Starting /dee2/code/volunteer_pipeline.sh SRR3727128 current disk space = 3115968102400 free memory = 1274520900 SRR3727128 SRAfilesize 6a97e92a9c35dcb134c76b480623647c SRR3727128.sra SRR3727128.sra file validated SRR3727128 is paired end SRR3727128 is conventional basespace SRR3727128 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10675 34.0 31.0 34.0 31.0 34.0 2 32.61175 34.0 33.0 34.0 31.0 34.0 3 33.13225 34.0 34.0 34.0 31.0 34.0 4 36.5165 37.0 37.0 37.0 35.0 37.0 5 36.53025 37.0 37.0 37.0 35.0 37.0 6 36.42475 37.0 37.0 37.0 35.0 37.0 7 36.4875 37.0 37.0 37.0 35.0 37.0 8 36.46225 37.0 37.0 37.0 35.0 37.0 9 38.3645 39.0 39.0 39.0 37.0 39.0 10-14 38.51455 39.4 39.0 39.4 36.8 39.4 15-19 39.668099999999995 41.0 40.0 41.0 37.2 41.0 20-24 39.6322 41.0 40.0 41.0 36.8 41.0 25-29 39.5228 41.0 39.8 41.0 36.6 41.0 30-34 39.2968 40.8 39.0 41.0 36.6 41.0 35-39 38.856500000000004 40.0 38.0 41.0 34.8 41.0 40-44 38.9591 40.0 38.2 41.0 35.2 41.0 45-49 39.1816 41.0 39.0 41.0 35.6 41.0 50-54 38.95155 40.4 38.4 41.0 35.0 41.0 55-59 38.617650000000005 40.0 38.0 41.0 35.0 41.0 60-64 37.87935 39.6 36.4 41.0 33.6 41.0 65-69 37.08669999999999 38.6 35.4 40.6 33.0 41.0 70-74 36.21205 36.8 35.0 39.2 32.2 40.8 75-79 34.899950000000004 35.2 34.2 37.4 31.2 39.2 80-84 34.3339 35.0 34.2 36.4 31.0 37.6 85-89 33.85215 35.0 34.0 35.4 31.0 36.4 90-94 33.31105 35.0 34.0 35.0 30.2 36.0 95-99 33.15005000000001 35.0 34.0 35.0 29.8 35.0 100-104 32.85165 35.0 33.4 35.0 29.2 35.0 105-109 32.72675 35.0 33.2 35.0 29.2 35.0 110-114 32.525800000000004 35.0 33.0 35.0 29.0 35.0 115-119 32.04809999999999 34.2 32.6 35.0 27.0 35.0 120-124 31.693399999999997 34.0 32.0 35.0 25.8 35.0 125-129 31.21305 34.0 31.6 35.0 24.4 35.0 130-134 30.770699999999998 34.0 31.0 35.0 23.2 35.0 135-139 29.533450000000006 33.8 29.4 35.0 15.6 35.0 140-144 28.4868 33.2 27.4 35.0 5.6 35.0 145-149 26.841700000000003 32.8 25.0 34.4 2.0 35.0 150 20.1355 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 5.0 9 2.0 10 4.0 11 3.0 12 3.0 13 5.0 14 2.0 15 10.0 16 9.0 17 6.0 18 7.0 19 5.0 20 6.0 21 12.0 22 12.0 23 10.0 24 18.0 25 31.0 26 31.0 27 33.0 28 63.0 29 55.0 30 74.0 31 105.0 32 130.0 33 207.0 34 293.0 35 569.0 36 1233.0 37 1048.0 38 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.79721002324981 18.780676827693103 13.639886334280549 32.78222681477654 2 19.02975743935984 25.881470367591895 38.284571142785694 16.804201050262566 3 16.975 32.025 26.775 24.224999999999998 4 19.75 38.574999999999996 21.9 19.775000000000002 5 18.85 39.4 23.25 18.5 6 17.1 37.125 26.0 19.775000000000002 7 12.725 20.9 45.775 20.599999999999998 8 18.65 21.099999999999998 28.475 31.775 9 18.25 22.175 29.849999999999998 29.725 10-14 19.869999999999997 29.945 26.284999999999997 23.9 15-19 19.90898179635927 28.595719143828767 27.535507101420286 23.95979195839168 20-24 19.435 28.815 28.02 23.73 25-29 20.125 28.884999999999998 27.71 23.28 30-34 19.925 28.884999999999998 27.49 23.7 35-39 20.615 29.244999999999997 26.340000000000003 23.799999999999997 40-44 20.3 29.285 27.11 23.305 45-49 20.59 28.77 26.945000000000004 23.695 50-54 20.36 28.565 27.560000000000002 