Starting /dee2/code/volunteer_pipeline.sh SRR3727131 current disk space = 3114364948480 free memory = 1576032468 SRR3727131 SRAfilesize cd6c922b481dfe2d2deeb09474cffa7c SRR3727131.sra SRR3727131.sra file validated SRR3727131 is paired end SRR3727131 is conventional basespace SRR3727131 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20575 34.0 31.0 34.0 31.0 34.0 2 32.6635 34.0 31.0 34.0 31.0 34.0 3 32.99525 34.0 31.0 34.0 31.0 34.0 4 36.4885 37.0 37.0 37.0 35.0 37.0 5 36.45725 37.0 37.0 37.0 35.0 37.0 6 36.46775 37.0 37.0 37.0 35.0 37.0 7 36.41325 37.0 37.0 37.0 35.0 37.0 8 36.429 37.0 37.0 37.0 35.0 37.0 9 38.2195 39.0 39.0 39.0 37.0 39.0 10-14 38.4727 39.4 39.2 39.4 37.0 39.4 15-19 39.485749999999996 41.0 39.2 41.0 36.8 41.0 20-24 39.485400000000006 41.0 39.0 41.0 36.8 41.0 25-29 39.29195 40.4 39.0 41.0 36.2 41.0 30-34 39.0867 40.0 38.6 41.0 36.0 41.0 35-39 38.70665 40.0 38.0 41.0 35.0 41.0 40-44 38.73415 40.0 38.0 41.0 35.0 41.0 45-49 38.69445 40.0 38.2 41.0 34.8 41.0 50-54 38.65855 40.0 38.0 41.0 35.0 41.0 55-59 38.19904999999999 40.0 37.6 41.0 34.2 41.0 60-64 37.66975 39.4 36.6 41.0 33.0 41.0 65-69 37.00185 38.6 35.6 40.2 32.4 41.0 70-74 35.996449999999996 36.8 35.0 39.2 31.4 40.6 75-79 34.631099999999996 35.2 33.8 37.4 30.4 39.0 80-84 33.9842 35.0 34.0 36.4 30.0 37.6 85-89 33.4395 35.0 34.0 35.4 29.6 36.4 90-94 33.106100000000005 35.0 33.8 35.0 29.6 35.8 95-99 32.799350000000004 35.0 33.4 35.0 29.2 35.0 100-104 32.380649999999996 34.8 33.0 35.0 27.8 35.0 105-109 32.0995 34.0 32.2 35.0 27.0 35.0 110-114 31.669249999999998 34.0 31.8 35.0 26.0 35.0 115-119 31.36465 34.0 31.2 35.0 25.0 35.0 120-124 30.886900000000004 34.0 31.0 35.0 23.6 35.0 125-129 30.13515 34.0 29.6 35.0 20.4 35.0 130-134 29.176499999999997 33.4 28.6 35.0 15.8 35.0 135-139 29.103949999999998 33.4 29.0 35.0 14.0 35.0 140-144 27.255399999999998 32.2 25.4 34.2 2.6 35.0 145-149 24.57815 31.8 13.4 34.0 2.0 35.0 150 17.4705 23.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 1.0 8 2.0 9 4.0 10 3.0 11 4.0 12 4.0 13 4.0 14 5.0 15 8.0 16 3.0 17 7.0 18 14.0 19 9.0 20 13.0 21 14.0 22 13.0 23 23.0 24 22.0 25 26.0 26 43.0 27 39.0 28 49.0 29 83.0 30 82.0 31 146.0 32 167.0 33 253.0 34 417.0 35 688.0 36 1181.0 37 664.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.937098844672654 19.845956354300384 12.631578947368421 36.58536585365854 2 17.925 27.075 38.224999999999994 16.775000000000002 3 16.725 32.35 28.199999999999996 22.725 4 20.325 36.825 22.400000000000002 20.45 5 21.0 38.0 22.35 18.65 6 15.65 37.8 25.575 20.974999999999998 7 11.75 20.674999999999997 45.275 22.3 8 17.2 20.9 29.125 32.775 9 17.95 22.0 31.6 28.449999999999996 10-14 19.005 29.904999999999998 26.955000000000002 24.135 15-19 19.655 28.994999999999997 27.685 23.665 20-24 19.814999999999998 29.715000000000003 27.305 23.165 25-29 19.919999999999998 29.26 27.77 23.05 30-34 20.0 29.195 27.71 23.095 35-39 20.165 29.265 27.705000000000002 22.865 40-44 19.91 29.21 27.24 23.64 45-49 19.994999999999997 28.754999999999995 27.560000000000002 23.69 50-54 19.64 28.58 27.815 23.965 55-59 20.285 28.92 27.73 