Starting /dee2/code/volunteer_pipeline.sh SRR3727129 current disk space = 3114196955136 free memory = 1577976200 SRR3727129 SRAfilesize d9663e2713fbaaca2af80288cf01cdda SRR3727129.sra SRR3727129.sra file validated SRR3727129 is paired end SRR3727129 is conventional basespace SRR3727129 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.44525 34.0 31.0 34.0 31.0 34.0 2 32.84825 34.0 33.0 34.0 31.0 34.0 3 33.146 34.0 34.0 34.0 31.0 34.0 4 36.53325 37.0 37.0 37.0 35.0 37.0 5 36.53575 37.0 37.0 37.0 35.0 37.0 6 36.5105 37.0 37.0 37.0 35.0 37.0 7 36.45325 37.0 37.0 37.0 35.0 37.0 8 36.5135 37.0 37.0 37.0 35.0 37.0 9 38.28975 39.0 39.0 39.0 37.0 39.0 10-14 38.59635 39.4 39.2 39.4 37.2 39.4 15-19 39.63705 41.0 39.8 41.0 37.0 41.0 20-24 39.665299999999995 41.0 39.6 41.0 37.4 41.0 25-29 39.52015 41.0 39.0 41.0 37.0 41.0 30-34 39.24105 40.2 39.0 41.0 36.2 41.0 35-39 38.95375 40.0 38.0 41.0 35.6 41.0 40-44 38.937250000000006 40.0 38.0 41.0 35.2 41.0 45-49 38.887600000000006 40.0 38.2 41.0 35.2 41.0 50-54 38.89455 40.0 38.0 41.0 35.0 41.0 55-59 38.3415 40.0 37.8 41.0 34.2 41.0 60-64 37.892399999999995 39.4 36.6 41.0 34.0 41.0 65-69 37.147200000000005 38.6 35.6 40.4 32.8 41.0 70-74 36.1248 36.8 35.0 39.2 32.0 40.8 75-79 34.802499999999995 35.2 34.0 37.4 30.6 39.2 80-84 34.13375 35.0 34.0 36.2 30.8 37.4 85-89 33.64855 35.0 34.0 35.2 30.6 36.4 90-94 33.2841 35.0 34.0 35.0 30.0 35.8 95-99 33.10209999999999 35.0 33.8 35.0 29.8 35.0 100-104 32.6933 35.0 33.0 35.0 29.0 35.0 105-109 32.39665 35.0 33.0 35.0 28.6 35.0 110-114 31.99075 34.4 32.2 35.0 26.6 35.0 115-119 31.648899999999998 34.0 32.0 35.0 25.0 35.0 120-124 31.23445 34.0 31.2 35.0 24.6 35.0 125-129 30.5331 34.0 30.4 35.0 22.2 35.0 130-134 29.522999999999996 34.0 29.2 35.0 17.0 35.0 135-139 29.4209 34.0 29.0 35.0 16.0 35.0 140-144 27.57005 32.6 26.2 34.4 3.0 35.0 145-149 24.99465 31.8 17.4 34.0 2.0 35.0 150 18.47125 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 4.0 11 3.0 12 2.0 13 6.0 14 2.0 15 5.0 16 6.0 17 8.0 18 3.0 19 11.0 20 6.0 21 13.0 22 15.0 23 15.0 24 21.0 25 34.0 26 26.0 27 45.0 28 52.0 29 72.0 30 89.0 31 116.0 32 159.0 33 251.0 34 380.0 35 689.0 36 1199.0 37 757.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.77817531305904 20.086889854331716 10.73345259391771 33.40148223869154 2 17.45 27.275 39.225 16.05 3 15.325 32.324999999999996 28.199999999999996 24.15 4 21.275 36.9 23.075000000000003 18.75 5 19.375 40.025 22.075 18.525 6 16.05 39.125 23.799999999999997 21.025 7 13.600000000000001 20.974999999999998 44.775 20.65 8 18.224999999999998 20.1 29.099999999999998 32.574999999999996 9 17.075000000000003 22.2 31.4 29.325000000000003 10-14 18.945 31.624999999999996 25.97 23.46 15-19 19.439999999999998 29.95 27.58 23.03 20-24 20.25 30.14 26.415 23.195 25-29 19.055 30.580000000000002 26.705000000000002 23.66 30-34 19.525000000000002 29.75 27.644999999999996 23.080000000000002 35-39 19.85 30.115 27.075 22.96 40-44 19.744999999999997 30.020000000000003 27.375 22.86 45-49 19.735 29.17 27.865000000000002 23.23 50-54 19.785 29.715000000000003 26.695 