23.515 55-59 20.09 29.415000000000003 27.22 23.275000000000002 60-64 19.79 28.67 27.169999999999998 24.37 65-69 20.3 28.83 27.12 23.75 70-74 20.22 29.13 27.275 23.375 75-79 20.26 28.494999999999997 27.525 23.72 80-84 20.169999999999998 28.675 26.905 24.25 85-89 20.11 28.465 27.639999999999997 23.785 90-94 20.495 28.28 27.245 23.98 95-99 20.630000000000003 27.76 27.87 23.74 100-104 20.76 28.58 27.075 23.585 105-109 20.919999999999998 28.73 27.05 23.3 110-114 20.825 28.92 26.840000000000003 23.415 115-119 20.94 28.389999999999997 27.400000000000002 23.27 120-124 20.72 28.634999999999998 26.995 23.65 125-129 20.915 28.055000000000003 27.68 23.35 130-134 20.685000000000002 28.63 26.97 23.715 135-139 20.775 28.410000000000004 26.779999999999998 24.035 140-144 21.215 28.050000000000004 26.8 23.935000000000002 145-149 20.330000000000002 28.189999999999998 27.115000000000002 24.365000000000002 150 8.125 33.4 28.375 30.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 2.0 25 4.0 26 6.0 27 8.0 28 14.0 29 21.0 30 30.0 31 42.5 32 51.5 33 58.0 34 66.5 35 88.5 36 110.5 37 123.5 38 138.5 39 164.0 40 191.5 41 200.0 42 209.5 43 228.5 44 251.5 45 240.0 46 218.5 47 230.5 48 222.0 49 197.0 50 164.0 51 145.0 52 130.0 53 102.0 54 80.5 55 55.0 56 42.5 57 42.0 58 32.5 59 16.0 60 12.0 61 12.5 62 7.0 63 10.0 64 9.0 65 3.0 66 3.0 67 1.0 68 0.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80831643002028 97.425 2 0.9888438133874239 1.95 3 0.17748478701825557 0.525 4 0.02535496957403651 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.9 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138 4.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3727128 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08075 34.0 31.0 34.0 28.0 34.0 2 31.18175 34.0 31.0 34.0 28.0 34.0 3 31.523 34.0 31.0 34.0 30.0 34.0 4 34.835 37.0 37.0 37.0 33.0 37.0 5 34.93775 37.0 37.0 37.0 33.0 37.0 6 34.923 37.0 37.0 37.0 33.0 37.0 7 34.94325 37.0 37.0 37.0 35.0 37.0 8 34.998 37.0 37.0 37.0 35.0 37.0 9 36.744 39.0 39.0 39.0 35.0 39.0 10-14 36.9237 39.4 38.8 39.4 34.6 39.4 15-19 38.05375 41.0 39.6 41.0 34.8 41.0 20-24 37.94855 41.0 39.0 41.0 34.6 41.0 25-29 37.4488 40.4 38.4 41.0 32.6 41.0 30-34 37.125499999999995 40.0 38.0 41.0 31.6 41.0 35-39 37.1904 40.0 38.0 41.0 32.4 41.0 40-44 36.78625 40.0 37.8 41.0 30.8 41.0 45-49 36.55135 40.0 37.2 41.0 30.4 41.0 50-54 35.97525 39.0 36.4 40.2 29.8 40.6 55-59 35.92675 39.0 36.0 41.0 28.8 41.0 60-64 35.8909 38.8 35.6 40.8 29.6 41.0 65-69 35.0148 37.6 35.0 40.0 28.4 41.0 70-74 34.0128 36.2 34.4 38.8 27.2 40.4 75-79 33.0351 35.2 33.8 36.8 26.4 39.0 80-84 32.32835 35.0 33.8 36.0 26.2 37.0 85-89 32.0852 35.0 34.0 35.2 26.4 36.2 90-94 31.61235 35.0 33.2 35.0 25.2 35.6 95-99 31.2488 35.0 32.8 35.0 23.6 35.0 100-104 31.061799999999998 35.0 32.6 35.0 23.2 35.0 105-109 30.8956 35.0 32.0 35.0 21.8 35.0 110-114 30.470499999999998 34.0 31.4 35.0 18.6 35.0 115-119 29.747149999999998 34.0 30.2 35.0 11.8 35.0 120-124 29.3273 34.0 29.6 35.0 7.0 35.0 125-129 28.5589 33.6 28.2 35.0 2.6 35.0 130-134 28.2041 33.8 28.6 35.0 2.0 35.0 135-139 27.5705 33.0 26.6 35.0 2.0 35.0 140-144 27.0135 32.8 25.4 34.8 2.0 35.0 145-149 25.48185 32.2 21.6 34.0 2.0 35.0 150 21.902 29.