Starting /dee2/code/volunteer_pipeline.sh SRR3727132 current disk space = 3114196955136 free memory = 1568504888 SRR3727132 SRAfilesize f03cacd492b0846810b50f9df4a89fe4 SRR3727132.sra SRR3727132.sra file validated SRR3727132 is paired end SRR3727132 is conventional basespace SRR3727132 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.585 34.0 31.0 34.0 30.0 34.0 2 32.40275 34.0 31.0 34.0 31.0 34.0 3 32.862 34.0 31.0 34.0 31.0 34.0 4 36.371 37.0 37.0 37.0 35.0 37.0 5 36.34225 37.0 37.0 37.0 35.0 37.0 6 36.35275 37.0 37.0 37.0 35.0 37.0 7 36.29125 37.0 37.0 37.0 35.0 37.0 8 36.30875 37.0 37.0 37.0 35.0 37.0 9 38.1295 39.0 39.0 39.0 37.0 39.0 10-14 38.44465 39.4 39.2 39.4 37.0 39.4 15-19 39.5621 41.0 39.6 41.0 36.8 41.0 20-24 39.52284999999999 41.0 39.0 41.0 37.0 41.0 25-29 39.356649999999995 40.8 39.0 41.0 36.2 41.0 30-34 39.068400000000004 40.0 38.6 41.0 35.8 41.0 35-39 38.86110000000001 40.0 38.0 41.0 35.2 41.0 40-44 38.46489999999999 40.0 38.0 41.0 34.2 41.0 45-49 38.31795000000001 40.0 38.0 41.0 33.8 41.0 50-54 38.1978 40.0 38.0 41.0 33.6 41.0 55-59 37.85205 39.8 37.0 41.0 33.2 41.0 60-64 37.787 39.4 36.6 41.0 33.2 41.0 65-69 36.919000000000004 38.4 35.2 40.2 32.0 41.0 70-74 36.02845 36.8 35.0 39.2 31.4 40.8 75-79 34.4616 35.2 33.8 37.4 30.0 39.2 80-84 34.11475 35.0 34.0 36.4 30.0 37.6 85-89 33.46485 35.0 34.0 35.2 29.8 36.2 90-94 33.0711 35.0 34.0 35.0 29.2 35.8 95-99 32.62755 35.0 33.2 35.0 28.6 35.0 100-104 32.3343 35.0 32.8 35.0 27.6 35.0 105-109 32.20485 34.8 32.4 35.0 27.4 35.0 110-114 32.04815 34.0 32.2 35.0 27.0 35.0 115-119 31.620749999999997 34.0 32.0 35.0 25.4 35.0 120-124 31.1744 34.0 31.2 35.0 24.2 35.0 125-129 30.7442 34.0 31.0 35.0 23.2 35.0 130-134 30.189999999999998 34.0 30.4 35.0 19.4 35.0 135-139 29.4829 34.0 29.2 35.0 17.2 35.0 140-144 28.760849999999998 33.4 29.0 35.0 6.0 35.0 145-149 27.36605 33.0 26.6 34.8 2.0 35.0 150 22.161 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 2.0 10 4.0 11 2.0 12 9.0 13 4.0 14 5.0 15 4.0 16 8.0 17 3.0 18 13.0 19 12.0 20 9.0 21 11.0 22 22.0 23 19.0 24 25.0 25 29.0 26 28.0 27 44.0 28 67.0 29 64.0 30 101.0 31 109.0 32 150.0 33 219.0 34 328.0 35 585.0 36 1191.0 37 922.0 38 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.87721123829345 20.78563995837669 10.874089490114464 30.463059313215403 2 19.575 26.174999999999997 36.975 17.275 3 16.425 31.8 27.3 24.474999999999998 4 20.0 38.725 21.95 19.325 5 21.3 38.4 21.25 19.05 6 17.2 36.1 24.15 22.55 7 13.075000000000001 20.5 44.775 21.65 8 17.675 20.674999999999997 29.175 32.475 9 17.025000000000002 20.925 31.324999999999996 30.725 10-14 19.415 30.5 26.38 23.705000000000002 15-19 20.305 28.93 27.065 23.7 20-24 19.84 29.2 27.74 23.22 25-29 19.98 29.59 26.900000000000002 23.53 30-34 19.655 29.435 27.57 23.34 35-39 20.14 28.87 27.255000000000003 23.735 40-44 20.119999999999997 28.804999999999996 27.284999999999997 23.79 45-49 20.23 29.25 26.979999999999997 23.54 50-54 19.72 29.15 27.275 23.855 55-59 20.18 29.265 27.169999999999998 23.385 60-64 20.150000000000002 28.21 27.67 23.97 65-69 20.064999999999998 29.395 