Starting /dee2/code/volunteer_pipeline.sh SRR3727134 current disk space = 3114335539200 free memory = 1569316072 SRR3727134 SRAfilesize 5ad2297f36a351a9fb887ea432a35434 SRR3727134.sra SRR3727134.sra file validated SRR3727134 is paired end SRR3727134 is conventional basespace SRR3727134 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.222 34.0 31.0 34.0 30.0 34.0 2 32.167 34.0 31.0 34.0 30.0 34.0 3 32.7505 34.0 31.0 34.0 30.0 34.0 4 36.27275 37.0 37.0 37.0 35.0 37.0 5 36.218 37.0 37.0 37.0 35.0 37.0 6 36.37725 37.0 37.0 37.0 35.0 37.0 7 36.348 37.0 37.0 37.0 35.0 37.0 8 36.25425 37.0 37.0 37.0 35.0 37.0 9 38.05075 39.0 39.0 39.0 35.0 39.0 10-14 38.327149999999996 39.4 38.4 39.4 35.8 39.4 15-19 39.579600000000006 41.0 39.6 41.0 36.8 41.0 20-24 39.4722 41.0 39.2 41.0 36.8 41.0 25-29 39.16235 40.4 39.0 41.0 35.8 41.0 30-34 38.993700000000004 40.0 38.0 41.0 35.8 41.0 35-39 38.82715 40.0 38.0 41.0 35.2 41.0 40-44 38.6577 40.0 38.0 41.0 34.6 41.0 45-49 38.95185 40.0 38.4 41.0 35.0 41.0 50-54 38.5286 40.0 38.0 41.0 34.2 41.0 55-59 38.2065 40.0 37.4 41.0 34.0 41.0 60-64 37.7125 39.6 36.6 41.0 33.4 41.0 65-69 36.92255000000001 38.6 35.4 40.4 32.0 41.0 70-74 35.80345 36.8 34.8 39.2 31.0 40.8 75-79 34.4346 35.2 33.6 37.4 30.0 39.2 80-84 34.081399999999995 35.0 34.0 36.4 30.6 37.6 85-89 33.461200000000005 35.0 34.0 35.4 30.0 36.4 90-94 33.019549999999995 35.0 33.8 35.0 29.4 35.8 95-99 32.30965 35.0 33.0 35.0 27.6 35.0 100-104 31.9655 34.8 32.4 35.0 26.0 35.0 105-109 31.636149999999997 34.2 32.2 35.0 25.2 35.0 110-114 30.59285 34.0 30.4 35.0 20.2 35.0 115-119 30.7574 34.0 30.8 35.0 22.6 35.0 120-124 30.418650000000003 34.0 30.6 35.0 20.2 35.0 125-129 29.8813 34.0 29.6 35.0 18.2 35.0 130-134 29.557299999999998 34.0 29.8 35.0 14.6 35.0 135-139 27.6118 33.0 25.4 35.0 3.6 35.0 140-144 27.0901 33.0 25.0 35.0 2.0 35.0 145-149 24.883699999999997 31.6 16.0 34.0 2.0 35.0 150 19.039 25.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 5.0 10 4.0 11 4.0 12 6.0 13 7.0 14 7.0 15 4.0 16 13.0 17 9.0 18 8.0 19 13.0 20 20.0 21 21.0 22 23.0 23 26.0 24 32.0 25 40.0 26 33.0 27 51.0 28 57.0 29 85.0 30 112.0 31 139.0 32 167.0 33 241.0 34 366.0 35 597.0 36 1133.0 37 771.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.69616908850727 18.150594451783356 11.968295904887714 40.184940554821665 2 16.725 28.325 39.1 15.85 3 15.625 31.0 26.900000000000002 26.474999999999998 4 20.275000000000002 38.675 21.325 19.725 5 19.900000000000002 38.975 22.825 18.3 6 15.1 36.1 26.325 22.475 7 12.35 19.025 46.375 22.25 8 19.15 20.4 28.025 32.425 9 18.725 20.1 31.05 30.125 10-14 18.9 30.18 26.56 24.36 15-19 19.325 29.044999999999998 27.744999999999997 23.885 20-24 19.415 29.095 27.800000000000004 23.69 25-29 19.555 28.955 27.889999999999997 23.599999999999998 30-34 19.62 29.65 27.37 23.36 35-39 19.245 29.23 28.000000000000004 23.525 40-44 20.0 29.43 27.62 22.95 45-49 19.93 