23.805 55-59 20.115 29.044999999999998 27.35 23.49 60-64 19.915 29.275000000000002 26.86 23.95 65-69 20.005 29.725 27.415 22.855 70-74 20.21 29.134999999999998 27.500000000000004 23.155 75-79 20.345 29.285 26.775 23.595 80-84 20.555 28.854999999999997 27.295 23.294999999999998 85-89 20.645 28.794999999999998 27.38 23.18 90-94 20.72 28.749999999999996 27.47 23.06 95-99 20.195 28.925 27.21 23.669999999999998 100-104 20.565 28.575 27.35 23.51 105-109 20.36 28.945 26.995 23.7 110-114 20.26 28.665000000000003 27.595 23.48 115-119 20.560000000000002 28.810000000000002 27.505000000000003 23.125 120-124 20.724999999999998 28.13 27.834999999999997 23.31 125-129 20.3 28.625 27.79 23.285 130-134 20.31 28.185 27.925 23.580000000000002 135-139 20.78 28.449999999999996 27.555000000000003 23.215 140-144 20.555 28.244999999999997 27.715 23.485 145-149 20.415 29.215000000000003 26.87 23.5 150 9.85 34.599999999999994 28.375 27.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.5 21 2.0 22 1.5 23 2.5 24 3.5 25 4.5 26 6.5 27 11.5 28 14.5 29 22.0 30 35.0 31 44.0 32 50.5 33 65.0 34 78.5 35 87.0 36 110.0 37 142.5 38 156.0 39 175.5 40 202.5 41 210.5 42 228.5 43 250.0 44 246.0 45 241.5 46 242.5 47 222.5 48 206.5 49 199.0 50 156.5 51 116.0 52 107.5 53 85.0 54 63.0 55 49.5 56 38.5 57 30.0 58 21.5 59 13.5 60 8.0 61 6.5 62 4.5 63 7.0 64 7.0 65 3.5 66 1.0 67 3.0 68 4.0 69 2.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.25 0.0 0.0 0.0 0.0 128-129 0.25 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.2875 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATTC 10 0.00621615 149.57143 1 CTCAGCA 10 0.0069790767 143.96251 7 TCTCAGC 10 0.0069790767 143.96251 6 >>END_MODULE SRR3727129 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.296 34.0 31.0 34.0 30.0 34.0 2 31.54225 34.0 31.0 34.0 30.0 34.0 3 31.678 34.0 31.0 34.0 30.0 34.0 4 35.10725 37.0 37.0 37.0 35.0 37.0 5 35.0765 37.0 37.0 37.0 35.0 37.0 6 35.08375 37.0 37.0 37.0 35.0 37.0 7 35.03675 37.0 37.0 37.0 35.0 37.0 8 35.02275 37.0 37.0 37.0 35.0 37.0 9 36.77925 39.0 38.0 39.0 35.0 39.0 10-14 37.01365 39.4 38.2 39.4 35.0 39.4 15-19 37.94845 40.8 38.8 41.0 33.8 41.0 20-24 37.967 40.8 39.0 41.0 34.2 41.0 25-29 37.864850000000004 40.0 39.0 41.0 34.0 41.0 30-34 37.52629999999999 40.0 38.0 41.0 33.2 41.0 35-39 37.247 40.0 38.0 41.0 32.6 41.0 40-44 36.68085000000001 40.0 37.4 41.0 30.6 41.0 45-49 36.80615 40.0 37.8 41.0 31.4 41.0 50-54 36.2191 39.0 36.8 40.4 30.6 40.6 55-59 36.430400000000006 39.8 36.6 41.0 31.0 41.0 60-64 36.35785 39.4 36.2 41.0 31.2 41.0 65-69 35.614799999999995 38.2 35.0 40.4 30.4 41.0 70-74 34.60585 36.6 34.8 39.0 29.4 40.8 75-79 33.395799999999994 35.2 34.0 37.0 28.2 39.0 80-84 32.530199999999994 35.0 33.8 36.2 26.8 37.2 85-89 31.514400000000002 35.0 32.4 35.0 24.2 36.2 90-94 31.46725 35.0 33.0 35.0 25.0 35.4 95-99 31.23225 35.0 32.8 35.0 24.2 35.0 100-104 30.59905 34.2 31.6 35.0 20.8 35.0 105-109 30.590500000000002 34.0 31.6 35.0 19.2 35.0 110-114 30.2343 34.0 31.0 35.0 18.2 35.0 115-119 29.84575 34.0 30.4 35.0 14.2 35.0 120-124 29.720850000000002 34.0 30.4 35.0 12.8 35.0 125-129 29.0799 34.0 29.0 35.0 6.2 35.0 130-134 27.8257 33.0 26.6 35.0 2.0 35.0 135-139 27.783950000000004 33.0 27.0 35.0 2.0 35.0 140-144 27.222199999999997 33.0 25.4 34.6 2.0 35.0 145-149 25.682100000000002 32.0 23.0 34.0 2.0 35.0 150 21.95975 27.