Starting /dee2/code/volunteer_pipeline.sh SRR3727126 current disk space = 3115333476352 free memory = 1568507140 SRR3727126 SRAfilesize ad828d0364c320edc85257a8ed3896b5 SRR3727126.sra SRR3727126.sra file validated SRR3727126 is paired end SRR3727126 is conventional basespace SRR3727126 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.778 34.0 33.0 34.0 31.0 34.0 2 33.0675 34.0 34.0 34.0 31.0 34.0 3 33.2675 34.0 34.0 34.0 31.0 34.0 4 36.584 37.0 37.0 37.0 35.0 37.0 5 36.57875 37.0 37.0 37.0 35.0 37.0 6 36.575 37.0 37.0 37.0 35.0 37.0 7 36.567 37.0 37.0 37.0 35.0 37.0 8 36.60125 37.0 37.0 37.0 35.0 37.0 9 38.427 39.0 39.0 39.0 37.0 39.0 10-14 38.72395 39.4 39.2 39.4 37.2 39.4 15-19 39.93025 41.0 40.0 41.0 38.0 41.0 20-24 39.87765 41.0 40.0 41.0 38.0 41.0 25-29 39.45145 40.6 39.2 41.0 37.0 41.0 30-34 39.2646 40.2 39.0 41.0 36.4 41.0 35-39 39.18115 40.0 38.6 41.0 36.2 41.0 40-44 39.2506 40.0 39.0 41.0 36.4 41.0 45-49 39.4975 41.0 39.6 41.0 36.6 41.0 50-54 39.2178 40.4 39.0 41.0 36.0 41.0 55-59 38.7629 40.0 38.0 41.0 35.0 41.0 60-64 38.22579999999999 39.8 37.0 41.0 34.4 41.0 65-69 37.611900000000006 38.8 36.0 40.6 34.0 41.0 70-74 36.62285 37.2 35.0 39.4 33.6 40.8 75-79 35.32395 35.6 34.6 37.4 32.2 39.2 80-84 34.779500000000006 35.0 34.8 36.4 32.2 37.6 85-89 34.2519 35.0 34.0 35.6 32.0 36.4 90-94 33.8175 35.0 34.0 35.0 31.6 35.8 95-99 33.3586 35.0 34.0 35.0 30.6 35.0 100-104 33.17865 35.0 33.8 35.0 29.8 35.0 105-109 32.859300000000005 35.0 33.4 35.0 29.2 35.0 110-114 32.843450000000004 35.0 33.0 35.0 29.4 35.0 115-119 32.3481 34.0 33.0 35.0 27.8 35.0 120-124 31.97785 34.0 32.2 35.0 26.6 35.0 125-129 31.789099999999998 34.0 32.0 35.0 25.8 35.0 130-134 31.217350000000003 34.0 31.2 35.0 24.6 35.0 135-139 30.62145 34.0 30.6 35.0 23.2 35.0 140-144 28.95955 33.2 28.8 34.8 11.2 35.0 145-149 27.1923 33.0 26.2 34.2 2.0 35.0 150 21.0705 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 2.0 10 2.0 11 2.0 12 0.0 13 3.0 14 3.0 15 3.0 16 4.0 17 3.0 18 2.0 19 3.0 20 4.0 21 7.0 22 12.0 23 10.0 24 23.0 25 11.0 26 24.0 27 44.0 28 32.0 29 48.0 30 47.0 31 94.0 32 119.0 33 180.0 34 305.0 35 652.0 36 1400.0 37 955.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.234117944824096 16.40091116173121 19.23563654770944 39.12933434573526 2 18.55 26.35 37.574999999999996 17.525 3 16.950000000000003 30.675 25.2 27.175 4 19.925 38.925 20.175 20.974999999999998 5 19.7 37.6 23.75 18.95 6 16.900000000000002 36.25 25.25 21.6 7 12.625 19.35 46.550000000000004 21.475 8 19.575 19.925 28.449999999999996 32.05 9 17.775 20.849999999999998 31.65 29.725 10-14 19.45 30.695 25.915 23.94 15-19 19.27 29.145 27.625 23.96 20-24 19.905 29.080000000000002 27.529999999999998 23.485 25-29 19.695 28.92 27.925 23.46 30-34 20.36 29.165000000000003 27.384999999999998 23.09 35-39 20.195 28.875 27.295 23.635 40-44 20.24 29.265 27.105 23.39 45-49 20.380000000000003 28.910000000000004 27.305 23.405 50-54 20.395 28.349999999999998 27.889999999999997 23.365 55-59 20.495 