Starting /dee2/code/volunteer_pipeline.sh SRR3727127 current disk space = 2822970322944 free memory = 1581274920 SRR3727127 SRAfilesize 4ff25f11fcf64262f485342e4debe791 SRR3727127.sra SRR3727127.sra file validated SRR3727127 is paired end SRR3727127 is conventional basespace SRR3727127 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.395 34.0 31.0 34.0 31.0 34.0 2 32.85325 34.0 33.0 34.0 31.0 34.0 3 33.10625 34.0 33.0 34.0 31.0 34.0 4 36.5425 37.0 37.0 37.0 35.0 37.0 5 36.46625 37.0 37.0 37.0 35.0 37.0 6 36.4435 37.0 37.0 37.0 35.0 37.0 7 36.49825 37.0 37.0 37.0 35.0 37.0 8 36.51325 37.0 37.0 37.0 35.0 37.0 9 38.33875 39.0 39.0 39.0 37.0 39.0 10-14 38.5724 39.4 39.2 39.4 37.2 39.4 15-19 39.691649999999996 41.0 39.8 41.0 37.6 41.0 20-24 39.68634999999999 41.0 39.8 41.0 37.4 41.0 25-29 39.32635 40.2 39.0 41.0 36.4 41.0 30-34 39.26865 40.0 39.0 41.0 36.0 41.0 35-39 39.14405 40.0 38.6 41.0 36.0 41.0 40-44 38.97545 40.0 38.0 41.0 35.2 41.0 45-49 38.85615 40.0 38.4 41.0 35.2 41.0 50-54 38.98715 40.0 38.6 41.0 35.0 41.0 55-59 38.5868 40.0 38.0 41.0 34.6 41.0 60-64 38.0138 39.6 36.8 41.0 34.0 41.0 65-69 37.24345 38.6 35.6 40.4 33.4 41.0 70-74 36.173100000000005 36.8 35.0 39.2 32.0 40.6 75-79 34.83975 35.2 34.0 37.4 30.8 39.0 80-84 34.4839 35.0 34.0 36.4 31.4 37.6 85-89 33.793850000000006 35.0 34.0 35.4 31.0 36.4 90-94 33.2952 35.0 34.0 35.0 30.0 35.8 95-99 32.88405 35.0 33.2 35.0 28.8 35.0 100-104 32.513200000000005 35.0 33.0 35.0 28.4 35.0 105-109 32.51899999999999 34.6 33.0 35.0 28.6 35.0 110-114 32.271550000000005 34.2 32.8 35.0 27.4 35.0 115-119 31.768649999999997 34.0 31.6 35.0 26.2 35.0 120-124 30.79045 34.0 30.6 35.0 22.8 35.0 125-129 30.17445 34.0 29.8 35.0 20.2 35.0 130-134 28.68965 33.4 28.2 35.0 10.0 35.0 135-139 28.278100000000002 33.0 27.0 34.6 6.8 35.0 140-144 26.32895 32.4 22.0 34.0 2.0 35.0 145-149 20.40085 26.8 2.6 34.0 2.0 35.0 150 13.87025 2.0 2.0 30.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 3.0 10 0.0 11 2.0 12 2.0 13 4.0 14 3.0 15 8.0 16 9.0 17 4.0 18 4.0 19 5.0 20 8.0 21 14.0 22 15.0 23 14.0 24 19.0 25 35.0 26 38.0 27 52.0 28 52.0 29 62.0 30 105.0 31 118.0 32 204.0 33 316.0 34 511.0 35 785.0 36 1142.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.987212276214834 17.74936061381074 12.327365728900256 34.93606138107417 2 17.45 25.8 40.050000000000004 16.7 3 16.579144786196547 31.357839459864966 28.207051762940733 23.85596399099775 4 21.075 37.1 22.650000000000002 19.175 5 20.4 37.574999999999996 24.2 17.825 6 16.35 35.75 26.150000000000002 21.75 7 12.725 20.599999999999998 45.800000000000004 20.875 8 17.4 20.05 29.099999999999998 33.45 9 17.45 21.45 30.75 30.349999999999998 10-14 19.57 30.15 26.484999999999996 23.794999999999998 15-19 19.794999999999998 28.744999999999997 28.249999999999996 23.21 20-24 19.595000000000002 29.445 27.534999999999997 23.425 25-29 20.16 29.28 27.400000000000002 23.16 30-34 20.265 29.26 27.139999999999997 23.335 35-39 19.78 28.849999999999998 27.525 23.845 40-44 19.985 28.84 27.815 23.36 45-49 20.355 28.82 27.279999999999998 23.544999999999998 50-54 20.26 28.875 28.17 22.695 55-59 20.44 28.939999999999998 27.365000000000002 23.255 60-64 20.335 28.365000000000002 27.534999999999997 23.765 65-69 20.32 28.525 27.22 23.935000000000002 