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 149.0 3 14.0 4 4.0 5 7.0 6 1.0 7 6.0 8 8.0 9 5.0 10 9.0 11 4.0 12 10.0 13 7.0 14 6.0 15 5.0 16 12.0 17 7.0 18 8.0 19 15.0 20 11.0 21 11.0 22 19.0 23 22.0 24 20.0 25 26.0 26 38.0 27 46.0 28 56.0 29 72.0 30 88.0 31 115.0 32 139.0 33 229.0 34 309.0 35 552.0 36 1162.0 37 798.0 38 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.280210157618214 16.062046534901175 14.635976982737054 29.02176632474356 2 22.35 23.974999999999998 36.8 16.875 3 19.15 26.025 32.35 22.475 4 22.95 35.575 21.475 20.0 5 23.799999999999997 35.975 20.775 19.45 6 18.45 37.275000000000006 23.65 20.625 7 17.95 15.65 44.0 22.400000000000002 8 21.625 20.849999999999998 27.775 29.75 9 21.15 23.5 29.325000000000003 26.025 10-14 23.205000000000002 28.675 26.305 21.815 15-19 23.13 27.045 27.96 21.865000000000002 20-24 23.79 27.025 27.865000000000002 21.32 25-29 23.355 27.35 27.92 21.375 30-34 23.41 27.655 27.91 21.025 35-39 23.215 27.32 27.425 22.040000000000003 40-44 22.685 28.075 28.355000000000004 20.885 45-49 23.23 27.134999999999998 28.22 21.415 50-54 22.965 27.810000000000002 27.889999999999997 21.335 55-59 23.555 27.425 27.66 21.36 60-64 23.125 27.435 27.92 21.52 65-69 22.96 27.62 28.425 20.995 70-74 23.189999999999998 28.055000000000003 27.715 21.04 75-79 23.595 27.169999999999998 28.07 21.165 80-84 23.22 27.845 27.855 21.08 85-89 23.225 28.134999999999998 27.615000000000002 21.025 90-94 23.595 27.560000000000002 28.065 20.78 95-99 23.385 27.439999999999998 28.044999999999998 21.13 100-104 23.395 27.305 28.46 20.84 105-109 23.385 27.42 28.244999999999997 20.95 110-114 23.24 27.439999999999998 27.935 21.385 115-119 23.585 27.85 27.950000000000003 20.615 120-124 23.715 27.22 28.294999999999998 20.77 125-129 23.72041827187672 27.577925651673592 27.898133786961527 20.803522289488168 130-134 23.822395755118386 27.76192621514742 27.852029834309455 20.56364819542474 135-139 24.176759083174858 26.929236312681414 28.48563707336603 20.4083675307777 140-144 23.662211543274765 27.94213345347149 27.962156479951943 20.433498523301797 145-149 24.801120728473506 26.987541902236455 28.068244358833244 20.1430930104568 150 24.937468734367183 28.01400700350175 27.01350675337669 20.035017508754375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 1.5 15 1.5 16 1.0 17 2.0 18 2.0 19 1.0 20 1.5 21 2.0 22 2.0 23 2.0 24 4.0 25 7.0 26 5.5 27 6.0 28 7.5 29 9.5 30 17.0 31 19.5 32 22.5 33 33.0 34 53.5 35 72.5 36 81.0 37 100.5 38 130.0 39 155.0 40 169.5 41 195.0 42 222.5 43 243.5 44 256.5 45 253.0 46 242.0 47 234.0 48 226.0 49 225.0 50 201.0 51 148.5 52 125.0 53 109.0 54 93.0 55 71.0 56 50.0 57 36.5 58 31.0 59 31.0 60 23.5 61 17.0 62 9.5 63 7.0 64 5.0 65 4.0 66 2.5 67 2.5 68 3.0 69 1.5 70 2.5 71 2.5 72 2.5 73 1.5 74 0.0 75 1.0 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.065 130-134 0.11499999999999999 135-139 0.09 140-144 0.11499999999999999 145-149 0.065 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8860759493671 97.65 2 0.9873417721518988 1.95 3 0.10126582278481014 