27.155 23.385 70-74 20.405 28.825 27.48 23.29 75-79 20.735 28.34 26.93 23.995 80-84 19.865 28.59 27.495000000000005 24.05 85-89 20.655 28.64 26.855 23.849999999999998 90-94 20.46 28.375 27.425 23.74 95-99 20.695 28.27 27.235 23.799999999999997 100-104 20.669999999999998 28.29 27.395000000000003 23.645 105-109 20.560000000000002 28.225 27.1 24.115000000000002 110-114 20.495 27.83 27.265 24.41 115-119 20.965 27.650000000000002 27.35 24.035 120-124 20.965 28.060000000000002 26.919999999999998 24.055 125-129 20.87 27.845 27.305 23.98 130-134 20.91 28.22 27.355 23.515 135-139 20.94 28.29 26.810000000000002 23.96 140-144 21.455 28.134999999999998 26.229999999999997 24.18 145-149 20.9 28.625 26.575 23.9 150 14.799999999999999 32.225 27.275 25.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 2.0 18 2.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 4.5 26 10.0 27 10.5 28 11.5 29 14.5 30 26.0 31 40.0 32 40.5 33 50.5 34 64.0 35 76.5 36 93.0 37 121.5 38 153.0 39 180.5 40 188.0 41 201.0 42 222.5 43 231.0 44 260.5 45 274.0 46 255.0 47 244.0 48 209.0 49 171.5 50 158.5 51 140.0 52 128.5 53 105.5 54 68.0 55 48.5 56 44.0 57 42.5 58 31.0 59 17.5 60 16.0 61 11.0 62 7.0 63 4.5 64 4.0 65 3.5 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4024144869215292 0.8 3 0.1006036217303823 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.1624999999999996 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.5625 0.0 0.0 0.0 0.0 138 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAAAA 10 0.0064622764 147.66667 1 CCACCTA 10 0.0069772652 143.975 8 TTAAAAG 10 0.0069772652 143.975 2 >>END_MODULE SRR3727132 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.98775 33.0 31.0 34.0 28.0 34.0 2 31.04225 34.0 31.0 34.0 28.0 34.0 3 31.25375 34.0 31.0 34.0 28.0 34.0 4 34.713 37.0 35.0 37.0 33.0 37.0 5 34.72175 37.0 35.0 37.0 33.0 37.0 6 34.798 37.0 37.0 37.0 33.0 37.0 7 34.55025 37.0 36.0 37.0 32.0 37.0 8 34.68725 37.0 36.0 37.0 33.0 37.0 9 36.4125 39.0 38.0 39.0 34.0 39.0 10-14 36.73115 39.4 38.2 39.4 33.8 39.4 15-19 37.81945 41.0 39.0 41.0 33.8 41.0 20-24 37.713300000000004 41.0 39.0 41.0 33.8 41.0 25-29 37.6306 40.6 39.0 41.0 33.8 41.0 30-34 37.3455 40.0 38.0 41.0 32.6 41.0 35-39 37.22665 40.0 38.0 41.0 32.6 41.0 40-44 36.9376 40.0 38.0 41.0 31.4 41.0 45-49 36.7378 40.0 38.0 41.0 31.0 41.0 50-54 36.03145 39.2 36.8 40.2 30.2 40.6 55-59 36.281850000000006 39.8 36.6 41.0 30.0 41.0 60-64 35.6798 38.8 35.4 40.4 29.0 41.0 65-69 34.869299999999996 37.4 35.0 39.6 28.4 41.0 70-74 34.42245 36.4 35.0 38.8 29.0 40.6 75-79 33.3275 35.2 34.0 37.0 28.2 39.0 80-84 32.5778 35.0 34.0 36.0 27.4 37.0 85-89 32.04455 35.0 34.0 35.0 26.2 36.0 90-94 31.669850000000004 35.0 33.0 35.0 25.4 35.4 95-99 31.544050000000006 35.0 33.0 35.0 25.0 35.0 100-104 31.344100000000005 35.0 33.0 35.0 24.6 35.0 105-109 31.165499999999998 35.0 33.0 35.0 24.0 35.0 110-114 30.9387 35.0 32.2 35.0 22.4 35.0 115-119 30.63105 34.2 32.0 35.0 19.2 35.0 120-124 30.4304 34.0 31.6 35.0 18.4 35.0 125-129 30.080000000000002 34.0 31.0 35.0 15.2 35.0 130-134 29.747700000000002 34.0 30.8 35.0 7.6 35.0 135-139 29.31295 34.0 30.0 35.0 3.6 35.0 140-144 28.733549999999997 34.0 29.0 35.0 2.0 35.0 145-149 27.68 33.8 28.2 35.0 2.0 35.0 150 23.9005 29.