70-74 20.13 28.48 27.68 23.71 75-79 20.25 28.610000000000003 27.045 24.095 80-84 20.015 28.77 28.060000000000002 23.155 85-89 20.44 29.099999999999998 27.439999999999998 23.02 90-94 20.715 28.535 27.265 23.485 95-99 20.495 28.215 27.925 23.365 100-104 20.455000000000002 28.595 27.500000000000004 23.45 105-109 20.055 27.87 27.955000000000002 24.12 110-114 20.125 28.665000000000003 27.495000000000005 23.715 115-119 20.735 27.845 28.23 23.189999999999998 120-124 20.485 28.32 27.54 23.655 125-129 20.32 28.54 27.650000000000002 23.49 130-134 19.564999999999998 28.54 28.110000000000003 23.785 135-139 20.849999999999998 28.535 27.02 23.595 140-144 20.064999999999998 28.294999999999998 27.725 23.915 145-149 18.935 29.94 27.73 23.395 150 7.825 36.025 28.475 27.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 3.0 23 3.0 24 3.5 25 2.5 26 4.0 27 7.5 28 10.0 29 17.5 30 22.0 31 32.0 32 47.5 33 50.5 34 55.0 35 72.0 36 102.0 37 133.0 38 155.0 39 167.0 40 195.5 41 241.5 42 258.5 43 247.5 44 260.0 45 272.0 46 250.5 47 227.5 48 200.5 49 183.0 50 169.0 51 160.0 52 126.0 53 87.0 54 64.0 55 39.0 56 29.0 57 23.0 58 18.0 59 14.0 60 12.0 61 6.0 62 4.0 63 6.5 64 7.5 65 3.5 66 0.5 67 0.5 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0125 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.037500000000000006 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.075 0.0 0.0 0.025 0.0 98-99 0.075 0.0 0.0 0.025 0.0 100-101 0.0875 0.0 0.0 0.025 0.0 102-103 0.1125 0.0 0.0 0.025 0.0 104-105 0.125 0.0 0.0 0.025 0.0 106-107 0.175 0.0 0.0 0.025 0.0 108-109 0.2 0.0 0.0 0.025 0.0 110-111 0.225 0.0 0.0 0.025 0.0 112-113 0.25 0.0 0.0 0.025 0.0 114-115 0.25 0.0 0.0 0.025 0.0 116-117 0.275 0.0 0.0 0.025 0.0 118-119 0.2875 0.0 0.0 0.025 0.0 120-121 0.3 0.0 0.0 0.025 0.0 122-123 0.3 0.0 0.0 0.025 0.0 124-125 0.3 0.0 0.0 0.025 0.0 126-127 0.375 0.0 0.0 0.025 0.0 128-129 0.375 0.0 0.0 0.025 0.0 130-131 0.4125 0.0 0.0 0.025 0.0 132-133 0.4625 0.0 0.0 0.025 0.0 134-135 0.675 0.0 0.0 0.025 0.0 136-137 0.8125 0.0 0.0 0.025 0.0 138 1.175 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATATCT 10 0.0069790767 143.96251 5 ATATCTA 10 0.0069790767 143.96251 6 >>END_MODULE SRR3727127 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3805 34.0 31.0 34.0 30.0 34.0 2 31.489 34.0 31.0 34.0 30.0 34.0 3 31.54025 34.0 31.0 34.0 30.0 34.0 4 34.867 37.0 35.0 37.0 35.0 37.0 5 34.95075 37.0 37.0 37.0 35.0 37.0 6 34.95425 37.0 37.0 37.0 35.0 37.0 7 34.95975 37.0 37.0 37.0 35.0 37.0 8 34.96 37.0 37.0 37.0 35.0 37.0 9 36.6325 39.0 38.0 39.0 35.0 39.0 10-14 36.84595 39.4 38.2 39.4 34.8 39.4 15-19 37.939800000000005 40.8 39.0 41.0 34.8 41.0 20-24 37.9236 40.6 39.0 41.0 34.8 41.0 25-29 37.52374999999999 40.0 38.2 41.0 33.2 41.0 30-34 37.4423 40.0 38.0 41.0 33.4 41.0 35-39 37.158350000000006 40.0 38.0 41.0 32.6 41.0 40-44 36.9816 40.0 38.0 41.0 32.6 41.0 45-49 36.50985 39.8 37.2 41.0 30.8 41.0 50-54 36.170249999999996 39.2 36.8 40.2 30.8 40.6 55-59 36.18575 39.2 36.2 40.8 30.6 41.0 60-64 36.1477 39.0 35.8 41.0 31.2 41.0 65-69 35.35095 37.8 35.0 40.0 30.2 41.0 70-74 34.257600000000004 36.4 34.4 38.8 28.8 40.4 75-79 33.309799999999996 35.2 34.0 37.0 28.0 39.0 80-84 32.4815 35.0 33.6 36.0 26.8 37.2 85-89 31.9317 35.0 33.0 35.0 26.4 36.2 90-94 