0.3 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.23750000000000002 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.5249999999999999 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 1.9500000000000002 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTTT 10 0.006973645 144.0 1 >>END_MODULE Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882925 spots for SRR3727128.sra Written 882925 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra Read 882912 spots for SRR3727128.sra Written 882912 spots for SRR3727128.sra SRR ids: ['SRR3727128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2po2ss5q SRR3727128.sra spots: 17658253 blocks: [[1, 882912], [882913, 1765824], [1765825, 2648736], [2648737, 3531648], [3531649, 4414560], [4414561, 5297472], [5297473, 6180384], [6180385, 7063296], [7063297, 7946208], [7946209, 8829120], [8829121, 9712032], [9712033, 10594944], [10594945, 11477856], [11477857, 12360768], [12360769, 13243680], [13243681, 14126592], [14126593, 15009504], [15009505, 15892416], [15892417, 16775328], [16775329, 17658253]] SRR3727128 file size 5927613 SRR3727128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727128 SRR3727128_1.fastq SRR3727128_2.fastq Input file: SRR3727128_1.fastq Paired file: SRR3727128_2.fastq trimmed: SRR3727128-trimmed-pair1.fastq, SRR3727128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:11:48 2025 >> started Fri Feb 14 10:12:10 2025 >> done (22.650s) 17658253 read pairs processed; of these: 99514 ( 0.56%) short read pairs filtered out after trimming by size control 543169 ( 3.08%) empty read pairs filtered out after trimming by size control 17015570 (96.36%) read pairs available; of these: 7113819 (41.81%) trimmed read pairs available after processing 9901751 (58.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 7 0.00% 21 16 0.00% 22 27 0.00% 23 51 0.00% 24 54 0.00% 25 54 0.00% 26 72 0.00% 27 79 0.00% 28 100 0.00% 29 113 0.00% 30 137 0.00% 31 151 0.00% 32 188 0.00% 33 206 0.00% 34 242 0.00% 35 249 0.00% 36 234 0.00% 37 291 0.00% 38 337 0.00% 39 394 0.00% 40 396 0.00% 41 429 0.00% 42 482 0.00% 43 531 0.00% 44 554 0.00% 45 579 0.00% 46 659 0.00% 47 740 0.00% 48 742 0.00% 49 745 0.00% 50 901 0.01% 51 903 0.01% 52 914 0.01% 53 1008 0.01% 54 1059 0.01% 55 1147 0.01% 56 1118 0.01% 57 1169 0.01% 58 1222 0.01% 59 1342 0.01% 60 1357 0.01% 61 1448 0.01% 62 1527 0.01% 63 1724 0.01% 64 1761 0.01% 65 1782 0.01% 66 1980 0.01% 67 2047 0.01% 68 2150 0.01% 69 2301 0.01% 70 2483 0.01% 71 2634 0.02% 72 2826 0.02% 73 3065 0.02% 74 3375 0.02% 75 3563 0.02% 76 3739 0.02% 77 4128 0.02% 78 4531 0.03% 79 4717 0.03% 80 5032 0.03% 81 5225 0.03% 82 5598 0.03% 83 6419 0.04% 84 11680 0.07% 85 12176 0.07% 86 12599 0.07% 87 13242 0.08% 88 13330 0.08% 89 13541 0.08% 90 15545 0.09% 91 15686 0.09% 92 15942 0.09% 93 16702 0.10% 94 16609 0.10% 95 17397 0.10% 96 20552 0.12% 97 20337 0.12% 98 20703 0.12% 99 20594 0.12% 100 16694 0.10% 101 17135 0.10% 102 21204 0.12% 103 26129 0.15% 104 26772 0.16% 105 26634 0.16% 106 25669 0.15% 107 23413 0.14% 108 27430 0.16% 109 31598 0.19% 110 29800 0.18% 111 25749 0.15% 112 21869 