29.275000000000002 27.575 23.22 50-54 20.29 28.595 27.82 23.294999999999998 55-59 19.885 29.255 27.595 23.265 60-64 20.275000000000002 28.405 27.810000000000002 23.51 65-69 20.23 28.645 28.189999999999998 22.935 70-74 20.235 28.88 28.02 22.865 75-79 20.41 28.405 27.905 23.28 80-84 19.41 28.849999999999998 27.82 23.919999999999998 85-89 20.53 28.555000000000003 27.61 23.305 90-94 20.16 28.83 27.605 23.405 95-99 20.52 28.52 27.26 23.7 100-104 20.765 28.815 26.889999999999997 23.53 105-109 20.845 28.43 27.33 23.395 110-114 20.49 28.77 27.24 23.5 115-119 20.335 29.310000000000002 27.200000000000003 23.155 120-124 20.595 28.544999999999998 27.794999999999998 23.064999999999998 125-129 20.755000000000003 28.375 27.400000000000002 23.47 130-134 20.674999999999997 28.345 27.98 23.0 135-139 19.235 29.744999999999997 27.495000000000005 23.525 140-144 20.380000000000003 28.64 27.3 23.68 145-149 19.900000000000002 29.28 26.68 24.14 150 8.674999999999999 35.125 27.825 28.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 2.0 22 2.5 23 2.0 24 4.5 25 7.0 26 8.5 27 11.0 28 12.0 29 17.5 30 25.0 31 29.0 32 38.5 33 49.0 34 64.0 35 85.0 36 99.0 37 125.5 38 163.5 39 184.0 40 205.0 41 237.0 42 248.0 43 251.5 44 260.5 45 264.0 46 255.5 47 239.5 48 222.0 49 186.5 50 151.0 51 124.5 52 100.0 53 70.5 54 55.5 55 53.0 56 35.0 57 21.0 58 17.0 59 13.5 60 11.5 61 10.0 62 8.5 63 6.5 64 4.0 65 4.0 66 2.5 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138 2.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAT 10 0.00621615 149.57143 1 AGCCATG 10 0.0069790767 143.96251 6 CCATGCG 10 0.0069790767 143.96251 8 GCCATGC 10 0.0069790767 143.96251 7 AAAAAAA 105 0.0012699551 10.968572 55-59 >>END_MODULE SRR3727134 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81625 34.0 31.0 34.0 30.0 34.0 2 31.92625 34.0 31.0 34.0 30.0 34.0 3 31.885 34.0 31.0 34.0 30.0 34.0 4 35.27325 37.0 35.0 37.0 35.0 37.0 5 35.2965 37.0 35.0 37.0 35.0 37.0 6 35.1895 37.0 35.0 37.0 33.0 37.0 7 35.30875 37.0 36.0 37.0 35.0 37.0 8 35.3255 37.0 36.0 37.0 35.0 37.0 9 36.99025 39.0 38.0 39.0 35.0 39.0 10-14 37.296 39.4 38.2 39.4 34.8 39.4 15-19 38.32785 40.8 38.8 41.0 34.8 41.0 20-24 38.289049999999996 41.0 39.0 41.0 34.2 41.0 25-29 38.0069 40.2 38.4 41.0 33.6 41.0 30-34 37.62335 40.0 38.0 41.0 33.0 41.0 35-39 37.402649999999994 40.0 38.0 41.0 32.2 41.0 40-44 37.14955 40.0 37.6 41.0 32.0 41.0 45-49 36.66355 40.0 36.8 41.0 30.2 41.0 50-54 36.031699999999994 38.8 35.8 40.0 29.6 40.6 55-59 36.227599999999995 39.4 35.8 40.8 29.8 41.0 60-64 36.25445 39.0 35.8 41.0 30.6 41.0 65-69 35.7077 38.2 35.0 40.2 30.4 41.0 70-74 34.34395 36.4 34.2 39.2 27.8 40.6 75-79 33.38505 35.4 33.8 37.2 27.6 39.0 80-84 32.3204 35.0 32.8 35.8 25.6 37.2 85-89 32.04225 35.0 33.0 35.0 26.4 36.2 90-94 31.5959 35.0 33.0 35.0 25.0 35.6 95-99 30.9183 34.2 31.4 35.0 22.2 35.0 100-104 30.89145 34.0 32.0 35.0 22.4 35.0 105-109 30.58145 34.0 31.6 35.0 20.2 35.0 110-114 29.393899999999995 34.0 29.2 35.0 11.0 35.0 115-119 29.358050000000002 34.0 29.6 35.0 8.8 35.0 120-124 29.01975 33.8 29.4 35.0 8.2 35.0 125-129 28.1324 33.0 26.6 35.0 2.6 35.0 130-134 28.2848 33.4 28.6 35.0 2.0 35.0 135-139 27.049950000000003 32.4 25.0 34.4 2.0 35.0 140-144 26.034749999999995 31.8 22.6 34.0 2.0 35.0 145-149 24.668 31.2 15.4 34.0 2.0 35.0 150 21.64925 29.