Starting /dee2/code/volunteer_pipeline.sh SRR3727130 current disk space = 3114459361280 free memory = 1574758012 SRR3727130 SRAfilesize 7e1eab596dcb05d0a0ec5ecca57b3252 SRR3727130.sra SRR3727130.sra file validated SRR3727130 is paired end SRR3727130 is conventional basespace SRR3727130 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1415 34.0 31.0 34.0 31.0 34.0 2 32.688 34.0 33.0 34.0 31.0 34.0 3 33.07075 34.0 33.0 34.0 31.0 34.0 4 36.5645 37.0 37.0 37.0 35.0 37.0 5 36.4605 37.0 37.0 37.0 35.0 37.0 6 36.5385 37.0 37.0 37.0 35.0 37.0 7 36.5245 37.0 37.0 37.0 35.0 37.0 8 36.45675 37.0 37.0 37.0 35.0 37.0 9 38.257 39.0 39.0 39.0 37.0 39.0 10-14 38.556 39.4 39.2 39.4 37.2 39.4 15-19 39.81275 41.0 40.0 41.0 38.0 41.0 20-24 39.737700000000004 41.0 39.8 41.0 37.8 41.0 25-29 39.50085 41.0 39.0 41.0 37.0 41.0 30-34 39.25755 40.0 39.0 41.0 36.0 41.0 35-39 39.09205 40.0 38.2 41.0 35.6 41.0 40-44 38.9602 40.0 38.2 41.0 35.6 41.0 45-49 39.2179 40.2 39.0 41.0 36.0 41.0 50-54 38.86385 40.0 38.6 41.0 35.0 41.0 55-59 38.56415 40.0 38.0 41.0 34.6 41.0 60-64 37.98800000000001 39.6 36.6 41.0 33.8 41.0 65-69 37.2177 38.6 35.6 40.2 33.2 41.0 70-74 36.125600000000006 36.8 35.0 39.2 31.8 40.8 75-79 34.77425 35.2 34.0 37.4 31.0 39.2 80-84 34.372249999999994 35.0 34.0 36.2 31.4 37.4 85-89 33.776500000000006 35.0 34.0 35.4 31.0 36.4 90-94 33.32675 35.0 34.0 35.0 30.2 35.8 95-99 32.86709999999999 35.0 33.0 35.0 29.0 35.0 100-104 32.48005 34.8 32.8 35.0 28.2 35.0 105-109 32.1497 34.4 32.4 35.0 27.4 35.0 110-114 31.1512 34.0 31.0 35.0 23.6 35.0 115-119 31.4127 34.0 31.4 35.0 24.0 35.0 120-124 31.049149999999997 34.0 30.8 35.0 24.4 35.0 125-129 30.393549999999998 34.0 30.4 35.0 21.2 35.0 130-134 29.96445 34.0 30.0 35.0 19.2 35.0 135-139 27.813799999999997 33.0 25.4 35.0 5.0 35.0 140-144 27.278749999999995 32.8 25.4 34.6 2.0 35.0 145-149 24.661849999999998 31.4 12.6 34.0 2.0 35.0 150 18.36625 24.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 2.0 11 2.0 12 6.0 13 5.0 14 4.0 15 7.0 16 3.0 17 6.0 18 4.0 19 4.0 20 9.0 21 20.0 22 13.0 23 14.0 24 24.0 25 27.0 26 40.0 27 43.0 28 49.0 29 67.0 30 97.0 31 136.0 32 174.0 33 287.0 34 418.0 35 675.0 36 1125.0 37 734.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.25773195876289 18.195876288659793 10.79896907216495 35.74742268041237 2 17.849999999999998 26.275 38.824999999999996 17.05 3 16.05 31.45 26.625 25.874999999999996 4 21.525 37.574999999999996 20.875 20.025000000000002 5 20.175 38.6 21.7 19.525000000000002 6 17.075000000000003 35.9 24.375 22.650000000000002 7 13.950000000000001 18.85 46.625 20.575 8 18.45 18.4 29.225 33.925 9 18.8 21.4 29.825000000000003 29.975 10-14 20.39 29.975 25.840000000000003 23.794999999999998 15-19 20.515 29.26 26.69 23.535 20-24 20.474999999999998 28.565 27.065 23.895 25-29 20.54 28.48 27.169999999999998 23.810000000000002 30-34 20.605 28.765 27.0 23.630000000000003 35-39 20.23 29.01 27.055 23.705000000000002 40-44 20.39 28.775000000000002 27.415 23.419999999999998 45-49 21.0 28.095 27.68 23.225 50-54 