31.331349999999997 35.0 32.4 35.0 24.4 35.4 95-99 31.025599999999997 34.4 32.0 35.0 23.8 35.0 100-104 30.750799999999998 34.0 32.0 35.0 21.2 35.0 105-109 30.471249999999998 34.0 31.2 35.0 19.2 35.0 110-114 30.0757 34.0 31.0 35.0 17.6 35.0 115-119 29.54005 34.0 30.0 35.0 11.0 35.0 120-124 29.0916 34.0 29.0 35.0 6.6 35.0 125-129 28.513749999999998 33.8 29.0 35.0 2.0 35.0 130-134 27.972 33.0 27.8 35.0 2.0 35.0 135-139 26.665700000000005 32.0 25.0 34.0 2.0 35.0 140-144 25.895699999999998 32.0 23.4 34.0 2.0 35.0 145-149 23.979999999999997 31.0 10.6 34.0 2.0 35.0 150 20.31 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 157.0 3 7.0 4 3.0 5 3.0 6 3.0 7 3.0 8 5.0 9 8.0 10 8.0 11 5.0 12 4.0 13 7.0 14 5.0 15 6.0 16 2.0 17 16.0 18 12.0 19 6.0 20 8.0 21 9.0 22 13.0 23 18.0 24 40.0 25 33.0 26 45.0 27 53.0 28 53.0 29 77.0 30 97.0 31 138.0 32 144.0 33 249.0 34 379.0 35 636.0 36 1176.0 37 568.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.625 14.875 14.625 30.875000000000004 2 23.025000000000002 23.400000000000002 36.6 16.975 3 22.45 25.025 29.4 23.125 4 24.099999999999998 35.9 20.65 19.35 5 23.3 37.375 21.55 17.775 6 17.974999999999998 37.525 24.325 20.175 7 17.525 15.55 44.675 22.25 8 20.1 20.075000000000003 28.299999999999997 31.525 9 23.674999999999997 22.5 28.349999999999998 25.474999999999998 10-14 22.07 28.99 26.645000000000003 22.295 15-19 22.725 28.299999999999997 28.095 20.880000000000003 20-24 22.915 28.49 27.634999999999998 20.96 25-29 22.46 28.810000000000002 28.4 20.330000000000002 30-34 21.8 27.79 29.14 21.27 35-39 22.830000000000002 27.465 28.335 21.37 40-44 22.715 27.825 28.575 20.885 45-49 22.845 27.49 28.52 21.145 50-54 22.195 28.455000000000002 28.325 21.025 55-59 22.71 27.83 28.48 20.979999999999997 60-64 22.965 27.315 28.199999999999996 21.52 65-69 23.32 27.16 28.455000000000002 21.065 70-74 23.119999999999997 26.900000000000002 28.765 21.215 75-79 22.605 27.93 28.560000000000002 20.905 80-84 23.080000000000002 28.205000000000002 28.08 20.635 85-89 23.119999999999997 28.110000000000003 28.345 20.424999999999997 90-94 22.435 28.02 28.255000000000003 21.29 95-99 22.91 28.77 27.950000000000003 20.369999999999997 100-104 23.445 27.735 27.815 21.005 105-109 23.255 27.425 28.585 20.735 110-114 23.435 27.76 28.17 20.635 115-119 22.915 27.944999999999997 28.23 20.91 120-124 22.935 27.715 28.634999999999998 20.715 125-129 23.1 28.585 27.66 20.655 130-134 23.40627973358706 27.71796284240573 28.008413040212325 20.86734438379488 135-139 23.721419975932612 28.103690332932207 27.97332531087044 20.20156438026474 140-144 23.096204943099213 28.079410437659796 27.923998596280143 20.900386022960845 145-149 23.86682711592459 28.479743281187325 27.181107099879664 20.472322503008424 150 25.540472599296127 27.32528908999497 26.21920563097034 20.915032679738562 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 1.0 12 1.5 13 1.5 14 1.5 15 1.0 16 1.0 17 3.0 18 4.0 19 3.0 20 2.0 21 2.5 22 3.0 23 3.5 24 4.0 25 3.0 26 7.0 27 9.5 28 10.0 29 10.5 30 13.5 31 19.0 32 24.5 33 40.5 34 53.5 35 69.5 36 86.0 37 101.0 38 134.5 39 171.5 40 199.0 41 216.5 42 228.0 43 252.5 44 271.0 45 270.5 46 265.0 47 266.0 48 236.5 49 191.0 50 178.5 51 146.0 52 105.0 53 86.0 54 69.0 55 57.5 56 50.5 57 32.0 58 19.0 59 15.5 60 10.5 61 10.5 62 7.5 63 3.0 64 3.5 65 5.5 66 4.0 67 1.5 68 1.5 69 1.0 70 0.5 71 1.0 72 1.