Starting /dee2/code/volunteer_pipeline.sh SRR3727125 current disk space = 3115546152960 free memory = 1570065152 SRR3727125 SRAfilesize ef374036eea6d0a7039cb810c5b65ad3 SRR3727125.sra SRR3727125.sra file validated SRR3727125 is paired end SRR3727125 is conventional basespace SRR3727125 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55125 34.0 33.0 34.0 31.0 34.0 2 32.957 34.0 33.0 34.0 31.0 34.0 3 33.23925 34.0 34.0 34.0 31.0 34.0 4 36.6055 37.0 37.0 37.0 35.0 37.0 5 36.55775 37.0 37.0 37.0 35.0 37.0 6 36.60325 37.0 37.0 37.0 35.0 37.0 7 36.567 37.0 37.0 37.0 35.0 37.0 8 36.608 37.0 37.0 37.0 35.0 37.0 9 38.44775 39.0 39.0 39.0 37.0 39.0 10-14 38.691500000000005 39.4 39.2 39.4 37.2 39.4 15-19 39.872 41.0 40.0 41.0 38.0 41.0 20-24 39.81505 41.0 40.0 41.0 37.8 41.0 25-29 39.3285 40.6 38.8 41.0 36.2 41.0 30-34 39.2548 40.2 39.0 41.0 36.4 41.0 35-39 39.18495 40.0 38.6 41.0 36.0 41.0 40-44 39.2774 40.0 38.8 41.0 36.6 41.0 45-49 39.4519 41.0 39.2 41.0 36.6 41.0 50-54 39.15375 40.0 39.0 41.0 35.2 41.0 55-59 38.750299999999996 40.0 38.0 41.0 35.0 41.0 60-64 38.197900000000004 39.6 37.0 41.0 34.2 41.0 65-69 37.5031 38.8 35.8 40.4 34.0 41.0 70-74 36.4669 36.8 35.0 39.2 32.8 40.8 75-79 35.2417 35.2 34.6 37.4 32.0 39.2 80-84 34.75825 35.0 34.6 36.4 32.4 37.6 85-89 34.16395 35.0 34.0 35.4 31.8 36.4 90-94 33.659949999999995 35.0 34.0 35.0 31.2 35.8 95-99 33.426100000000005 35.0 34.0 35.0 31.0 35.0 100-104 33.2053 35.0 34.0 35.0 30.0 35.0 105-109 32.92375 35.0 33.4 35.0 29.6 35.0 110-114 32.81445 35.0 33.0 35.0 29.2 35.0 115-119 32.41975 34.2 33.0 35.0 28.2 35.0 120-124 32.05825 34.0 32.2 35.0 27.0 35.0 125-129 31.853050000000003 34.0 32.0 35.0 26.2 35.0 130-134 31.375850000000003 34.0 31.4 35.0 24.8 35.0 135-139 30.671999999999997 34.0 30.8 35.0 23.0 35.0 140-144 29.1548 33.4 28.8 35.0 13.6 35.0 145-149 27.593849999999996 33.0 27.4 34.4 2.0 35.0 150 21.60225 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 3.0 13 2.0 14 8.0 15 3.0 16 5.0 17 4.0 18 2.0 19 8.0 20 7.0 21 5.0 22 9.0 23 10.0 24 10.0 25 16.0 26 19.0 27 29.0 28 37.0 29 46.0 30 72.0 31 74.0 32 143.0 33 207.0 34 324.0 35 598.0 36 1312.0 37 1038.0 38 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.50968399592253 17.889908256880734 18.883792048929664 37.71661569826708 2 20.1 28.125 36.1 15.675 3 16.8 31.4 25.35 26.450000000000003 4 18.6 39.550000000000004 20.525 21.325 5 19.950000000000003 36.825 24.125 19.1 6 16.475 35.6 24.675 23.25 7 12.325 19.575 46.375 21.725 8 19.7 20.625 26.3 33.375 9 18.15 21.55 30.575000000000003 29.725 10-14 19.805 30.070000000000004 25.835 24.29 15-19 19.61 28.77 27.305 24.315 20-24 20.31 28.42 27.72 23.549999999999997 25-29 20.205000000000002 29.060000000000002 27.16 23.575 30-34 20.44 28.4 27.495000000000005 23.665 35-39 19.775000000000002 28.62 27.62 23.985 40-44 20.685000000000002 28.335 27.62 23.36 45-49 20.76 28.37 27.21 23.66 50-54 20.325 28.67 27.355 23.65 55-59 20.27 28.525 27.355 23.849999999999998 60-64 20.830000000000002 28.645 26.784999999999997 