23.064999999999998 60-64 19.63 29.2 27.43 23.74 65-69 19.78 28.48 28.09 23.65 70-74 20.455000000000002 28.365000000000002 27.705000000000002 23.474999999999998 75-79 20.29 28.494999999999997 27.825 23.39 80-84 20.41 27.875 28.16 23.555 85-89 20.895 28.225 28.299999999999997 22.58 90-94 20.645 28.525 27.250000000000004 23.580000000000002 95-99 20.979999999999997 27.88 27.525 23.615 100-104 20.565 28.215 27.474999999999998 23.745 105-109 20.935000000000002 28.125 27.595 23.345 110-114 20.145 28.65 27.41 23.794999999999998 115-119 20.3 27.655 27.834999999999997 24.21 120-124 20.94 28.050000000000004 27.365000000000002 23.645 125-129 20.39 28.634999999999998 27.87 23.105 130-134 20.544999999999998 28.675 27.47 23.31 135-139 21.17 28.060000000000002 27.805000000000003 22.965 140-144 20.375 28.975 27.779999999999998 22.869999999999997 145-149 20.385 29.125 27.02 23.47 150 10.85 35.699999999999996 28.825 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 2.0 25 5.5 26 7.5 27 7.5 28 10.5 29 17.5 30 21.5 31 33.0 32 44.0 33 45.0 34 62.5 35 89.0 36 102.5 37 126.5 38 143.0 39 164.0 40 210.0 41 229.5 42 242.0 43 263.5 44 273.5 45 272.5 46 257.5 47 240.5 48 225.5 49 188.0 50 153.5 51 136.0 52 109.0 53 81.5 54 62.0 55 47.5 56 30.5 57 19.0 58 18.5 59 13.0 60 6.5 61 5.5 62 8.0 63 8.0 64 3.5 65 1.0 66 0.5 67 0.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.30000000000000004 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.3625 0.0 0.0 0.0 0.0 130-131 0.44999999999999996 0.0 0.0 0.0 0.0 132-133 0.525 0.0 0.0 0.0 0.0 134-135 0.5875 0.0 0.0 0.0 0.0 136-137 0.7250000000000001 0.0 0.0 0.0 0.0 138 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAATA 10 0.0069754543 143.9875 7 ATATCAG 10 0.0069754543 143.9875 6 >>END_MODULE SRR3727131 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4105 34.0 31.0 34.0 30.0 34.0 2 31.65125 34.0 31.0 34.0 30.0 34.0 3 31.79 34.0 31.0 34.0 30.0 34.0 4 35.1805 37.0 35.0 37.0 35.0 37.0 5 35.22275 37.0 37.0 37.0 35.0 37.0 6 35.27875 37.0 37.0 37.0 35.0 37.0 7 35.20525 37.0 37.0 37.0 35.0 37.0 8 35.16725 37.0 36.0 37.0 35.0 37.0 9 36.95725 39.0 38.0 39.0 35.0 39.0 10-14 37.176649999999995 39.4 38.2 39.4 35.0 39.4 15-19 38.07455 40.2 38.6 41.0 34.0 41.0 20-24 38.0938 40.2 38.6 41.0 34.4 41.0 25-29 37.916399999999996 40.0 38.6 41.0 34.0 41.0 30-34 37.517250000000004 40.0 38.0 41.0 33.0 41.0 35-39 37.27145 40.0 38.0 41.0 32.4 41.0 40-44 36.76015 40.0 37.2 41.0 30.8 41.0 45-49 36.903800000000004 40.0 37.6 41.0 31.6 41.0 50-54 36.2635 39.0 36.4 40.2 31.0 40.8 55-59 36.4691 39.0 36.2 41.0 31.0 41.0 60-64 36.339150000000004 39.0 35.6 41.0 31.0 41.0 65-69 35.65285 38.2 35.0 40.2 30.4 41.0 70-74 34.5625 36.4 34.8 39.0 29.4 40.6 75-79 33.43235 35.0 34.0 37.0 27.8 39.0 80-84 32.599399999999996 35.0 33.6 36.2 27.2 37.2 85-89 31.38425 34.8 32.0 35.0 24.0 36.0 90-94 31.4243 35.0 32.4 35.0 25.0 35.4 95-99 31.16885 34.8 32.0 35.0 24.2 35.0 100-104 30.523500000000002 34.2 31.2 35.0 20.2 35.0 105-109 30.560899999999997 34.0 31.4 35.0 19.6 35.0 110-114 30.175599999999996 34.0 30.8 35.0 18.4 35.0 115-119 29.71395 34.0 30.0 35.0 13.8 