0.13% 113 22439 0.13% 114 30124 0.18% 115 44165 0.26% 116 39914 0.23% 117 31589 0.19% 118 25939 0.15% 119 27194 0.16% 120 29668 0.17% 121 45135 0.27% 122 46909 0.28% 123 37659 0.22% 124 30145 0.18% 125 31890 0.19% 126 47076 0.28% 127 52672 0.31% 128 45557 0.27% 129 50504 0.30% 130 64031 0.38% 131 67708 0.40% 132 69887 0.41% 133 78811 0.46% 134 84759 0.50% 135 82817 0.49% 136 91966 0.54% 137 98191 0.58% 138 106145 0.62% 139 113028 0.66% 140 117678 0.69% 141 131265 0.77% 142 150628 0.89% 143 167102 0.98% 144 192295 1.13% 145 230963 1.36% 146 306486 1.80% 147 434063 2.55% 148 672740 3.95% 149 2542881 14.94% 150 9901751 58.19% 17015570 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.0 sequence=AACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=28.86 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=9.6 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=2.5 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=56.95 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR3727128 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:13:06 Started mapping on | Feb 14 10:13:06 Finished on | Feb 14 10:19:39 Mapping speed, Million of reads per hour | 155.87 Number of input reads | 17015570 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15102360 Uniquely mapped reads % | 88.76% Average mapped length | 290.52 Number of splices: Total | 13760246 Number of splices: Annotated (sjdb) | 13522902 Number of splices: GT/AG | 13498901 Number of splices: GC/AG | 220982 Number of splices: AT/AC | 10241 Number of splices: Non-canonical | 30122 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341005 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 36197 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.96% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1597802 1597802 1597802 N_multimapping 341005 341005 341005 N_noFeature 462719 14885014 544643 N_ambiguous 223452 900 87513 UnstrandedReadsAssigned:14416189 PositiveStrandReadsAssigned:216446 NegativeStrandReadsAssigned:14470204 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR3727128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727128-trimmed-pair1.fastq SRR3727128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,015,570 reads, 14,590,828 reads pseudoaligned [quant] estimated average fragment length: 244.482 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR3727128.ke.tsv 34699 SRR3727128.se.tsv 87100 total ==> SRR3727128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.52 655 22.0475 Potri.005G024800.1.v4.1 1035 791.518 544 41.0523 Potri.004G059700.1.v4.1 961 717.564 11 0.915653 Potri.007G009000.2.v4.1 1416 1172.52 0 0 Potri.003G141000.2.v4.1 2943 2699.52 422 9.33739 Potri.016G087400.1.v4.1 270 78.2955 769 586.663 Potri.015G069301.1.v4.1 564 326.318 0 0 Potri.010G195200.1.v4.1 1773 1529.52 53 2.06976 Potri.012G127500.1.v4.1 977 733.539 2153 175.315 ==> SRR3727128.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 128 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 125 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3727128 completed mapping pipeline successfully