28.999999999999996 26.875 23.630000000000003 60-64 20.72 28.655 27.339999999999996 23.285 65-69 20.145 28.735 27.79 23.330000000000002 70-74 20.365 29.015 27.16 23.46 75-79 20.465 28.12 27.58 23.835 80-84 20.36 28.565 27.29 23.785 85-89 20.53 28.625 27.68 23.165 90-94 20.599999999999998 28.52 27.37 23.51 95-99 20.59 27.825 27.894999999999996 23.69 100-104 20.89 27.98 27.72 23.41 105-109 20.505000000000003 28.29 27.98 23.225 110-114 21.15 28.175 27.639999999999997 23.035 115-119 21.025 28.560000000000002 27.37 23.044999999999998 120-124 20.855 28.205000000000002 27.939999999999998 23.0 125-129 21.205 28.17 27.375 23.25 130-134 21.695 27.534999999999997 27.794999999999998 22.975 135-139 21.240000000000002 28.51 27.495000000000005 22.755 140-144 21.349999999999998 28.915000000000003 27.01 22.725 145-149 21.98 29.18 26.235000000000003 22.605 150 10.75 34.375 27.575 27.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 4.5 26 7.0 27 6.5 28 6.5 29 10.5 30 19.5 31 31.0 32 36.5 33 43.0 34 62.0 35 81.5 36 96.0 37 117.5 38 140.0 39 159.5 40 183.5 41 225.0 42 266.5 43 281.0 44 287.0 45 283.0 46 263.5 47 254.5 48 236.0 49 186.0 50 145.0 51 123.5 52 97.0 53 75.0 54 66.5 55 55.0 56 37.5 57 23.5 58 18.0 59 16.0 60 10.0 61 8.0 62 11.0 63 8.5 64 3.0 65 0.5 66 0.5 67 2.5 68 4.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.7625 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAAA 10 0.006973645 144.0 8 ATTTTGA 10 0.006973645 144.0 4 CAAAAAC 10 0.006973645 144.0 9 >>END_MODULE SRR3727126 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.714 34.0 31.0 34.0 30.0 34.0 2 32.221 34.0 31.0 34.0 31.0 34.0 3 32.246 34.0 31.0 34.0 31.0 34.0 4 35.70725 37.0 37.0 37.0 35.0 37.0 5 35.67875 37.0 37.0 37.0 35.0 37.0 6 35.6955 37.0 37.0 37.0 35.0 37.0 7 35.69725 37.0 37.0 37.0 35.0 37.0 8 35.6785 37.0 37.0 37.0 35.0 37.0 9 37.48575 39.0 39.0 39.0 37.0 39.0 10-14 37.6757 39.4 38.8 39.4 36.4 39.4 15-19 38.87295 41.0 40.0 41.0 36.4 41.0 20-24 38.7608 41.0 39.6 41.0 36.4 41.0 25-29 38.5546 40.8 39.0 41.0 35.6 41.0 30-34 38.4694 40.2 38.8 41.0 35.6 41.0 35-39 38.26585 40.0 38.0 41.0 35.0 41.0 40-44 37.984500000000004 40.0 38.0 41.0 34.4 41.0 45-49 37.670100000000005 40.0 38.0 41.0 33.4 41.0 50-54 37.15415 39.6 37.4 40.4 32.6 40.8 55-59 37.1805 39.8 36.8 41.0 32.4 41.0 60-64 37.1161 39.4 36.4 41.0 32.8 41.0 65-69 36.4543 38.6 35.4 40.4 32.4 41.0 70-74 35.518699999999995 36.8 35.0 39.2 31.6 40.8 75-79 34.4613 35.6 34.8 37.4 30.8 39.2 80-84 33.524950000000004 35.0 34.0 36.2 30.0 37.4 85-89 32.87365 35.0 34.0 35.2 29.2 36.2 90-94 32.36275 35.0 34.0 35.0 29.0 35.8 95-99 31.98865 35.0 33.0 35.0 26.4 35.0 100-104 31.7468 35.0 33.0 35.0 25.8 35.0 105-109 31.6244 35.0 33.0 35.0 25.4 35.0 110-114 31.012 34.4 31.8 35.0 22.4 35.0 115-119 30.94185 34.0 31.8 35.0 23.4 35.0 120-124 30.574099999999998 34.0 31.2 35.0 21.6 35.0 125-129 30.30065 34.0 31.0 35.0 19.0 35.0 130-134 29.74165 34.0 29.8 35.0 17.8 35.0 135-139 29.34115 34.0 29.2 35.0 10.6 35.0 140-144 28.60335 33.4 28.6 35.0 3.0 35.0 145-149 27.68245 33.0 28.2 34.8 2.0 35.0 150 23.48425 29.