21.395 27.900000000000002 27.3 23.405 55-59 20.535 28.244999999999997 27.245 23.974999999999998 60-64 21.495 28.16 27.250000000000004 23.095 65-69 20.4 27.88 27.544999999999998 24.175 70-74 20.705000000000002 27.72 28.060000000000002 23.515 75-79 20.79 27.544999999999998 27.48 24.185000000000002 80-84 21.34 27.665 27.3 23.695 85-89 21.15 28.115000000000002 27.445000000000004 23.29 90-94 21.279999999999998 27.884999999999998 27.250000000000004 23.585 95-99 21.45 27.875 27.29 23.385 100-104 21.205 28.389999999999997 27.355 23.05 105-109 21.404999999999998 27.485 27.29 23.82 110-114 21.37 27.91 27.445000000000004 23.275000000000002 115-119 20.965 27.875 27.845 23.315 120-124 22.009999999999998 27.779999999999998 26.729999999999997 23.48 125-129 20.94 27.96 27.595 23.505000000000003 130-134 22.035 27.779999999999998 26.69 23.494999999999997 135-139 20.61 28.16 27.49 23.74 140-144 22.155 27.66 26.939999999999998 23.244999999999997 145-149 22.455 27.975 26.650000000000002 22.919999999999998 150 10.875 36.15 27.150000000000002 25.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 2.5 25 4.0 26 3.5 27 7.0 28 9.0 29 12.0 30 21.5 31 28.0 32 31.5 33 40.0 34 55.5 35 72.5 36 77.0 37 87.5 38 115.0 39 153.5 40 185.0 41 202.0 42 219.5 43 245.5 44 285.5 45 272.0 46 243.5 47 254.5 48 251.5 49 225.5 50 182.0 51 154.5 52 131.0 53 96.5 54 80.0 55 61.5 56 42.0 57 35.5 58 30.0 59 24.5 60 19.5 61 14.0 62 8.0 63 3.0 64 2.0 65 1.5 66 0.5 67 0.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.6301991429291656 1.25 3 0.0 0.0 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.45 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.45 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.5375000000000001 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3727130 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.821 34.0 31.0 34.0 30.0 34.0 2 32.00475 34.0 31.0 34.0 31.0 34.0 3 31.90175 34.0 31.0 34.0 31.0 34.0 4 35.2995 37.0 37.0 37.0 35.0 37.0 5 35.349 37.0 37.0 37.0 35.0 37.0 6 35.2405 37.0 37.0 37.0 35.0 37.0 7 35.4005 37.0 37.0 37.0 35.0 37.0 8 35.4015 37.0 37.0 37.0 35.0 37.0 9 37.09675 39.0 38.0 39.0 35.0 39.0 10-14 37.350350000000006 39.4 38.2 39.4 35.2 39.4 15-19 38.46685 41.0 39.0 41.0 35.6 41.0 20-24 38.374550000000006 41.0 39.0 41.0 35.4 41.0 25-29 38.14325 40.2 38.6 41.0 34.8 41.0 30-34 37.7851 40.0 38.0 41.0 34.0 41.0 35-39 37.5612 40.0 38.0 41.0 33.4 41.0 40-44 37.2064 40.0 38.0 41.0 32.6 41.0 45-49 36.832 40.0 37.2 41.0 31.4 41.0 50-54 36.119600000000005 38.8 36.2 40.0 30.2 40.6 55-59 36.33345 39.4 36.2 40.8 30.2 41.0 60-64 36.3283 39.0 35.8 41.0 31.2 41.0 65-69 35.69905 38.0 35.0 40.2 31.0 41.0 70-74 34.334649999999996 36.4 34.2 38.8 28.6 40.4 75-79 33.39295 35.2 34.0 36.8 28.2 38.8 80-84 32.34455 35.0 33.6 35.8 26.0 37.0 85-89 32.043499999999995 35.0 33.2 35.0 26.6 36.0 90-94 31.558 35.0 33.0 35.0 25.0 35.2 95-99 30.9355 34.2 32.2 35.0 22.0 35.0 100-104 30.869 34.2 32.0 35.0 23.0 35.0 105-109 30.6247 34.0 31.6 35.0 20.0 35.0 110-114 29.575349999999997 34.0 29.8 35.0 13.0 35.0 115-119 29.494 34.0 30.0 35.0 11.0 35.0 120-124 29.092149999999997 33.8 29.6 35.0 6.2 35.0 125-129 28.204949999999997 33.0 27.4 35.0 2.0 35.0 130-134 28.195749999999997 33.4 28.2 35.0 2.0 35.0 135-139 26.9954 32.4 25.0 34.4 2.0 35.0 140-144 26.035000000000004 31.6 22.6 34.0 2.0 35.0 145-149 24.6346 31.2 15.2 34.0 2.0 35.0 150 21.65225 29.