23.74 65-69 20.84 28.199999999999996 27.150000000000002 23.810000000000002 70-74 20.72 28.499999999999996 27.450000000000003 23.330000000000002 75-79 20.369999999999997 28.465 27.11 24.055 80-84 20.31 28.925 27.325 23.44 85-89 20.59 28.12 26.790000000000003 24.5 90-94 21.26 28.470000000000002 26.674999999999997 23.595 95-99 20.84 28.494999999999997 27.305 23.36 100-104 20.380000000000003 28.32 27.775 23.525 105-109 20.29 28.244999999999997 27.334999999999997 24.13 110-114 20.836041802090104 28.361418070903543 27.42137106855343 23.381169058452922 115-119 21.235 27.395000000000003 27.865000000000002 23.505000000000003 120-124 21.125 27.689999999999998 27.355 23.830000000000002 125-129 21.395 27.884999999999998 27.51 23.21 130-134 21.349999999999998 28.494999999999997 26.490000000000002 23.665 135-139 21.375 27.589999999999996 27.29 23.745 140-144 21.005 27.41 27.950000000000003 23.635 145-149 21.23 29.175 26.490000000000002 23.105 150 9.700000000000001 34.150000000000006 28.000000000000004 28.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 2.0 24 1.0 25 3.5 26 5.5 27 6.0 28 10.5 29 16.5 30 20.5 31 22.0 32 35.0 33 46.0 34 48.5 35 65.5 36 91.5 37 104.0 38 124.0 39 157.0 40 192.5 41 224.0 42 241.0 43 256.5 44 267.0 45 265.0 46 259.5 47 252.0 48 229.0 49 210.5 50 181.0 51 142.0 52 116.0 53 93.5 54 82.0 55 56.0 56 30.0 57 28.0 58 25.0 59 21.5 60 18.0 61 13.5 62 10.0 63 7.0 64 6.0 65 4.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9125 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATAGGC 10 0.006973645 144.0 1 AGGCATC 10 0.006973645 144.0 4 >>END_MODULE SRR3727125 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.844 34.0 31.0 34.0 30.0 34.0 2 32.29575 34.0 31.0 34.0 31.0 34.0 3 32.28975 34.0 31.0 34.0 31.0 34.0 4 35.8185 37.0 37.0 37.0 35.0 37.0 5 35.8375 37.0 37.0 37.0 35.0 37.0 6 35.842 37.0 37.0 37.0 35.0 37.0 7 35.7655 37.0 37.0 37.0 35.0 37.0 8 35.7805 37.0 37.0 37.0 35.0 37.0 9 37.55525 39.0 39.0 39.0 37.0 39.0 10-14 37.851749999999996 39.4 39.0 39.4 36.4 39.4 15-19 39.0039 41.0 40.0 41.0 36.8 41.0 20-24 38.866499999999995 41.0 39.8 41.0 36.4 41.0 25-29 38.69145 41.0 39.0 41.0 36.0 41.0 30-34 38.5229 40.4 38.8 41.0 35.6 41.0 35-39 38.3507 40.0 38.0 41.0 34.8 41.0 40-44 38.077149999999996 40.0 38.0 41.0 34.6 41.0 45-49 37.761449999999996 40.0 38.0 41.0 33.4 41.0 50-54 37.294599999999996 39.6 37.4 40.4 33.2 40.8 55-59 37.318 39.8 37.0 41.0 32.8 41.0 60-64 37.20395 39.4 36.4 41.0 33.0 41.0 65-69 36.496249999999996 38.4 35.2 40.4 32.6 41.0 70-74 35.5067 36.6 35.0 39.0 32.0 40.6 75-79 34.47215 35.4 34.8 37.2 31.2 39.0 80-84 33.60615 35.0 34.0 36.0 30.4 37.0 85-89 32.96105 35.0 34.0 35.2 29.8 36.2 90-94 32.537099999999995 35.0 33.8 35.0 29.0 35.4 95-99 32.1522 35.0 33.4 35.0 27.6 35.0 100-104 31.863800000000005 35.0 33.0 35.0 25.8 35.0 105-109 31.788849999999996 34.8 32.8 35.0 25.8 35.0 110-114 31.1493 34.2 31.8 35.0 23.6 35.0 115-119 31.106749999999998 34.0 31.6 35.0 24.4 35.0 120-124 30.682300000000005 34.0 30.8 35.0 22.6 35.0 125-129 30.28745 34.0 30.8 35.0 20.2 35.0 130-134 29.751800000000003 34.0 29.8 35.0 18.0 35.0 135-139 29.370349999999995 34.0 29.4 35.0 13.4 35.0 140-144 28.375350000000005 33.2 27.8 35.0 3.0 35.0 145-149 27.476499999999998 33.0 27.4 34.8 2.0 35.0 150 23.58575 29.0 18.