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 163.0 3 8.0 4 5.0 5 4.0 6 2.0 7 9.0 8 1.0 9 5.0 10 4.0 11 5.0 12 5.0 13 6.0 14 7.0 15 9.0 16 7.0 17 10.0 18 9.0 19 10.0 20 5.0 21 10.0 22 14.0 23 18.0 24 15.0 25 21.0 26 22.0 27 28.0 28 39.0 29 57.0 30 63.0 31 93.0 32 129.0 33 162.0 34 278.0 35 541.0 36 1254.0 37 967.0 38 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 15.975 13.350000000000001 30.3 2 22.900000000000002 23.75 35.9 17.45 3 20.1 24.025 33.1 22.775000000000002 4 24.825 35.625 19.7 19.85 5 23.7 37.724999999999994 19.625 18.95 6 17.675 38.324999999999996 24.45 19.55 7 17.675 16.625 43.95 21.75 8 21.025 20.549999999999997 27.925 30.5 9 22.425 22.625 28.975 25.974999999999998 10-14 23.169999999999998 28.49 26.450000000000003 21.89 15-19 23.115 27.85 27.525 21.51 20-24 23.380000000000003 28.26 27.315 21.044999999999998 25-29 23.74 28.1 27.12 21.04 30-34 23.16 27.810000000000002 27.505000000000003 21.525 35-39 23.06 27.67 27.860000000000003 21.41 40-44 23.185 27.744999999999997 28.21 20.86 45-49 23.215 27.615000000000002 27.565 21.605 50-54 23.72 27.805000000000003 27.63 20.845 55-59 23.935000000000002 27.445000000000004 27.465 21.154999999999998 60-64 22.994999999999997 26.68 28.73 21.595 65-69 23.215 27.115000000000002 28.215 21.455 70-74 23.365 27.075 28.405 21.154999999999998 75-79 23.905 27.365000000000002 27.88 20.849999999999998 80-84 23.105 27.860000000000003 27.700000000000003 21.335 85-89 23.78 27.565 28.285 20.369999999999997 90-94 23.385 27.43 28.49 20.695 95-99 23.915 27.42 28.225 20.44 100-104 23.22 27.800000000000004 28.810000000000002 20.169999999999998 105-109 23.53 27.96 27.985 20.525 110-114 23.385 27.625 28.720000000000002 20.27 115-119 23.76 27.779999999999998 28.175 20.285 120-124 23.9 28.015 28.04 20.044999999999998 125-129 23.369999999999997 27.455000000000002 28.9 20.275000000000002 130-134 24.185000000000002 27.975 27.685 20.155 135-139 25.05 27.18 27.965 19.805 140-144 24.625 28.15 27.715 19.509999999999998 145-149 25.55 27.834999999999997 26.96 19.655 150 25.775 26.75 27.675 19.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 0.5 8 0.5 9 2.5 10 3.0 11 1.5 12 1.0 13 2.0 14 1.5 15 1.0 16 2.5 17 2.5 18 2.0 19 2.5 20 3.0 21 3.0 22 3.0 23 3.0 24 5.5 25 7.5 26 4.5 27 5.0 28 7.5 29 11.5 30 17.5 31 23.0 32 22.0 33 30.5 34 42.5 35 52.0 36 72.5 37 94.5 38 112.0 39 141.0 40 166.0 41 190.5 42 227.0 43 240.0 44 254.0 45 267.5 46 265.0 47 260.5 48 240.5 49 218.5 50 186.0 51 147.0 52 127.0 53 111.5 54 90.5 55 65.5 56 50.0 57 45.5 58 43.0 59 33.0 60 21.5 61 15.0 62 12.5 63 10.5 64 7.0 65 5.0 66 3.