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 103.0 3 6.0 4 5.0 5 7.0 6 3.0 7 7.0 8 8.0 9 9.0 10 8.0 11 4.0 12 8.0 13 9.0 14 10.0 15 6.0 16 12.0 17 10.0 18 10.0 19 18.0 20 13.0 21 24.0 22 21.0 23 19.0 24 28.0 25 29.0 26 38.0 27 57.0 28 61.0 29 87.0 30 96.0 31 118.0 32 161.0 33 237.0 34 357.0 35 652.0 36 1104.0 37 650.0 38 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 14.725 13.475000000000001 33.5 2 22.05 23.974999999999998 36.7 17.275 3 20.125 27.0 29.549999999999997 23.325000000000003 4 24.474999999999998 36.05 18.775 20.7 5 22.925 38.85 20.075000000000003 18.15 6 15.825 38.4 23.474999999999998 22.3 7 16.375 15.35 44.800000000000004 23.474999999999998 8 20.4 21.125 27.224999999999998 31.25 9 22.400000000000002 21.925 27.875 27.800000000000004 10-14 22.035 28.634999999999998 26.479999999999997 22.85 15-19 22.48 28.205000000000002 27.26 22.055 20-24 23.044999999999998 27.905 27.310000000000002 21.740000000000002 25-29 22.259999999999998 28.005000000000003 27.310000000000002 22.425 30-34 22.689999999999998 27.505000000000003 27.68 22.125 35-39 22.81 27.994999999999997 27.055 22.14 40-44 22.73 27.115000000000002 27.685 22.470000000000002 45-49 22.59 27.634999999999998 27.72 22.055 50-54 22.82 27.725 27.26 22.195 55-59 23.044999999999998 27.315 27.63 22.009999999999998 60-64 22.36 27.35 27.79 22.5 65-69 22.53 27.779999999999998 27.415 22.275 70-74 23.080000000000002 27.644999999999996 26.834999999999997 22.439999999999998 75-79 22.439999999999998 28.125 27.345000000000002 22.09 80-84 22.95 27.284999999999997 27.345000000000002 22.42 85-89 22.835 26.85 27.515 22.8 90-94 23.165 27.825 27.01 22.0 95-99 23.169999999999998 27.229999999999997 27.775 21.825 100-104 23.09 27.265 27.73 21.915000000000003 105-109 22.985 27.485 27.815 21.715 110-114 23.145 27.175 27.575 22.105 115-119 23.400000000000002 27.515 27.584999999999997 21.5 120-124 23.225 27.305 27.495000000000005 21.975 125-129 23.43351502725409 27.054058108716305 27.299094864229634 22.21333199979997 130-134 23.485 27.534999999999997 27.36 21.62 135-139 23.78 27.139999999999997 27.67 21.41 140-144 24.08 27.405 26.889999999999997 21.625 145-149 24.385 27.485 26.565 21.565 150 24.15 27.875 26.075 21.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 4.0 25 6.5 26 7.0 27 6.5 28 4.0 29 6.0 30 13.5 31 15.5 32 21.0 33 27.5 34 32.0 35 44.0 36 63.0 37 86.0 38 106.0 39 139.0 40 174.5 41 212.5 42 245.0 43 249.0 44 261.5 45 265.0 46 260.0 47 258.5 48 237.5 49 227.5 50 188.5 51 140.5 52 133.0 53 116.0 54 93.0 55 74.0 56 56.0 57 53.5 58 47.5 59 32.0 60 18.5 61 14.5 62 15.5 63 10.5 64 7.0 65 4.5 66 2.0 67 0.5 68 0.0 69 2.0 70 2.