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 71.0 3 3.0 4 3.0 5 3.0 6 4.0 7 4.0 8 5.0 9 3.0 10 4.0 11 3.0 12 8.0 13 2.0 14 5.0 15 8.0 16 4.0 17 8.0 18 5.0 19 17.0 20 7.0 21 11.0 22 16.0 23 11.0 24 21.0 25 23.0 26 28.0 27 26.0 28 24.0 29 62.0 30 65.0 31 96.0 32 149.0 33 192.0 34 326.0 35 600.0 36 1265.0 37 913.0 38 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.2 14.05 20.25 34.5 2 25.674999999999997 22.525000000000002 35.425000000000004 16.375 3 20.849999999999998 26.825 28.875 23.45 4 22.125 35.675000000000004 21.375 20.825 5 23.525 34.525 23.05 18.9 6 18.625 36.225 24.175 20.974999999999998 7 16.625 14.825 45.9 22.650000000000002 8 21.3 21.099999999999998 26.55 31.05 9 20.849999999999998 23.525 28.725 26.900000000000002 10-14 22.05 28.835 26.775 22.34 15-19 22.725 27.875 27.775 21.625 20-24 22.66 27.860000000000003 28.115000000000002 21.365000000000002 25-29 23.24 28.634999999999998 26.705000000000002 21.42 30-34 21.81 27.975 27.955000000000002 22.259999999999998 35-39 22.71 28.055000000000003 27.229999999999997 22.005 40-44 22.275 27.67 28.249999999999996 21.805 45-49 22.93 27.36 28.09 21.62 50-54 22.37 26.924999999999997 28.51 22.195 55-59 22.735 27.26 28.09 21.915000000000003 60-64 22.98 27.72 27.565 21.735 65-69 22.78 28.055000000000003 27.889999999999997 21.275 70-74 22.97 27.855 27.685 21.490000000000002 75-79 23.330000000000002 27.045 28.199999999999996 21.425 80-84 23.49 27.32 27.735 21.455 85-89 23.66 27.395000000000003 27.765 21.18 90-94 23.32 28.1 27.35 21.23 95-99 23.494999999999997 27.96 27.485 21.060000000000002 100-104 23.575 28.16 27.425 20.84 105-109 23.515 27.515 27.955000000000002 21.015 110-114 23.445 27.794999999999998 27.87 20.89 115-119 23.32 27.62 27.605 21.455 120-124 23.86 27.49 27.87 20.78 125-129 23.907390739073907 27.482748274827486 27.42774277427743 21.182118211821184 130-134 24.015 27.055 28.22 20.71 135-139 23.98 27.195000000000004 28.215 20.61 140-144 24.37 27.73 27.61 20.29 145-149 24.375 27.515 27.595 20.515 150 25.525 29.299999999999997 25.474999999999998 19.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 1.0 10 1.5 11 1.0 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 1.5 18 1.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.5 24 2.5 25 2.0 26 3.5 27 8.0 28 7.5 29 9.5 30 13.0 31 18.5 32 26.0 33 31.5 34 39.5 35 53.0 36 65.0 37 93.5 38 127.0 39 150.0 40 177.0 41 203.5 42 238.5 43 256.5 44 259.5 45 287.0 46 304.5 47 274.5 48 244.0 49 206.0 50 160.5 51 140.5 52 122.0 53 103.5 54 84.5 55 54.5 56 41.5 57 41.5 58 31.5 59 29.0 60 22.5 61 11.5 62 10.5 63 8.5 64 6.5 65 5.0 66 3.