Starting /dee2/code/volunteer_pipeline.sh SRR3727133 current disk space = 2809841754112 free memory = 1575186268 SRR3727133 SRAfilesize 8152859bc1921253669affbbeb62aa30 SRR3727133.sra SRR3727133.sra file validated SRR3727133 is paired end SRR3727133 is conventional basespace SRR3727133 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.40075 34.0 31.0 34.0 30.0 34.0 2 32.265 34.0 31.0 34.0 31.0 34.0 3 32.77925 34.0 31.0 34.0 31.0 34.0 4 36.38725 37.0 37.0 37.0 35.0 37.0 5 36.3215 37.0 37.0 37.0 35.0 37.0 6 36.35625 37.0 37.0 37.0 35.0 37.0 7 36.2335 37.0 37.0 37.0 35.0 37.0 8 36.30475 37.0 37.0 37.0 35.0 37.0 9 38.09425 39.0 38.0 39.0 35.0 39.0 10-14 38.423950000000005 39.4 39.0 39.4 36.2 39.4 15-19 39.522000000000006 41.0 39.4 41.0 36.8 41.0 20-24 39.549299999999995 41.0 39.2 41.0 37.0 41.0 25-29 39.359750000000005 40.4 39.0 41.0 36.2 41.0 30-34 38.9477 40.0 38.6 41.0 35.6 41.0 35-39 38.75055 40.0 38.0 41.0 35.0 41.0 40-44 38.361450000000005 40.0 38.0 41.0 33.8 41.0 45-49 38.2495 40.0 38.0 41.0 33.6 41.0 50-54 38.0798 40.0 37.6 41.0 33.4 41.0 55-59 37.831649999999996 39.8 37.0 41.0 33.4 41.0 60-64 37.6819 39.4 36.6 41.0 33.0 41.0 65-69 36.7936 38.4 35.2 40.2 32.0 41.0 70-74 35.9482 36.8 35.0 39.2 31.4 40.8 75-79 34.363749999999996 35.2 33.4 37.2 29.8 39.2 80-84 34.04415 35.0 34.0 36.2 30.0 37.6 85-89 33.3223 35.0 34.0 35.2 29.8 36.4 90-94 32.9572 35.0 33.4 35.0 29.0 35.8 95-99 32.54355 35.0 33.0 35.0 28.2 35.0 100-104 32.22365 35.0 32.8 35.0 27.2 35.0 105-109 32.13465 34.4 32.4 35.0 27.0 35.0 110-114 31.9132 34.0 32.0 35.0 25.4 35.0 115-119 31.5529 34.0 31.8 35.0 25.0 35.0 120-124 31.04495 34.0 31.0 35.0 23.8 35.0 125-129 30.667 34.0 31.0 35.0 23.2 35.0 130-134 30.143099999999997 34.0 29.8 35.0 19.0 35.0 135-139 29.46275 34.0 29.2 35.0 16.6 35.0 140-144 28.7014 33.2 29.0 35.0 5.0 35.0 145-149 27.21195 33.0 26.2 34.8 2.0 35.0 150 22.3185 29.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 5.0 9 5.0 10 3.0 11 5.0 12 3.0 13 3.0 14 2.0 15 8.0 16 11.0 17 8.0 18 4.0 19 8.0 20 8.0 21 11.0 22 20.0 23 22.0 24 28.0 25 36.0 26 36.0 27 50.0 28 58.0 29 70.0 30 97.0 31 119.0 32 154.0 33 232.0 34 321.0 35 613.0 36 1190.0 37 863.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.33656110965716 17.456163308034544 12.535985344150745 35.671290238157546 2 18.75 25.95 38.9 16.400000000000002 3 17.625 31.0 26.575 24.8 4 21.5 37.775 20.525 20.200000000000003 5 20.275000000000002 37.85 22.675 19.2 6 15.75 35.575 26.5 22.175 7 12.5 19.6 45.800000000000004 22.1 8 17.525 20.45 29.7 32.324999999999996 9 18.125 22.45 28.95 30.475 10-14 19.36 30.615 26.025 24.0 15-19 19.575 28.82 27.275 24.33 20-24 19.495 28.744999999999997 27.805000000000003 23.955000000000002 25-29 19.965 28.7 27.73 23.605 30-34 19.99 28.754999999999995 26.91 24.345 35-39 19.945 29.349999999999998 26.945000000000004 23.76 40-44 20.035 28.355000000000004 27.83 23.78 45-49 20.064999999999998 28.355000000000004 27.705000000000002 23.875 50-54 19.59 28.68 27.810000000000002 23.919999999999998 55-59 20.54 28.315 27.565 23.580000000000002 60-64 20.080000000000002 28.895 27.389999999999997 