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.6048387096774194 1.2 3 0.025201612903225805 0.075 4 0.05040322580645161 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTGTA 10 0.006973645 144.0 4 >>END_MODULE Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937122 spots for SRR3727130.sra Written 937122 spots for SRR3727130.sra Read 937123 spots for SRR3727130.sra Written 937123 spots for SRR3727130.sra SRR ids: ['SRR3727130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_37p03oyx SRR3727130.sra spots: 18742441 blocks: [[1, 937122], [937123, 1874244], [1874245, 2811366], [2811367, 3748488], [3748489, 4685610], [4685611, 5622732], [5622733, 6559854], [6559855, 7496976], [7496977, 8434098], [8434099, 9371220], [9371221, 10308342], [10308343, 11245464], [11245465, 12182586], [12182587, 13119708], [13119709, 14056830], [14056831, 14993952], [14993953, 15931074], [15931075, 16868196], [16868197, 17805318], [17805319, 18742441]] SRR3727130 file size 6292891 SRR3727130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727130 SRR3727130_1.fastq SRR3727130_2.fastq Input file: SRR3727130_1.fastq Paired file: SRR3727130_2.fastq trimmed: SRR3727130-trimmed-pair1.fastq, SRR3727130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:35:00 2025 >> started Fri Feb 14 11:35:25 2025 >> done (24.641s) 18742441 read pairs processed; of these: 89557 ( 0.48%) short read pairs filtered out after trimming by size control 432665 ( 2.31%) empty read pairs filtered out after trimming by size control 18220219 (97.21%) read pairs available; of these: 8089005 (44.40%) trimmed read pairs available after processing 10131214 (55.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 12 0.00% 21 11 0.00% 22 19 0.00% 23 30 0.00% 24 32 0.00% 25 33 0.00% 26 53 0.00% 27 59 0.00% 28 90 0.00% 29 89 0.00% 30 86 0.00% 31 139 0.00% 32 135 0.00% 33 174 0.00% 34 179 0.00% 35 228 0.00% 36 256 0.00% 37 251 0.00% 38 337 0.00% 39 337 0.00% 40 404 0.00% 41 433 0.00% 42 462 0.00% 43 501 0.00% 44 538 0.00% 45 572 0.00% 46 629 0.00% 47 697 0.00% 48 691 0.00% 49 770 0.00% 50 825 0.00% 51 874 0.00% 52 898 0.00% 53 999 0.01% 54 1043 0.01% 55 1058 0.01% 56 1160 0.01% 57 1156 0.01% 58 1282 0.01% 59 1345 0.01% 60 1448 0.01% 61 1495 0.01% 62 1632 0.01% 63 1610 0.01% 64 1809 0.01% 65 1826 0.01% 66 1838 0.01% 67 2022 0.01% 68 2112 0.01% 69 2269 0.01% 70 2459 0.01% 71 2540 0.01% 72 2586 0.01% 73 2839 0.02% 74 2891 0.02% 75 3198 0.02% 76 3431 0.02% 77 3829 0.02% 78 3923 0.02% 79 4154 0.02% 80 4601 0.03% 81 4893 0.03% 82 5508 0.03% 83 6453 0.04% 84 11507 0.06% 85 11756 0.06% 86 12093 0.07% 87 12807 0.07% 88 12887 0.07% 89 13262 0.07% 90 13818 0.08% 91 14300 0.08% 92 14590 0.08% 93 15127 0.08% 94 15626 0.09% 95 16260 0.09% 96 16583 0.09% 97 17024 0.09% 98 16885 0.09% 99 17381 0.10% 100 17128 0.09% 101 17276 0.09% 102 18625 0.10% 103 18085 0.10% 104 18362 0.10% 105 20265 0.11% 106 19674 0.11% 107 20940 0.11% 108 22291 0.12% 109 27205 0.15% 110 23187 0.13% 111 23782 0.13% 112 24628 0.14% 113 26744 0.15% 114 24495 0.13% 115 