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 141.0 3 4.0 4 2.0 5 6.0 6 4.0 7 5.0 8 5.0 9 5.0 10 5.0 11 11.0 12 5.0 13 10.0 14 13.0 15 8.0 16 13.0 17 10.0 18 9.0 19 12.0 20 13.0 21 11.0 22 11.0 23 15.0 24 24.0 25 24.0 26 32.0 27 42.0 28 53.0 29 51.0 30 79.0 31 117.0 32 140.0 33 229.0 34 374.0 35 657.0 36 1164.0 37 689.0 38 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.825 16.825000000000003 12.65 29.7 2 22.1 24.2 36.425000000000004 17.275 3 20.25 26.025 31.724999999999998 22.0 4 23.200000000000003 36.25 20.775 19.775000000000002 5 24.425 37.95 20.9 16.725 6 17.45 37.65 23.825 21.075 7 17.325 15.075 45.074999999999996 22.525000000000002 8 20.375 19.875 28.849999999999998 30.9 9 21.4 22.075 29.525000000000002 27.0 10-14 22.564999999999998 28.375 27.22 21.84 15-19 23.244999999999997 27.750000000000004 27.894999999999996 21.11 20-24 23.25 28.255000000000003 27.450000000000003 21.044999999999998 25-29 22.650000000000002 28.305000000000003 28.285 20.76 30-34 22.900000000000002 27.265 28.49 21.345 35-39 22.35 28.125 28.18 21.345 40-44 23.225 28.175 27.615000000000002 20.985 45-49 23.294999999999998 27.865000000000002 28.035 20.805 50-54 22.900000000000002 27.775 27.865000000000002 21.46 55-59 23.285 27.73 27.83 21.154999999999998 60-64 22.96 27.77 28.16 21.11 65-69 23.294999999999998 27.950000000000003 28.115000000000002 20.64 70-74 22.745 28.24 28.23 20.785 75-79 22.805 27.644999999999996 28.395 21.154999999999998 80-84 23.150000000000002 27.794999999999998 28.64 20.415 85-89 23.635 27.839999999999996 27.76 20.765 90-94 23.415 27.544999999999998 28.535 20.505000000000003 95-99 22.830000000000002 27.87 28.945 20.355 100-104 23.945 27.42 28.115000000000002 20.52 105-109 23.715 27.715 28.16 20.41 110-114 23.31 27.72 28.110000000000003 20.86 115-119 22.919999999999998 28.439999999999998 27.98 20.66 120-124 23.119999999999997 27.29 29.14 20.45 125-129 23.215 26.979999999999997 28.970000000000002 20.835 130-134 23.18 27.794999999999998 28.470000000000002 20.555 135-139 23.72 27.445000000000004 28.82 20.015 140-144 24.615000000000002 27.650000000000002 27.894999999999996 19.84 145-149 24.085 27.67 28.084999999999997 20.16 150 24.9685692733216 27.156147850138296 27.583605732964543 20.29167714357556 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 2.0 8 2.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 2.0 17 3.0 18 2.5 19 2.5 20 3.5 21 2.5 22 2.5 23 2.5 24 2.0 25 4.0 26 5.0 27 6.5 28 8.5 29 12.0 30 15.0 31 15.5 32 25.0 33 39.5 34 50.5 35 68.0 36 90.5 37 103.5 38 128.0 39 159.5 40 187.5 41 225.0 42 244.0 43 264.5 44 272.0 45 261.0 46 258.0 47 245.5 48 229.0 49 198.5 50 168.5 51 142.0 52 124.5 53 97.0 54 66.5 55 54.0 56 40.0 57 29.0 58 22.5 59 23.5 60 18.0 61 9.5 62 9.5 63 11.5 64 10.0 65 8.0 66 4.0 67 1.0 68 1.0 69 2.0 70 3.0 71 1.5 72 0.0 73 1.0 74 1.