23.635 65-69 20.07 28.325 27.445000000000004 24.16 70-74 20.169999999999998 29.154999999999998 26.855 23.82 75-79 20.419999999999998 28.310000000000002 27.525 23.745 80-84 20.21 28.095 27.26 24.435000000000002 85-89 20.715 27.925 27.525 23.835 90-94 20.7 28.735 27.339999999999996 23.225 95-99 21.044999999999998 28.065 27.295 23.595 100-104 19.900000000000002 28.494999999999997 27.644999999999996 23.96 105-109 20.195 28.285 27.83 23.69 110-114 20.93 27.71 27.884999999999998 23.474999999999998 115-119 21.035 28.194999999999997 27.095000000000002 23.674999999999997 120-124 21.035 28.084999999999997 27.169999999999998 23.71 125-129 21.065 28.244999999999997 27.325 23.365 130-134 21.01 28.27 27.47 23.25 135-139 21.37 28.15 26.834999999999997 23.645 140-144 21.245 27.63 27.49 23.635 145-149 21.315 28.625 26.825 23.235 150 15.174999999999999 32.550000000000004 28.375 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 3.5 25 6.0 26 5.5 27 10.0 28 10.5 29 15.0 30 24.5 31 30.5 32 33.0 33 45.0 34 66.0 35 78.5 36 96.5 37 117.0 38 146.0 39 172.0 40 191.0 41 213.0 42 236.5 43 243.0 44 250.0 45 255.0 46 236.5 47 232.5 48 226.5 49 206.5 50 174.5 51 139.5 52 115.0 53 90.5 54 76.5 55 59.5 56 42.5 57 40.0 58 30.0 59 19.5 60 17.5 61 14.5 62 9.5 63 5.0 64 2.5 65 5.0 66 3.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.9125 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138 3.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGATGC 10 0.0069754543 143.9875 3 >>END_MODULE SRR3727133 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52 33.0 31.0 34.0 30.0 34.0 2 31.58675 34.0 31.0 34.0 30.0 34.0 3 31.78025 34.0 31.0 34.0 30.0 34.0 4 35.35875 37.0 35.0 37.0 33.0 37.0 5 35.3805 37.0 35.0 37.0 35.0 37.0 6 35.41625 37.0 36.0 37.0 35.0 37.0 7 35.24425 37.0 36.0 37.0 33.0 37.0 8 35.3655 37.0 36.0 37.0 35.0 37.0 9 37.09525 39.0 38.0 39.0 35.0 39.0 10-14 37.41065 39.4 38.2 39.4 35.2 39.4 15-19 38.5169 41.0 39.0 41.0 35.4 41.0 20-24 38.411950000000004 41.0 39.0 41.0 34.8 41.0 25-29 38.36455 40.2 39.0 41.0 34.8 41.0 30-34 37.98780000000001 40.0 38.0 41.0 33.6 41.0 35-39 37.902249999999995 40.0 38.0 41.0 33.6 41.0 40-44 37.66609999999999 40.0 38.0 41.0 33.0 41.0 45-49 37.4838 40.0 38.0 41.0 32.8 41.0 50-54 36.713 39.2 36.8 40.2 31.6 40.6 55-59 36.99485 39.8 36.8 41.0 31.8 41.0 60-64 36.36045 38.8 35.4 40.4 31.0 41.0 65-69 35.5238 37.4 35.0 39.6 30.2 41.0 70-74 34.96935 36.6 35.0 38.8 30.6 40.6 75-79 33.9476 35.2 34.4 37.0 30.0 39.0 80-84 33.204299999999996 35.0 34.0 36.0 29.4 37.0 85-89 32.68745 35.0 34.0 35.0 29.0 36.2 90-94 32.3046 35.0 33.4 35.0 28.6 35.4 95-99 32.14815 35.0 33.2 35.0 27.0 35.0 100-104 31.893399999999996 35.0 33.0 35.0 26.2 35.0 105-109 31.76775 35.0 33.0 35.0 25.8 35.0 110-114 31.5271 35.0 33.0 35.0 25.0 35.0 115-119 31.191450000000003 34.2 32.0 35.0 24.6 35.0 120-124 31.0043 34.0 31.8 35.0 23.8 35.0 125-129 30.6853 34.0 31.4 35.0 21.8 35.0 130-134 30.238800000000005 34.0 31.0 35.0 18.6 35.0 135-139 29.926300000000005 34.0 30.4 35.0 17.6 35.0 140-144 29.28985 34.0 29.8 35.0 5.6 35.0 145-149 28.1641 33.8 29.0 35.0 2.0 35.0 150 24.4775 30.0 19.