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 89.0 3 5.0 4 6.0 5 6.0 6 2.0 7 8.0 8 4.0 9 10.0 10 9.0 11 14.0 12 12.0 13 11.0 14 7.0 15 12.0 16 8.0 17 14.0 18 18.0 19 16.0 20 17.0 21 16.0 22 27.0 23 22.0 24 29.0 25 43.0 26 49.0 27 58.0 28 62.0 29 67.0 30 110.0 31 133.0 32 177.0 33 213.0 34 335.0 35 624.0 36 1067.0 37 697.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.875 13.075000000000001 14.299999999999999 36.75 2 22.55 22.7 38.675 16.075 3 20.05 26.55 29.5 23.9 4 23.05 36.25 21.099999999999998 19.6 5 23.25 36.825 22.35 17.575 6 18.125 37.525 24.05 20.3 7 15.525 14.6 47.699999999999996 22.175 8 20.925 20.150000000000002 28.425 30.5 9 22.6 22.1 29.375 25.924999999999997 10-14 22.045 28.29 27.425 22.24 15-19 22.415 27.650000000000002 28.485 21.45 20-24 21.92 28.455000000000002 28.410000000000004 21.215 25-29 22.575 27.915 28.860000000000003 20.65 30-34 23.18 27.625 28.475 20.72 35-39 22.725 27.950000000000003 28.26 21.065 40-44 22.689999999999998 27.97 28.185 21.154999999999998 45-49 23.175 27.815 27.98 21.029999999999998 50-54 23.13 27.175 28.860000000000003 20.835 55-59 23.115 27.615000000000002 28.335 20.935000000000002 60-64 23.22 27.935 27.82 21.025 65-69 23.09 28.194999999999997 28.225 20.49 70-74 23.455000000000002 27.284999999999997 28.475 20.785 75-79 23.31 27.79 28.37 20.53 80-84 23.315 28.175 27.73 20.78 85-89 22.994999999999997 28.42 27.750000000000004 20.835 90-94 23.145 28.01 28.275 20.57 95-99 23.555 27.96 27.97 20.515 100-104 23.105 28.215 28.175 20.505000000000003 105-109 23.01 27.735 28.23 21.025 110-114 23.16 27.675 28.46 20.705000000000002 115-119 23.385 28.015 27.825 20.775 120-124 23.07 28.285 27.97 20.674999999999997 125-129 23.814762952590517 28.375675135027006 27.350470094018803 20.459091818363675 130-134 23.07 28.435 27.994999999999997 20.5 135-139 23.75 28.15 27.994999999999997 20.105 140-144 24.165 28.53 27.41 19.895 145-149 24.474999999999998 28.22 27.27 20.035 150 25.8 28.349999999999998 26.200000000000003 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.0 20 0.5 21 1.0 22 2.0 23 3.5 24 5.0 25 4.0 26 3.0 27 3.5 28 10.5 29 19.0 30 21.5 31 21.0 32 23.0 33 37.0 34 49.0 35 56.5 36 77.5 37 107.5 38 137.0 39 163.5 40 185.5 41 228.0 42 252.5 43 263.5 44 300.0 45 302.5 46 270.5 47 256.5 48 227.5 49 190.5 50 167.0 51 132.0 52 108.0 53 87.5 54 63.0 55 48.0 56 36.5 57 29.5 58 25.0 59 15.5 60 11.5 61 10.5 62 7.0 63 5.0 64 4.0 65 4.0 66 4.0 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 2.5 75 2.0 