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 76.0 3 4.0 4 6.0 5 3.0 6 1.0 7 4.0 8 4.0 9 4.0 10 1.0 11 5.0 12 4.0 13 8.0 14 10.0 15 9.0 16 8.0 17 14.0 18 7.0 19 10.0 20 12.0 21 10.0 22 14.0 23 19.0 24 15.0 25 19.0 26 31.0 27 22.0 28 40.0 29 54.0 30 63.0 31 88.0 32 116.0 33 197.0 34 288.0 35 621.0 36 1297.0 37 912.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.1 12.575 21.0 38.324999999999996 2 23.724999999999998 21.3 38.625 16.35 3 19.575 25.55 30.349999999999998 24.525 4 23.849999999999998 34.050000000000004 22.1 20.0 5 23.849999999999998 35.825 22.35 17.974999999999998 6 16.7 38.074999999999996 23.974999999999998 21.25 7 15.55 14.649999999999999 48.35 21.45 8 21.55 20.325 27.900000000000002 30.225 9 21.725 24.45 28.1 25.724999999999998 10-14 22.13 28.444999999999997 27.115000000000002 22.31 15-19 22.259999999999998 27.584999999999997 28.565 21.59 20-24 22.39 27.655 28.735 21.22 25-29 22.55 28.09 28.21 21.15 30-34 21.715 27.855 28.854999999999997 21.575 35-39 22.24 28.475 27.855 21.43 40-44 22.38 28.025 27.72 21.875 45-49 22.5 27.474999999999998 28.410000000000004 21.615000000000002 50-54 22.465 27.735 28.199999999999996 21.6 55-59 22.88 27.85 27.810000000000002 21.46 60-64 22.43 27.860000000000003 28.18 21.529999999999998 65-69 22.689999999999998 28.17 28.095 21.044999999999998 70-74 22.805 27.584999999999997 28.37 21.240000000000002 75-79 22.67 27.505000000000003 28.365000000000002 21.46 80-84 22.795 27.134999999999998 28.560000000000002 21.51 85-89 23.425 27.58 27.985 21.01 90-94 23.335 27.47 28.345 20.849999999999998 95-99 23.235 28.21 27.24 21.315 100-104 23.400000000000002 27.560000000000002 27.965 21.075 105-109 22.905 27.185 28.860000000000003 21.05 110-114 23.265 27.85 27.985 20.9 115-119 23.52 27.450000000000003 28.095 20.935000000000002 120-124 23.27 27.779999999999998 27.74 21.21 125-129 23.25232523252325 27.687768776877686 28.027802780278027 21.032103210321033 130-134 23.735 27.794999999999998 27.66 20.810000000000002 135-139 23.22 27.955000000000002 27.88 20.945 140-144 23.990000000000002 28.01 27.439999999999998 20.560000000000002 145-149 24.525 28.15 27.089999999999996 20.235 150 22.3 28.4 27.500000000000004 21.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 2.5 25 5.0 26 4.5 27 4.5 28 11.0 29 15.0 30 13.5 31 16.5 32 24.0 33 33.5 34 49.0 35 68.0 36 84.5 37 110.5 38 140.5 39 156.5 40 186.5 41 231.5 42 261.0 43 268.0 44 273.5 45 282.5 46 264.0 47 246.0 48 240.5 49 205.0 50 168.5 51 138.0 52 108.5 53 92.0 54 66.0 55 44.0 56 35.0 57 30.0 58 24.0 59 16.5 60 12.0 61 10.5 62 12.0 63 12.0 64 5.5 65 1.5 66 1.0 67 1.0 68 2.5 69 2.