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 82.0 3 7.0 4 0.0 5 5.0 6 2.0 7 6.0 8 6.0 9 2.0 10 4.0 11 7.0 12 6.0 13 8.0 14 7.0 15 5.0 16 12.0 17 4.0 18 9.0 19 5.0 20 11.0 21 12.0 22 11.0 23 22.0 24 22.0 25 27.0 26 22.0 27 38.0 28 48.0 29 58.0 30 78.0 31 91.0 32 111.0 33 190.0 34 289.0 35 528.0 36 1278.0 37 975.0 38 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.15 14.85 14.025000000000002 34.975 2 21.5 24.025 37.225 17.25 3 20.525 26.625 30.175 22.675 4 24.275 36.075 20.7 18.95 5 22.775000000000002 36.475 22.3 18.45 6 17.775 36.7 24.675 20.849999999999998 7 17.474999999999998 14.475 45.074999999999996 22.975 8 21.175 21.725 25.074999999999996 32.025 9 21.4 23.799999999999997 28.65 26.150000000000002 10-14 22.725 28.115000000000002 27.02 22.14 15-19 22.945 28.044999999999998 27.700000000000003 21.310000000000002 20-24 22.445 28.244999999999997 27.325 21.985 25-29 22.705000000000002 28.455000000000002 27.034999999999997 21.805 30-34 22.735 28.610000000000003 27.325 21.33 35-39 22.535 28.51 27.505000000000003 21.45 40-44 23.115 27.775 27.944999999999997 21.165 45-49 22.6 28.62 27.51 21.27 50-54 23.115 27.650000000000002 28.055000000000003 21.18 55-59 23.555 27.405 27.72 21.32 60-64 23.115 27.58 28.1 21.205 65-69 23.45 27.845 27.525 21.18 70-74 23.575 28.04 27.49 20.895 75-79 23.29 28.24 27.705000000000002 20.765 80-84 23.645 27.42 27.735 21.2 85-89 23.810000000000002 27.779999999999998 27.295 21.115000000000002 90-94 23.72 27.525 27.79 20.965 95-99 22.98 27.775 27.825 21.42 100-104 22.96 27.825 28.265 20.95 105-109 23.265 27.02 28.615000000000002 21.099999999999998 110-114 23.369999999999997 27.955000000000002 27.655 21.02 115-119 23.51 27.68 28.144999999999996 20.665 120-124 23.455000000000002 27.32 28.055000000000003 21.17 125-129 23.715 27.900000000000002 27.839999999999996 20.544999999999998 130-134 23.935000000000002 27.845 27.195000000000004 21.025 135-139 24.11 28.435 27.77 19.685 140-144 24.27 28.1 26.895000000000003 20.735 145-149 24.335 27.58 27.375 20.71 150 24.7 28.799999999999997 25.275 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.5 14 1.0 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 1.5 21 2.5 22 2.0 23 2.0 24 2.5 25 4.0 26 6.0 27 6.0 28 9.0 29 12.5 30 18.5 31 22.0 32 24.5 33 37.5 34 50.5 35 61.0 36 77.5 37 106.5 38 125.5 39 145.0 40 186.0 41 213.0 42 225.0 43 239.0 44 261.0 45 266.5 46 251.5 47 248.5 48 229.0 49 205.5 50 183.5 51 154.0 52 133.0 53 107.0 54 87.0 55 67.5 56 48.5 57 41.0 58 29.0 59 21.5 60 21.0 61 14.5 62 8.5 63 5.5 64 8.0 65 7.0 66 3.0 67 3.5 68 3.0 69 1.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138 3.