35.0 120-124 29.585700000000003 34.0 30.0 35.0 12.4 35.0 125-129 28.9651 34.0 28.8 35.0 6.0 35.0 130-134 27.683700000000005 33.0 26.2 35.0 2.0 35.0 135-139 27.6276 33.0 26.6 34.8 2.0 35.0 140-144 27.188300000000005 33.0 25.4 34.2 2.0 35.0 145-149 25.45745 32.0 21.8 34.0 2.0 35.0 150 21.79075 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 105.0 3 7.0 4 8.0 5 9.0 6 4.0 7 4.0 8 8.0 9 9.0 10 9.0 11 8.0 12 7.0 13 8.0 14 11.0 15 11.0 16 7.0 17 9.0 18 9.0 19 15.0 20 8.0 21 26.0 22 25.0 23 13.0 24 17.0 25 30.0 26 39.0 27 53.0 28 60.0 29 53.0 30 73.0 31 119.0 32 190.0 33 239.0 34 382.0 35 663.0 36 1121.0 37 639.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.2 14.549999999999999 14.05 34.2 2 22.55 22.075 38.925 16.45 3 19.400000000000002 25.424999999999997 31.55 23.625 4 23.1 35.125 20.775 21.0 5 23.375 37.574999999999996 20.625 18.425 6 17.8 37.25 23.925 21.025 7 16.075 16.25 45.625 22.05 8 20.375 21.275 27.925 30.425 9 22.125 22.85 28.65 26.375 10-14 22.495 28.74 26.919999999999998 21.845 15-19 22.439999999999998 28.610000000000003 27.694999999999997 21.255 20-24 23.01 28.355000000000004 27.73 20.905 25-29 23.215 28.28 27.67 20.835 30-34 23.119999999999997 28.125 27.51 21.245 35-39 22.384999999999998 28.185 28.565 20.865000000000002 40-44 23.1 27.944999999999997 27.83 21.125 45-49 22.645 28.050000000000004 28.055000000000003 21.25 50-54 22.705000000000002 27.615000000000002 28.110000000000003 21.57 55-59 22.805 28.26 28.705000000000002 20.23 60-64 23.21 27.93 28.384999999999998 20.474999999999998 65-69 23.325000000000003 27.67 28.285 20.72 70-74 23.03 27.82 28.294999999999998 20.855 75-79 22.54 28.16 28.225 21.075 80-84 22.95 28.1 28.015 20.935000000000002 85-89 23.400000000000002 28.83 26.979999999999997 20.79 90-94 22.650000000000002 27.845 28.595 20.91 95-99 23.24 27.935 27.775 21.05 100-104 23.345 28.49 27.62 20.544999999999998 105-109 23.294999999999998 27.6 28.685 20.419999999999998 110-114 23.69 28.09 27.72 20.5 115-119 22.465 28.110000000000003 28.26 21.165 120-124 23.485 27.889999999999997 27.975 20.65 125-129 22.975 28.76 27.21 21.055 130-134 23.885 28.035 27.450000000000003 20.630000000000003 135-139 23.65 28.585 27.74 20.025000000000002 140-144 23.59 27.794999999999998 27.889999999999997 20.724999999999998 145-149 23.810000000000002 28.88 27.205000000000002 20.105 150 24.165621079046424 27.603513174404014 27.478042659974903 20.752823086574654 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 1.5 13 1.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 2.5 21 2.5 22 2.5 23 2.0 24 1.5 25 3.0 26 4.0 27 5.5 28 8.5 29 11.0 30 11.5 31 16.5 32 26.5 33 33.5 34 44.5 35 57.5 36 79.0 37 116.5 38 145.5 39 163.0 40 199.0 41 233.0 42 262.5 43 269.0 44 270.5 45 263.0 46 261.5 47 248.0 48 220.0 49 218.5 50 187.0 51 141.0 52 116.5 53 93.0 54 64.0 55 53.0 56 37.0 57 27.0 58 19.5 59 14.0 60 14.0 61 7.0 62 4.5 63 6.5 64 6.5 65 4.5 66 2.0 67 2.0 68 2.5 69 2.