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.38749999999999996 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.7625 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTG 10 0.006973645 144.0 2 TTTTATT 10 0.006973645 144.0 2 TCTGATG 10 0.006973645 144.0 2 TCAGAAA 10 0.006973645 144.0 2 >>END_MODULE Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887609 spots for SRR3727126.sra Written 887609 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra Read 887596 spots for SRR3727126.sra Written 887596 spots for SRR3727126.sra SRR ids: ['SRR3727126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l3oqrtth SRR3727126.sra spots: 17751933 blocks: [[1, 887596], [887597, 1775192], [1775193, 2662788], [2662789, 3550384], [3550385, 4437980], [4437981, 5325576], [5325577, 6213172], [6213173, 7100768], [7100769, 7988364], [7988365, 8875960], [8875961, 9763556], [9763557, 10651152], [10651153, 11538748], [11538749, 12426344], [12426345, 13313940], [13313941, 14201536], [14201537, 15089132], [15089133, 15976728], [15976729, 16864324], [16864325, 17751933]] SRR3727126 file size 5959175 SRR3727126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727126 SRR3727126_1.fastq SRR3727126_2.fastq Input file: SRR3727126_1.fastq Paired file: SRR3727126_2.fastq trimmed: SRR3727126-trimmed-pair1.fastq, SRR3727126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:36:21 2025 >> started Fri Feb 14 10:36:41 2025 >> done (19.203s) 17751933 read pairs processed; of these: 74685 ( 0.42%) short read pairs filtered out after trimming by size control 268001 ( 1.51%) empty read pairs filtered out after trimming by size control 17409247 (98.07%) read pairs available; of these: 7345978 (42.20%) trimmed read pairs available after processing 10063269 (57.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 12 0.00% 22 19 0.00% 23 23 0.00% 24 25 0.00% 25 28 0.00% 26 53 0.00% 27 63 0.00% 28 75 0.00% 29 154 0.00% 30 93 0.00% 31 125 0.00% 32 123 0.00% 33 158 0.00% 34 204 0.00% 35 226 0.00% 36 250 0.00% 37 273 0.00% 38 309 0.00% 39 303 0.00% 40 394 0.00% 41 449 0.00% 42 482 0.00% 43 509 0.00% 44 499 0.00% 45 603 0.00% 46 653 0.00% 47 690 0.00% 48 714 0.00% 49 790 0.00% 50 753 0.00% 51 898 0.01% 52 954 0.01% 53 1011 0.01% 54 1074 0.01% 55 1065 0.01% 56 1127 0.01% 57 1275 0.01% 58 1351 0.01% 59 1403 0.01% 60 1428 0.01% 61 1405 0.01% 62 1667 0.01% 63 1757 0.01% 64 1754 0.01% 65 1862 0.01% 66 2037 0.01% 67 2162 0.01% 68 2365 0.01% 69 2508 0.01% 70 2627 0.02% 71 2839 0.02% 72 3138 0.02% 73 3316 0.02% 74 3457 0.02% 75 3866 0.02% 76 4113 0.02% 77 4256 0.02% 78 4695 0.03% 79 5024 0.03% 80 5238 0.03% 81 5473 0.03% 82 5754 0.03% 83 6376 0.04% 84 10459 0.06% 85 10715 0.06% 86 11242 0.06% 87 12192 0.07% 88 12609 0.07% 89 12782 0.07% 90 13169 0.08% 91 14158 0.08% 92 15020 0.09% 93 15119 0.09% 94 15536 0.09% 95 15877 0.09% 96 16264 0.09% 97 16926 0.10% 98 17685 0.10% 99 18149 0.10% 100 16899 0.10% 101 17817 0.10% 102 24004 0.14% 103 19004 0.11% 104 19666 0.11% 105 23487 0.13% 106 23829 0.14% 107 22990 0.13% 108 23252 0.13% 109 24904 0.14% 110 25350 0.15% 111 22121 0.13% 112 22935 0.13% 113 26348 0.15% 114 27754 0.16% 115 42514 0.24% 116 24263 0.14% 117 22819 0.13% 118 23626 0.14% 119 24381 0.14% 120 25343 0.15% 121 31819 0.18% 