number of splices: GT/AG | 11715954 Number of splices: GC/AG | 162451 Number of splices: AT/AC | 9660 Number of splices: Non-canonical | 22672 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304350 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 18529 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.77% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1351015 1351015 1351015 N_multimapping 304350 304350 304350 N_noFeature 469273 12976207 547195 N_ambiguous 166434 748 75254 UnstrandedReadsAssigned:12509219 PositiveStrandReadsAssigned:167971 NegativeStrandReadsAssigned:12522477 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727124-trimmed-pair1.fastq SRR3727124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,781,335 reads, 12,644,196 reads pseudoaligned [quant] estimated average fragment length: 254.943 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR3727124.ke.tsv 34699 SRR3727124.se.tsv 87100 total ==> SRR3727124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.06 507 19.8944 Potri.005G024800.1.v4.1 1035 781.057 234 20.7381 Potri.004G059700.1.v4.1 961 707.089 32 3.13265 Potri.007G009000.2.v4.1 1416 1162.06 0 0 Potri.003G141000.2.v4.1 2943 2689.06 600.344 15.4538 Potri.016G087400.1.v4.1 270 69.9725 1001.57 990.807 Potri.015G069301.1.v4.1 564 315.123 0 0 Potri.010G195200.1.v4.1 1773 1519.06 37 1.68603 Potri.012G127500.1.v4.1 977 723.073 3896 372.969 ==> SRR3727124.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 386 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 206 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR3727124 completed mapping pipeline successfully