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.2875 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.3375 0.0 0.0 0.0 0.0 134-135 0.6125 0.0 0.0 0.0 0.0 136-137 0.9249999999999999 0.0 0.0 0.0 0.0 138 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 10 0.0069754543 143.9875 9 TCACAGG 10 0.0069754543 143.9875 8 >>END_MODULE Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673369 spots for SRR3727129.sra Written 673369 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra Read 673352 spots for SRR3727129.sra Written 673352 spots for SRR3727129.sra SRR ids: ['SRR3727129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n6jwc1zc SRR3727129.sra spots: 13467057 blocks: [[1, 673352], [673353, 1346704], [1346705, 2020056], [2020057, 2693408], [2693409, 3366760], [3366761, 4040112], [4040113, 4713464], [4713465, 5386816], [5386817, 6060168], [6060169, 6733520], [6733521, 7406872], [7406873, 8080224], [8080225, 8753576], [8753577, 9426928], [9426929, 10100280], [10100281, 10773632], [10773633, 11446984], [11446985, 12120336], [12120337, 12793688], [12793689, 13467057]] SRR3727129 file size 4515540 SRR3727129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727129 SRR3727129_1.fastq SRR3727129_2.fastq Input file: SRR3727129_1.fastq Paired file: SRR3727129_2.fastq trimmed: SRR3727129-trimmed-pair1.fastq, SRR3727129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:38:03 2025 >> started Fri Feb 14 11:38:36 2025 >> done (32.444s) 13467057 read pairs processed; of these: 64807 ( 0.48%) short read pairs filtered out after trimming by size control 314201 ( 2.33%) empty read pairs filtered out after trimming by size control 13088049 (97.19%) read pairs available; of these: 6408355 (48.96%) trimmed read pairs available after processing 6679694 (51.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 7 0.00% 22 16 0.00% 23 11 0.00% 24 16 0.00% 25 28 0.00% 26 19 0.00% 27 35 0.00% 28 39 0.00% 29 59 0.00% 30 54 0.00% 31 75 0.00% 32 86 0.00% 33 97 0.00% 34 96 0.00% 35 111 0.00% 36 144 0.00% 37 144 0.00% 38 154 0.00% 39 176 0.00% 40 223 0.00% 41 262 0.00% 42 259 0.00% 43 278 0.00% 44 307 0.00% 45 315 0.00% 46 334 0.00% 47 369 0.00% 48 417 0.00% 49 440 0.00% 50 446 0.00% 51 514 0.00% 52 552 0.00% 53 591 0.00% 54 563 0.00% 55 632 0.00% 56 714 0.01% 57 730 0.01% 58 777 0.01% 59 868 0.01% 60 891 0.01% 61 904 0.01% 62 1038 0.01% 63 1104 0.01% 64 1121 0.01% 65 1153 0.01% 66 1285 0.01% 67 1378 0.01% 68 1453 0.01% 69 1563 0.01% 70 1681 0.01% 71 1836 0.01% 72 2064 0.02% 73 2108 0.02% 74 2132 0.02% 75 2361 0.02% 76 2530 0.02% 77 2727 0.02% 78 2941 0.02% 79 3198 0.02% 80 3521 0.03% 81 3954 0.03% 82 4407 0.03% 83 5168 0.04% 84 8356 0.06% 85 8419 0.06% 86 8906 0.07% 87 9352 0.07% 88 9729 0.07% 89 9835 0.08% 90 10327 0.08% 91 10768 0.08% 92 11197 0.09% 93 11058 0.08% 94 11472 0.09% 95 11786 0.09% 96 12083 0.09% 97 12217 0.09% 98 12392 0.09% 99 12527 0.10% 100 12546 0.10% 101 12620 0.10% 102 13339 0.10% 103 13258 0.10% 104 13562 0.10% 105 14420 0.11% 106 14542 0.11% 107 15295 0.12% 108 17345 0.13% 