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.8374999999999999 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.5499999999999998 0.0 0.0 0.0 0.0 138 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCAAA 10 0.006973645 144.0 6 >>END_MODULE Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736411 spots for SRR3727125.sra Written 736411 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra Read 736393 spots for SRR3727125.sra Written 736393 spots for SRR3727125.sra SRR ids: ['SRR3727125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ndvau4b SRR3727125.sra spots: 14727878 blocks: [[1, 736393], [736394, 1472786], [1472787, 2209179], [2209180, 2945572], [2945573, 3681965], [3681966, 4418358], [4418359, 5154751], [5154752, 5891144], [5891145, 6627537], [6627538, 7363930], [7363931, 8100323], [8100324, 8836716], [8836717, 9573109], [9573110, 10309502], [10309503, 11045895], [11045896, 11782288], [11782289, 12518681], [12518682, 13255074], [13255075, 13991467], [13991468, 14727878]] SRR3727125 file size 4940328 SRR3727125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727125 SRR3727125_1.fastq SRR3727125_2.fastq Input file: SRR3727125_1.fastq Paired file: SRR3727125_2.fastq trimmed: SRR3727125-trimmed-pair1.fastq, SRR3727125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:29:47 2025 >> started Fri Feb 14 10:30:03 2025 >> done (16.350s) 14727878 read pairs processed; of these: 57177 ( 0.39%) short read pairs filtered out after trimming by size control 241975 ( 1.64%) empty read pairs filtered out after trimming by size control 14428726 (97.97%) read pairs available; of these: 5994358 (41.54%) trimmed read pairs available after processing 8434368 (58.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 6 0.00% 21 8 0.00% 22 10 0.00% 23 19 0.00% 24 24 0.00% 25 25 0.00% 26 33 0.00% 27 40 0.00% 28 38 0.00% 29 53 0.00% 30 87 0.00% 31 70 0.00% 32 75 0.00% 33 92 0.00% 34 126 0.00% 35 147 0.00% 36 151 0.00% 37 179 0.00% 38 176 0.00% 39 216 0.00% 40 229 0.00% 41 275 0.00% 42 264 0.00% 43 310 0.00% 44 377 0.00% 45 374 0.00% 46 374 0.00% 47 442 0.00% 48 439 0.00% 49 555 0.00% 50 561 0.00% 51 549 0.00% 52 587 0.00% 53 638 0.00% 54 685 0.00% 55 787 0.01% 56 771 0.01% 57 799 0.01% 58 822 0.01% 59 887 0.01% 60 982 0.01% 61 996 0.01% 62 1108 0.01% 63 1093 0.01% 64 1251 0.01% 65 1317 0.01% 66 1378 0.01% 67 1475 0.01% 68 1623 0.01% 69 1730 0.01% 70 1898 0.01% 71 1960 0.01% 72 2089 0.01% 73 2405 0.02% 74 2514 0.02% 75 2825 0.02% 76 3028 0.02% 77 3202 0.02% 78 3550 0.02% 79 3877 0.03% 80 4188 0.03% 81 4431 0.03% 82 4580 0.03% 83 4952 0.03% 84 8084 0.06% 85 7920 0.05% 86 8311 0.06% 87 8827 0.06% 88 8858 0.06% 89 9073 0.06% 90 9503 0.07% 91 11116 0.08% 92 10357 0.07% 93 10626 0.07% 94 11025 0.08% 95 12230 0.08% 96 11803 0.08% 97 12036 0.08% 98 12009 0.08% 99 12502 0.09% 100 12268 0.09% 101 13160 0.09% 102 17194 0.12% 103 13164 0.09% 104 13120 0.09% 105 18048 0.13% 106 14302 0.10% 107 15409 0.11% 108 16094 0.11% 109 28699 0.20% 110 17215 0.12% 111 16212 0.11% 112 17160 0.12% 113 16814 0.12% 114 19633 0.14% 115 37718 0.26% 116 17690 0.12% 117 16740 0.12% 118 