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCCA 10 0.006973645 144.0 4 AAAAAAC 10 0.006973645 144.0 1 >>END_MODULE Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332609 spots for SRR3727133.sra Written 1332609 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra Read 1332601 spots for SRR3727133.sra Written 1332601 spots for SRR3727133.sra SRR ids: ['SRR3727133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hic0p_lv SRR3727133.sra spots: 26652028 blocks: [[1, 1332601], [1332602, 2665202], [2665203, 3997803], [3997804, 5330404], [5330405, 6663005], [6663006, 7995606], [7995607, 9328207], [9328208, 10660808], [10660809, 11993409], [11993410, 13326010], [13326011, 14658611], [14658612, 15991212], [15991213, 17323813], [17323814, 18656414], [18656415, 19989015], [19989016, 21321616], [21321617, 22654217], [22654218, 23986818], [23986819, 25319419], [25319420, 26652028]] SRR3727133 file size 8957742 SRR3727133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727133 SRR3727133_1.fastq SRR3727133_2.fastq Input file: SRR3727133_1.fastq Paired file: SRR3727133_2.fastq trimmed: SRR3727133-trimmed-pair1.fastq, SRR3727133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Apr 15 11:46:31 2025 >> started Tue Apr 15 11:47:00 2025 >> done (29.338s) 26652028 read pairs processed; of these: 129012 ( 0.48%) short read pairs filtered out after trimming by size control 626434 ( 2.35%) empty read pairs filtered out after trimming by size control 25896582 (97.17%) read pairs available; of these: 7227480 (27.91%) trimmed read pairs available after processing 18669102 (72.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 11 0.00% 21 13 0.00% 22 18 0.00% 23 31 0.00% 24 42 0.00% 25 47 0.00% 26 64 0.00% 27 78 0.00% 28 94 0.00% 29 97 0.00% 30 117 0.00% 31 157 0.00% 32 188 0.00% 33 227 0.00% 34 264 0.00% 35 302 0.00% 36 355 0.00% 37 375 0.00% 38 437 0.00% 39 447 0.00% 40 488 0.00% 41 525 0.00% 42 586 0.00% 43 635 0.00% 44 711 0.00% 45 766 0.00% 46 842 0.00% 47 853 0.00% 48 897 0.00% 49 972 0.00% 50 1014 0.00% 51 1046 0.00% 52 1095 0.00% 53 1137 0.00% 54 1343 0.01% 55 1388 0.01% 56 1379 0.01% 57 1509 0.01% 58 1525 0.01% 59 1549 0.01% 60 1602 0.01% 61 1722 0.01% 62 1735 0.01% 63 1954 0.01% 64 1996 0.01% 65 2224 0.01% 66 2456 0.01% 67 2605 0.01% 68 2505 0.01% 69 2569 0.01% 70 2791 0.01% 71 3022 0.01% 72 3199 0.01% 73 3423 0.01% 74 3736 0.01% 75 3993 0.02% 76 4256 0.02% 77 4768 0.02% 78 5267 0.02% 79 5713 0.02% 80 6265 0.02% 81 6621 0.03% 82 7347 0.03% 83 7640 0.03% 84 14774 0.06% 85 15018 0.06% 86 15337 0.06% 87 16019 0.06% 88 16727 0.06% 89 17095 0.07% 90 17882 0.07% 91 18759 0.07% 92 19914 0.08% 93 20136 0.08% 94 21658 0.08% 95 22269 0.09% 96 22852 0.09% 97 23386 0.09% 98 23477 0.09% 99 24273 0.09% 100 24659 0.10% 101 24163 0.09% 102 26212 0.10% 103 26304 0.10% 104 29488 0.11% 105 33085 0.13% 106 32147 0.12% 107 32377 0.13% 108 33564 0.13% 109 34575 0.13% 110 36663 0.14% 111 36898 0.14% 112 41030 0.16% 113 41398 0.16% 114 40038 0.15% 115 49671 0.19% 116 41949 0.16% 117 38015 0.15% 118 32924 0.13% 119 33008 0.13% 120 34245 0.13% 121 41180 0.16% 122 43301 0.17% 123 51865 0.20% 124 54793 0.21% 125 49818 0.19% 126 52990 0.20% 127 52219 0.20% 128 59166 0.23% 129 62801 0.24% 130 62258 0.24% 131 70621 0.27% 132 80154 0.31% 133 89999 0.35% 134 96346 0.37% 135 101339 0.39% 136 108951 0.42% 137 115833 0.45% 138 122857 0.47% 139 130998 0.51% 140 141059 0.54% 141 156662 0.60% 142 174003 0.67% 143 198817 0.77% 144 250191 0.97% 145 279421 1.08% 146 360707 1.39% 147 498770 1.93% 148 754465 2.91% 149 1820868 