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.155 135-139 0.27999999999999997 140-144 0.265 145-149 0.27999999999999997 150 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.375 0.0 0.0 0.0 0.0 130-131 0.42500000000000004 0.0 0.0 0.0 0.0 132-133 0.4875 0.0 0.0 0.0 0.0 134-135 0.75 0.0 0.0 0.0 0.0 136-137 0.9 0.0 0.0 0.0 0.0 138 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAATG 10 0.0070117936 143.7375 9 AATCCAG 10 0.0070117936 143.7375 5 CAAAGCC 10 0.0070117936 143.7375 1 TGAAAGC 10 0.0070117936 143.7375 2 >>END_MODULE Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819992 spots for SRR3727127.sra Written 819992 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra Read 819986 spots for SRR3727127.sra Written 819986 spots for SRR3727127.sra SRR ids: ['SRR3727127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z6z1wp6i SRR3727127.sra spots: 16399726 blocks: [[1, 819986], [819987, 1639972], [1639973, 2459958], [2459959, 3279944], [3279945, 4099930], [4099931, 4919916], [4919917, 5739902], [5739903, 6559888], [6559889, 7379874], [7379875, 8199860], [8199861, 9019846], [9019847, 9839832], [9839833, 10659818], [10659819, 11479804], [11479805, 12299790], [12299791, 13119776], [13119777, 13939762], [13939763, 14759748], [14759749, 15579734], [15579735, 16399726]] SRR3727127 file size 5503597 SRR3727127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727127 SRR3727127_1.fastq SRR3727127_2.fastq Input file: SRR3727127_1.fastq Paired file: SRR3727127_2.fastq trimmed: SRR3727127-trimmed-pair1.fastq, SRR3727127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 14:40:07 2025 >> started Thu Apr 10 14:40:26 2025 >> done (18.364s) 16399726 read pairs processed; of these: 97183 ( 0.59%) short read pairs filtered out after trimming by size control 483095 ( 2.95%) empty read pairs filtered out after trimming by size control 15819448 (96.46%) read pairs available; of these: 8212170 (51.91%) trimmed read pairs available after processing 7607278 (48.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 6 0.00% 22 20 0.00% 23 17 0.00% 24 39 0.00% 25 45 0.00% 26 54 0.00% 27 48 0.00% 28 66 0.00% 29 104 0.00% 30 101 0.00% 31 114 0.00% 32 141 0.00% 33 179 0.00% 34 186 0.00% 35 197 0.00% 36 242 0.00% 37 279 0.00% 38 298 0.00% 39 357 0.00% 40 394 0.00% 41 413 0.00% 42 491 0.00% 43 524 0.00% 44 566 0.00% 45 678 0.00% 46 673 0.00% 47 797 0.01% 48 740 0.00% 49 808 0.01% 50 835 0.01% 51 930 0.01% 52 1061 0.01% 53 1093 0.01% 54 1166 0.01% 55 1279 0.01% 56 1334 0.01% 57 1383 0.01% 58 1495 0.01% 59 1498 0.01% 60 1637 0.01% 61 1717 0.01% 62 1815 0.01% 63 2040 0.01% 64 2126 0.01% 65 2243 0.01% 66 2346 0.01% 67 2558 0.02% 68 2632 0.02% 69 2955 0.02% 70 3023 0.02% 71 3224 0.02% 72 3549 0.02% 73 3727 0.02% 74 3993 0.03% 75 4293 0.03% 76 4629 0.03% 77 4921 0.03% 78 5170 0.03% 79 5475 0.03% 80 5878 0.04% 81 6340 0.04% 82 7058 0.04% 83 7656 0.05% 84 12204 0.08% 85 12712 0.08% 86 13141 0.08% 87 14009 0.09% 88 14042 0.09% 89 14216 0.09% 90 14834 0.09% 91 16007 0.10% 92 16094 0.10% 93 16035 0.10% 94 16821 0.11% 95 17441 0.11% 96 17582 0.11% 97 18370 0.12% 98 18672 0.12% 99 18829 0.12% 100 18661 0.12% 101 20533 