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.3269617706237425 0.65 3 0.1006036217303823 0.3 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3375 0.0 0.0 0.0 0.0 126-127 0.35 0.0 0.0 0.0 0.0 128-129 0.3625 0.0 0.0 0.0 0.0 130-131 0.48750000000000004 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.6875 0.0 0.0 0.0 0.0 136-137 0.8500000000000001 0.0 0.0 0.0 0.0 138 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931978 spots for SRR3727131.sra Written 931978 spots for SRR3727131.sra Read 931991 spots for SRR3727131.sra Written 931991 spots for SRR3727131.sra SRR ids: ['SRR3727131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l_uwfz3y SRR3727131.sra spots: 18639573 blocks: [[1, 931978], [931979, 1863956], [1863957, 2795934], [2795935, 3727912], [3727913, 4659890], [4659891, 5591868], [5591869, 6523846], [6523847, 7455824], [7455825, 8387802], [8387803, 9319780], [9319781, 10251758], [10251759, 11183736], [11183737, 12115714], [12115715, 13047692], [13047693, 13979670], [13979671, 14911648], [14911649, 15843626], [15843627, 16775604], [16775605, 17707582], [17707583, 18639573]] SRR3727131 file size 6258233 SRR3727131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727131 SRR3727131_1.fastq SRR3727131_2.fastq Input file: SRR3727131_1.fastq Paired file: SRR3727131_2.fastq trimmed: SRR3727131-trimmed-pair1.fastq, SRR3727131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:31:51 2025 >> started Fri Feb 14 11:32:11 2025 >> done (20.136s) 18639573 read pairs processed; of these: 85985 ( 0.46%) short read pairs filtered out after trimming by size control 344771 ( 1.85%) empty read pairs filtered out after trimming by size control 18208817 (97.69%) read pairs available; of these: 9465586 (51.98%) trimmed read pairs available after processing 8743231 (48.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 10 0.00% 22 11 0.00% 23 30 0.00% 24 31 0.00% 25 39 0.00% 26 50 0.00% 27 62 0.00% 28 66 0.00% 29 94 0.00% 30 129 0.00% 31 124 0.00% 32 144 0.00% 33 174 0.00% 34 189 0.00% 35 237 0.00% 36 307 0.00% 37 291 0.00% 38 351 0.00% 39 403 0.00% 40 413 0.00% 41 524 0.00% 42 542 0.00% 43 622 0.00% 44 638 0.00% 45 696 0.00% 46 787 0.00% 47 832 0.00% 48 854 0.00% 49 997 0.01% 50 1027 0.01% 51 1072 0.01% 52 1197 0.01% 53 1247 0.01% 54 1281 0.01% 55 1407 0.01% 56 1412 0.01% 57 1578 0.01% 58 1680 0.01% 59 1746 0.01% 60 1782 0.01% 61 1967 0.01% 62 2076 0.01% 63 2147 0.01% 64 2311 0.01% 65 2476 0.01% 66 2601 0.01% 67 2778 0.02% 68 2866 0.02% 69 3037 0.02% 70 3183 0.02% 71 3451 0.02% 72 3678 0.02% 73 3780 0.02% 74 4179 0.02% 75 4337 0.02% 76 4501 0.02% 77 5161 0.03% 78 5197 0.03% 79 5671 0.03% 80 6242 0.03% 81 6841 0.04% 82 7677 0.04% 83 8428 0.05% 84 12410 0.07% 85 12614 0.07% 86 13558 0.07% 87 14138 0.08% 88 14442 0.08% 89 15288 0.08% 90 15894 0.09% 91 16684 0.09% 92 17078 0.09% 93 17347 0.10% 94 17997 0.10% 95 18287 0.10% 96 19077 0.10% 97 20006 0.11% 98 20052 0.11% 99 20413 0.11% 100 20558 0.11% 101 20623 0.11% 102 21678 0.12% 103 21913 0.12% 104 22606 0.12% 105 23032 0.13% 106 23112 0.13% 107 24746 0.14% 108 25353 0.14% 109 25671 0.14% 110 26384 0.14% 111 27015 0.15% 112 27396 0.15% 113 27490 0.15% 114 30000 0.16% 115 44106 0.24% 116 32458 0.18% 117 31919 0.18% 118 31820 0.17% 119 32659 0.18% 120 