122 39718 0.23% 123 29819 0.17% 124 27733 0.16% 125 28264 0.16% 126 32578 0.19% 127 34576 0.20% 128 34898 0.20% 129 39501 0.23% 130 53387 0.31% 131 46578 0.27% 132 51274 0.29% 133 69358 0.40% 134 81288 0.47% 135 72831 0.42% 136 80727 0.46% 137 95250 0.55% 138 106469 0.61% 139 121714 0.70% 140 134563 0.77% 141 145600 0.84% 142 166043 0.95% 143 182924 1.05% 144 221360 1.27% 145 279283 1.60% 146 362635 2.08% 147 506435 2.91% 148 789789 4.54% 149 2650020 15.22% 150 10063269 57.80% 17409247 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.17 sequence-density-rank=6 fanout-score=11.66 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=3.0 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=31 prefix-density=0.45 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=22.75 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.2 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGAT SRR3727126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:37:25 Started mapping on | Feb 14 10:37:26 Finished on | Feb 14 10:39:33 Mapping speed, Million of reads per hour | 493.49 Number of input reads | 17409247 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16534728 Uniquely mapped reads % | 94.98% Average mapped length | 291.33 Number of splices: Total | 14915781 Number of splices: Annotated (sjdb) | 14631831 Number of splices: GT/AG | 14682242 Number of splices: GC/AG | 191703 Number of splices: AT/AC | 11959 Number of splices: Non-canonical | 29877 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404334 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 39177 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 486244 486244 486244 N_multimapping 404334 404334 404334 N_noFeature 613986 16318475 746348 N_ambiguous 180355 1500 95370 UnstrandedReadsAssigned:15740387 PositiveStrandReadsAssigned:214753 NegativeStrandReadsAssigned:15693010 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727126-trimmed-pair1.fastq SRR3727126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,409,247 reads, 15,785,081 reads pseudoaligned [quant] estimated average fragment length: 263.16 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR3727126.ke.tsv 34699 SRR3727126.se.tsv 87100 total ==> SRR3727126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.84 1509 52.5622 Potri.005G024800.1.v4.1 1035 772.84 437 34.5829 Potri.004G059700.1.v4.1 961 698.903 16 1.40014 Potri.007G009000.2.v4.1 1416 1153.84 0 0 Potri.003G141000.2.v4.1 2943 2680.84 578.182 13.1906 Potri.016G087400.1.v4.1 270 70.4776 511 443.445 Potri.015G069301.1.v4.1 564 309.333 0 0 Potri.010G195200.1.v4.1 1773 1510.84 307 12.4277 Potri.012G127500.1.v4.1 977 714.877 13256 1134.1 ==> SRR3727126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 203 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 360 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 58 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 229 SRR3727126 completed mapping pipeline successfully