0.13% 102 21838 0.14% 103 19854 0.13% 104 21158 0.13% 105 29461 0.19% 106 22279 0.14% 107 23908 0.15% 108 24719 0.16% 109 28980 0.18% 110 24417 0.15% 111 29725 0.19% 112 24906 0.16% 113 26949 0.17% 114 25837 0.16% 115 40223 0.25% 116 27765 0.18% 117 29413 0.19% 118 29203 0.18% 119 31908 0.20% 120 34716 0.22% 121 40674 0.26% 122 35322 0.22% 123 35065 0.22% 124 35399 0.22% 125 42896 0.27% 126 43266 0.27% 127 42085 0.27% 128 45321 0.29% 129 59896 0.38% 130 61196 0.39% 131 59566 0.38% 132 69287 0.44% 133 99257 0.63% 134 88560 0.56% 135 82700 0.52% 136 102853 0.65% 137 120419 0.76% 138 134302 0.85% 139 150736 0.95% 140 168500 1.07% 141 190483 1.20% 142 215967 1.37% 143 251666 1.59% 144 297005 1.88% 145 363857 2.30% 146 466724 2.95% 147 642878 4.06% 148 965048 6.10% 149 2382116 15.06% 150 7607278 48.09% 15819448 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=10 fanout-score=32.53 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=10.8 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=28 prefix-density=0.28 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=39.25 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.6 sequence=GTTGAAGCTATAATTGTGCCAGAAGGATCATCAATCATCGAGGATTTTCGGTGCGATAGGGTTTG SRR3727127 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 14:41:06 Started mapping on | Apr 10 14:41:06 Finished on | Apr 10 14:42:38 Mapping speed, Million of reads per hour | 619.02 Number of input reads | 15819448 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15051676 Uniquely mapped reads % | 95.15% Average mapped length | 288.87 Number of splices: Total | 12978158 Number of splices: Annotated (sjdb) | 12739307 Number of splices: GT/AG | 12782212 Number of splices: GC/AG | 159342 Number of splices: AT/AC | 10461 Number of splices: Non-canonical | 26143 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419811 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 45500 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.82% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 370557 370557 370557 N_multimapping 419811 419811 419811 N_noFeature 498146 14843811 619983 N_ambiguous 183612 1575 96413 UnstrandedReadsAssigned:14369918 PositiveStrandReadsAssigned:206290 NegativeStrandReadsAssigned:14335280 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR3727127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727127-trimmed-pair1.fastq SRR3727127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,819,448 reads, 14,495,048 reads pseudoaligned [quant] estimated average fragment length: 256.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR3727127.ke.tsv 34699 SRR3727127.se.tsv 87100 total ==> SRR3727127.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.81 1664 56.5404 Potri.005G024800.1.v4.1 1035 779.812 2554 196.174 Potri.004G059700.1.v4.1 961 705.869 16 1.35771 Potri.007G009000.2.v4.1 1416 1160.81 1 0.0516 Potri.003G141000.2.v4.1 2943 2687.81 480 10.6968 Potri.016G087400.1.v4.1 270 72.7463 628 517.083 Potri.015G069301.1.v4.1 564 315.242 0 0 Potri.010G195200.1.v4.1 1773 1517.81 202.717 7.99989 Potri.012G127500.1.v4.1 977 721.854 12219 1013.91 ==> SRR3727127.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 118 SRR3727127 completed mapping pipeline successfully