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.2874999999999996 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.8625 0.0 0.0 0.0 0.0 138 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105468 spots for SRR3727132.sra Written 1105468 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra Read 1105456 spots for SRR3727132.sra Written 1105456 spots for SRR3727132.sra SRR ids: ['SRR3727132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fl1_igw0 SRR3727132.sra spots: 22109132 blocks: [[1, 1105456], [1105457, 2210912], [2210913, 3316368], [3316369, 4421824], [4421825, 5527280], [5527281, 6632736], [6632737, 7738192], [7738193, 8843648], [8843649, 9949104], [9949105, 11054560], [11054561, 12160016], [12160017, 13265472], [13265473, 14370928], [14370929, 15476384], [15476385, 16581840], [16581841, 17687296], [17687297, 18792752], [18792753, 19898208], [19898209, 21003664], [21003665, 22109132]] SRR3727132 file size 7427177 SRR3727132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727132 SRR3727132_1.fastq SRR3727132_2.fastq Input file: SRR3727132_1.fastq Paired file: SRR3727132_2.fastq trimmed: SRR3727132-trimmed-pair1.fastq, SRR3727132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:36:59 2025 >> started Fri Feb 14 11:37:22 2025 >> done (23.643s) 22109132 read pairs processed; of these: 122848 ( 0.56%) short read pairs filtered out after trimming by size control 801709 ( 3.63%) empty read pairs filtered out after trimming by size control 21184575 (95.82%) read pairs available; of these: 6190721 (29.22%) trimmed read pairs available after processing 14993854 (70.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 7 0.00% 21 16 0.00% 22 19 0.00% 23 24 0.00% 24 29 0.00% 25 53 0.00% 26 53 0.00% 27 43 0.00% 28 67 0.00% 29 81 0.00% 30 98 0.00% 31 100 0.00% 32 132 0.00% 33 138 0.00% 34 164 0.00% 35 184 0.00% 36 209 0.00% 37 224 0.00% 38 300 0.00% 39 299 0.00% 40 326 0.00% 41 355 0.00% 42 363 0.00% 43 440 0.00% 44 449 0.00% 45 495 0.00% 46 514 0.00% 47 583 0.00% 48 593 0.00% 49 648 0.00% 50 648 0.00% 51 691 0.00% 52 748 0.00% 53 811 0.00% 54 867 0.00% 55 881 0.00% 56 995 0.00% 57 995 0.00% 58 1111 0.01% 59 1185 0.01% 60 1187 0.01% 61 1236 0.01% 62 1351 0.01% 63 1482 0.01% 64 1611 0.01% 65 1637 0.01% 66 2008 0.01% 67 2094 0.01% 68 2020 0.01% 69 2202 0.01% 70 2395 0.01% 71 2601 0.01% 72 2785 0.01% 73 3118 0.01% 74 3453 0.02% 75 3798 0.02% 76 4086 0.02% 77 4537 0.02% 78 4868 0.02% 79 5340 0.03% 80 5456 0.03% 81 5754 0.03% 82 5791 0.03% 83 5912 0.03% 84 12610 0.06% 85 12434 0.06% 86 13334 0.06% 87 13944 0.07% 88 13528 0.06% 89 13224 0.06% 90 13160 0.06% 91 14131 0.07% 92 15670 0.07% 93 15934 0.08% 94 16052 0.08% 95 16521 0.08% 96 16967 0.08% 97 17918 0.08% 98 22561 0.11% 99 23957 0.11% 100 18928 0.09% 101 17738 0.08% 102 26208 0.12% 103 27076 0.13% 104 29227 0.14% 105 35462 0.17% 106 31057 0.15% 107 24532 0.12% 108 26946 0.13% 109 26330 0.12% 110 34773 0.16% 111 29274 0.14% 112 27257 0.13% 113 34267 0.16% 114 40931 0.19% 115 55997 0.26% 116 37161 0.18% 117 23424 0.11% 118 21151 0.10% 119 29815 0.14% 120 28637 0.14% 121 53539 0.25% 122 62360 0.29% 123 52074 0.25% 124 30163 0.14% 125 29453 0.14% 126 50844 0.24% 127 48474 0.23% 128 50745 0.24% 129 58969 0.28% 130 81750 0.39% 131 78559 0.37% 132 64365 0.30% 133 89915 0.42% 134 100409 0.47% 135 100905 0.48% 136 107426 0.51% 137 113688 0.54% 138 119702 0.57% 139 129752 0.61% 140 136721 0.65% 141 146490 