17810 0.12% 119 17398 0.12% 120 17679 0.12% 121 19821 0.14% 122 20127 0.14% 123 21396 0.15% 124 25552 0.18% 125 39374 0.27% 126 32202 0.22% 127 26405 0.18% 128 26181 0.18% 129 30333 0.21% 130 33966 0.24% 131 32091 0.22% 132 38083 0.26% 133 72179 0.50% 134 64121 0.44% 135 56737 0.39% 136 75800 0.53% 137 95051 0.66% 138 90733 0.63% 139 98759 0.68% 140 106004 0.73% 141 119625 0.83% 142 136644 0.95% 143 160152 1.11% 144 185695 1.29% 145 230014 1.59% 146 290559 2.01% 147 411474 2.85% 148 642145 4.45% 149 2204568 15.28% 150 8434368 58.46% 14428726 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.0 sequence=TCACTCCTGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=358.70 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=35.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=33 prefix-density=0.16 prefix-fanout=2.2 sequence=ACCTACATAAACTCTTACGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=405.45 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=33.9 sequence=AAGAAGAAGAAA SRR3727125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:30:47 Started mapping on | Feb 14 10:30:47 Finished on | Feb 14 10:32:17 Mapping speed, Million of reads per hour | 577.15 Number of input reads | 14428726 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13729332 Uniquely mapped reads % | 95.15% Average mapped length | 291.91 Number of splices: Total | 13572003 Number of splices: Annotated (sjdb) | 13330346 Number of splices: GT/AG | 13325020 Number of splices: GC/AG | 211359 Number of splices: AT/AC | 11629 Number of splices: Non-canonical | 23995 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456931 % of reads mapped to multiple loci | 3.17% Number of reads mapped to too many loci | 39247 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 255732 255732 255732 N_multimapping 456931 456931 456931 N_noFeature 367271 13591366 430728 N_ambiguous 145089 742 70099 UnstrandedReadsAssigned:13216972 PositiveStrandReadsAssigned:137224 NegativeStrandReadsAssigned:13228505 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727125-trimmed-pair1.fastq SRR3727125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,428,726 reads, 13,456,401 reads pseudoaligned [quant] estimated average fragment length: 252.388 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR3727125.ke.tsv 34699 SRR3727125.se.tsv 87100 total ==> SRR3727125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.61 385 13.8327 Potri.005G024800.1.v4.1 1035 783.612 48 3.88802 Potri.004G059700.1.v4.1 961 709.674 32 2.86206 Potri.007G009000.2.v4.1 1416 1164.61 4 0.218005 Potri.003G141000.2.v4.1 2943 2691.61 453 10.6825 Potri.016G087400.1.v4.1 270 73.6966 1107.53 953.884 Potri.015G069301.1.v4.1 564 318.012 0 0 Potri.010G195200.1.v4.1 1773 1521.61 7 0.292 Potri.012G127500.1.v4.1 977 725.652 1897 165.931 ==> SRR3727125.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 356 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 SRR3727125 completed mapping pipeline successfully