7.03% 150 18669102 72.09% 25896582 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.62 fanout-score-rank=12 prefix-density=0.27 prefix-fanout=4.6 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=51.83 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.8 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=8.70 fanout-score-rank=13 prefix-density=0.36 prefix-fanout=4.6 sequence=CAATGGCAGCAGCAACAATGGCCCTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=61.38 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.1 sequence=AAGAGAGCAGCATACATCCATAGAGAGAAAGAGAAGACATGGCAACCAGAACTCCAAAGCTTGTGAAGCACACATTGTTGACTCGGTTCAAGGATGAGATCACACGAGAACAAATCGACAACTACATTAATGACTATACCAATCTGCTCGATCTCATTCCAACCATGAAGAGTTTCAATTGGGGCACGGATTTGGGCATGGAGTCTGCGGAGCTAAACCGAGGATACACTCATGCCTTTGAATCTACATTTGAGAGCAAGTCAGGTTTGCAAGAGTACCTCGATTCTGCTGCTCTTGCTGCATTTGCAGAAGGATTTTTGCCTACTTTGTCACAGCGTCTTGTGATAGACTACTTTCTCTACTAAATGCTCAGGAGTAACGACTTCGGCCGGGCTATTTCATGGGAATAAAGTAATGTAATGTGCAATAAATGCTGGTTTTG SRR3727133 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 15 11:47:48 Started mapping on | Apr 15 11:47:48 Finished on | Apr 15 11:50:56 Mapping speed, Million of reads per hour | 495.89 Number of input reads | 25896582 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 24296469 Uniquely mapped reads % | 93.82% Average mapped length | 292.43 Number of splices: Total | 22710514 Number of splices: Annotated (sjdb) | 22310053 Number of splices: GT/AG | 22302452 Number of splices: GC/AG | 347136 Number of splices: AT/AC | 17441 Number of splices: Non-canonical | 43485 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 732717 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 62884 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896918 896918 896918 N_multimapping 732717 732717 732717 N_noFeature 692842 24012253 833307 N_ambiguous 271958 1396 127310 UnstrandedReadsAssigned:23331669 PositiveStrandReadsAssigned:282820 NegativeStrandReadsAssigned:23335852 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727133-trimmed-pair1.fastq SRR3727133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,896,582 reads, 23,704,266 reads pseudoaligned [quant] estimated average fragment length: 252.199 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR3727133.ke.tsv 34699 SRR3727133.se.tsv 87100 total ==> SRR3727133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.8 600 13.0542 Potri.005G024800.1.v4.1 1035 783.801 84 4.11964 Potri.004G059700.1.v4.1 961 709.831 48 2.59939 Potri.007G009000.2.v4.1 1416 1164.8 3 0.0990045 Potri.003G141000.2.v4.1 2943 2691.8 577.268 8.24366 Potri.016G087400.1.v4.1 270 74.1988 1710 885.9 Potri.015G069301.1.v4.1 564 318.845 0 0 Potri.010G195200.1.v4.1 1773 1521.8 6 0.151558 Potri.012G127500.1.v4.1 977 725.811 3869 204.909 ==> SRR3727133.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 74 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 425 Potri.001G212900.v4.1 75 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 657 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR3727133 completed mapping pipeline successfully