47626 0.26% 116 25682 0.14% 117 26931 0.15% 118 25552 0.14% 119 28890 0.16% 120 38623 0.21% 121 29476 0.16% 122 27437 0.15% 123 28351 0.16% 124 31642 0.17% 125 37360 0.21% 126 35445 0.19% 127 35378 0.19% 128 37373 0.21% 129 41333 0.23% 130 45662 0.25% 131 45382 0.25% 132 51833 0.28% 133 81679 0.45% 134 87521 0.48% 135 78865 0.43% 136 109659 0.60% 137 123186 0.68% 138 125968 0.69% 139 137501 0.75% 140 144625 0.79% 141 165104 0.91% 142 187376 1.03% 143 219558 1.21% 144 257983 1.42% 145 309924 1.70% 146 399588 2.19% 147 555812 3.05% 148 852251 4.68% 149 2967576 16.29% 150 10131214 55.60% 18220219 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=6.89 fanout-score-rank=12 prefix-density=0.41 prefix-fanout=4.7 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=42.87 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.9 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.32 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=105.32 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCT SRR3727130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:37:02 Started mapping on | Feb 14 11:37:02 Finished on | Feb 14 11:38:39 Mapping speed, Million of reads per hour | 676.21 Number of input reads | 18220219 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17434422 Uniquely mapped reads % | 95.69% Average mapped length | 291.27 Number of splices: Total | 16348962 Number of splices: Annotated (sjdb) | 16062245 Number of splices: GT/AG | 16049079 Number of splices: GC/AG | 256157 Number of splices: AT/AC | 11117 Number of splices: Non-canonical | 32609 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515961 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 40584 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293651 293651 293651 N_multimapping 515961 515961 515961 N_noFeature 507091 17221792 620614 N_ambiguous 193620 961 93832 UnstrandedReadsAssigned:16733711 PositiveStrandReadsAssigned:211669 NegativeStrandReadsAssigned:16719976 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727130-trimmed-pair1.fastq SRR3727130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,220,219 reads, 16,977,601 reads pseudoaligned [quant] estimated average fragment length: 257.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR3727130.ke.tsv 34699 SRR3727130.se.tsv 87100 total ==> SRR3727130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.4 424 13.5329 Potri.005G024800.1.v4.1 1035 778.404 86 6.21123 Potri.004G059700.1.v4.1 961 704.46 25 1.99511 Potri.007G009000.2.v4.1 1416 1159.4 5 0.242448 Potri.003G141000.2.v4.1 2943 2686.4 381.369 7.98102 Potri.016G087400.1.v4.1 270 73.0931 916 704.536 Potri.015G069301.1.v4.1 564 314.98 0 0 Potri.010G195200.1.v4.1 1773 1516.4 6 0.222444 Potri.012G127500.1.v4.1 977 720.432 2527 197.195 ==> SRR3727130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 54 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 399 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3727130 completed mapping pipeline successfully