0.69% 142 161384 0.76% 143 176341 0.83% 144 214663 1.01% 145 239126 1.13% 146 298378 1.41% 147 400753 1.89% 148 594906 2.81% 149 1428065 6.74% 150 14993854 70.78% 21184575 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.06 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=3.4 sequence=TTCCATCATCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=37.88 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=11.6 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.40 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=2.9 sequence=GCATTCGCTGAGTTGAAGGTGAAGGAACTCAAGAATGGTAGGTTGGCTAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=32.81 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.5 sequence=TGATGATGGAACAAAGGCTAAAGCTGTAGCAGTGTGCCACACAGATACGTCAGCATGGAACCCAAAGCATTTGGCTTTCCAGGTGCTCAACGTTAAGCCAGGAACCGTACCAGTCTGCCATTTCCTTCCTCAGGATCATGTTGTGTGGTTTTCCAACTAGAAGTTTGCAATCTGCAGTCCTGTCATTTCCTTCTCATCTGTCAACAGTAGTTGAAACTGGAATGTTTTTAAGTTATGATCCATTTGTTTTTATAATAATAGTGTACCTAAAAACGCACTATGTGTTAAATGTAATTTGTACGATTCAATGTCTT SRR3727132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:38:15 Started mapping on | Feb 14 11:38:16 Finished on | Feb 14 11:40:21 Mapping speed, Million of reads per hour | 610.12 Number of input reads | 21184575 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 20073880 Uniquely mapped reads % | 94.76% Average mapped length | 291.73 Number of splices: Total | 17750825 Number of splices: Annotated (sjdb) | 17442135 Number of splices: GT/AG | 17414215 Number of splices: GC/AG | 283193 Number of splices: AT/AC | 13250 Number of splices: Non-canonical | 40167 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 622177 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 58538 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518932 518932 518932 N_multimapping 622177 622177 622177 N_noFeature 540076 19811618 657580 N_ambiguous 254478 1077 109030 UnstrandedReadsAssigned:19279326 PositiveStrandReadsAssigned:261185 NegativeStrandReadsAssigned:19307270 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727132-trimmed-pair1.fastq SRR3727132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,184,575 reads, 19,692,279 reads pseudoaligned [quant] estimated average fragment length: 231.522 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR3727132.ke.tsv 34699 SRR3727132.se.tsv 87100 total ==> SRR3727132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.48 408 10.7583 Potri.005G024800.1.v4.1 1035 804.478 97 5.68305 Potri.004G059700.1.v4.1 961 730.494 35 2.25827 Potri.007G009000.2.v4.1 1416 1185.48 7 0.27831 Potri.003G141000.2.v4.1 2943 2712.48 454.136 7.89122 Potri.016G087400.1.v4.1 270 80.2346 1230 722.55 Potri.015G069301.1.v4.1 564 336.411 0 0 Potri.010G195200.1.v4.1 1773 1542.48 8 0.244453 Potri.012G127500.1.v4.1 977 746.486 1758 111 ==> SRR3727132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 449 Potri.001G212900.v4.1 46 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 393 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR3727132 completed mapping pipeline successfully