37599 0.21% 121 39639 0.22% 122 36074 0.20% 123 37409 0.21% 124 39164 0.22% 125 42403 0.23% 126 44461 0.24% 127 46532 0.26% 128 51285 0.28% 129 58780 0.32% 130 59747 0.33% 131 65542 0.36% 132 84906 0.47% 133 85747 0.47% 134 92881 0.51% 135 92338 0.51% 136 113611 0.62% 137 132282 0.73% 138 151720 0.83% 139 176053 0.97% 140 187237 1.03% 141 212803 1.17% 142 235741 1.29% 143 273582 1.50% 144 333453 1.83% 145 408961 2.25% 146 533860 2.93% 147 751237 4.13% 148 1126536 6.19% 149 2988514 16.41% 150 8743231 48.02% 18208817 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=34 prefix-density=0.55 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.17 sequence-density-rank=27 fanout-score=11.29 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=3.0 sequence=TTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=12 prefix-density=0.76 prefix-fanout=2.6 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=30.90 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=7.9 sequence=AAGGCCAAGATCCAGGACAAGGA SRR3727131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:33:01 Started mapping on | Feb 14 11:33:03 Finished on | Feb 14 11:34:52 Mapping speed, Million of reads per hour | 601.39 Number of input reads | 18208817 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17282357 Uniquely mapped reads % | 94.91% Average mapped length | 289.68 Number of splices: Total | 15072188 Number of splices: Annotated (sjdb) | 14781107 Number of splices: GT/AG | 14836140 Number of splices: GC/AG | 191786 Number of splices: AT/AC | 13066 Number of splices: Non-canonical | 31196 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.03% Deletion average length | 1.92 Insertion rate per base | 0.02% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450787 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 33761 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 493873 493873 493873 N_multimapping 450787 450787 450787 N_noFeature 587654 17066471 707664 N_ambiguous 205643 1533 108647 UnstrandedReadsAssigned:16489060 PositiveStrandReadsAssigned:214353 NegativeStrandReadsAssigned:16466046 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR3727131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727131-trimmed-pair1.fastq SRR3727131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,208,817 reads, 16,523,863 reads pseudoaligned [quant] estimated average fragment length: 255.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR3727131.ke.tsv 34699 SRR3727131.se.tsv 87100 total ==> SRR3727131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.11 1603 47.2404 Potri.005G024800.1.v4.1 1035 780.11 452 30.1052 Potri.004G059700.1.v4.1 961 706.139 8 0.588652 Potri.007G009000.2.v4.1 1416 1161.11 0 0 Potri.003G141000.2.v4.1 2943 2688.11 525 10.1478 Potri.016G087400.1.v4.1 270 68.5832 744 563.656 Potri.015G069301.1.v4.1 564 313.922 0 0 Potri.010G195200.1.v4.1 1773 1518.11 298 10.1993 Potri.012G127500.1.v4.1 977 722.12 13913 1001.08 ==> SRR3727131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 395 SRR3727131 completed mapping pipeline successfully