109 17399 0.13% 110 17059 0.13% 111 18042 0.14% 112 17805 0.14% 113 17620 0.13% 114 18612 0.14% 115 34953 0.27% 116 19657 0.15% 117 19010 0.15% 118 19309 0.15% 119 20902 0.16% 120 23391 0.18% 121 21968 0.17% 122 22343 0.17% 123 23129 0.18% 124 26755 0.20% 125 28580 0.22% 126 28388 0.22% 127 29220 0.22% 128 30755 0.23% 129 34263 0.26% 130 36287 0.28% 131 39843 0.30% 132 48447 0.37% 133 58525 0.45% 134 62841 0.48% 135 63871 0.49% 136 91026 0.70% 137 98707 0.75% 138 108264 0.83% 139 119601 0.91% 140 131238 1.00% 141 147807 1.13% 142 171377 1.31% 143 196187 1.50% 144 229468 1.75% 145 283357 2.17% 146 366700 2.80% 147 512595 3.92% 148 777458 5.94% 149 2014768 15.39% 150 6679694 51.04% 13088049 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=38.61 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=11.6 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=23 prefix-density=0.42 prefix-fanout=2.9 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.15 sequence-density-rank=20 fanout-score=18.56 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.4 sequence=TTTGTTCTTGTCTACACTGTCTTCTCTGC SRR3727129 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:39:40 Started mapping on | Feb 14 11:39:41 Finished on | Feb 14 11:41:39 Mapping speed, Million of reads per hour | 399.30 Number of input reads | 13088049 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12413138 Uniquely mapped reads % | 94.84% Average mapped length | 290.62 Number of splices: Total | 10375682 Number of splices: Annotated (sjdb) | 10181656 Number of splices: GT/AG | 10218717 Number of splices: GC/AG | 125080 Number of splices: AT/AC | 8526 Number of splices: Non-canonical | 23359 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338570 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 28198 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 353489 353489 353489 N_multimapping 338570 338570 338570 N_noFeature 383627 12241983 471109 N_ambiguous 155818 1327 71147 UnstrandedReadsAssigned:11873693 PositiveStrandReadsAssigned:169828 NegativeStrandReadsAssigned:11870882 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727129-trimmed-pair1.fastq SRR3727129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,088,049 reads, 11,950,938 reads pseudoaligned [quant] estimated average fragment length: 248.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR3727129.ke.tsv 34699 SRR3727129.se.tsv 87100 total ==> SRR3727129.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.97 1141 39.6373 Potri.005G024800.1.v4.1 1035 787.967 860 67.1459 Potri.004G059700.1.v4.1 961 713.978 12 1.03401 Potri.007G009000.2.v4.1 1416 1168.97 0 0 Potri.003G141000.2.v4.1 2943 2695.97 293 6.68624 Potri.016G087400.1.v4.1 270 72.3953 750 637.352 Potri.015G069301.1.v4.1 564 321.147 0 0 Potri.010G195200.1.v4.1 1773 1525.97 218 8.78901 Potri.012G127500.1.v4.1 977 729.973 9753 821.979 ==> SRR3727129.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 573 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 121 SRR3727129 completed mapping pipeline successfully