76 0.0 77 0.5 78 1.0 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.48750000000000004 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATGA 10 0.0069863307 143.91249 7 >>END_MODULE Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266109 spots for SRR3727134.sra Written 1266109 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra Read 1266097 spots for SRR3727134.sra Written 1266097 spots for SRR3727134.sra SRR ids: ['SRR3727134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xp4nj_i7 SRR3727134.sra spots: 25321952 blocks: [[1, 1266097], [1266098, 2532194], [2532195, 3798291], [3798292, 5064388], [5064389, 6330485], [6330486, 7596582], [7596583, 8862679], [8862680, 10128776], [10128777, 11394873], [11394874, 12660970], [12660971, 13927067], [13927068, 15193164], [15193165, 16459261], [16459262, 17725358], [17725359, 18991455], [18991456, 20257552], [20257553, 21523649], [21523650, 22789746], [22789747, 24055843], [24055844, 25321952]] SRR3727134 file size 8509621 SRR3727134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727134 SRR3727134_1.fastq SRR3727134_2.fastq Input file: SRR3727134_1.fastq Paired file: SRR3727134_2.fastq trimmed: SRR3727134-trimmed-pair1.fastq, SRR3727134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:34:10 2025 >> started Fri Feb 14 11:34:38 2025 >> done (27.450s) 25321952 read pairs processed; of these: 121400 ( 0.48%) short read pairs filtered out after trimming by size control 491570 ( 1.94%) empty read pairs filtered out after trimming by size control 24708982 (97.58%) read pairs available; of these: 10824954 (43.81%) trimmed read pairs available after processing 13884028 (56.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 16 0.00% 21 22 0.00% 22 42 0.00% 23 52 0.00% 24 59 0.00% 25 75 0.00% 26 96 0.00% 27 111 0.00% 28 134 0.00% 29 149 0.00% 30 185 0.00% 31 219 0.00% 32 249 0.00% 33 300 0.00% 34 333 0.00% 35 384 0.00% 36 440 0.00% 37 482 0.00% 38 609 0.00% 39 628 0.00% 40 679 0.00% 41 721 0.00% 42 810 0.00% 43 892 0.00% 44 1006 0.00% 45 1052 0.00% 46 1179 0.00% 47 1157 0.00% 48 1290 0.01% 49 1357 0.01% 50 1374 0.01% 51 1514 0.01% 52 1625 0.01% 53 1634 0.01% 54 1744 0.01% 55 1803 0.01% 56 2001 0.01% 57 2088 0.01% 58 2177 0.01% 59 2248 0.01% 60 2303 0.01% 61 2401 0.01% 62 2614 0.01% 63 2690 0.01% 64 2880 0.01% 65 2995 0.01% 66 3294 0.01% 67 3284 0.01% 68 3559 0.01% 69 3756 0.02% 70 3847 0.02% 71 4160 0.02% 72 4503 0.02% 73 4688 0.02% 74 5029 0.02% 75 5321 0.02% 76 5570 0.02% 77 5898 0.02% 78 6281 0.03% 79 6732 0.03% 80 7169 0.03% 81 7698 0.03% 82 8669 0.04% 83 9846 0.04% 84 16526 0.07% 85 17090 0.07% 86 18668 0.08% 87 18533 0.08% 88 19184 0.08% 89 20002 0.08% 90 20486 0.08% 91 21102 0.09% 92 21981 0.09% 93 22344 0.09% 94 22814 0.09% 95 23824 0.10% 96 24979 0.10% 97 26495 0.11% 98 25879 0.10% 99 26663 0.11% 100 26259 0.11% 101 26418 0.11% 102 28280 0.11% 103 28675 0.12% 104 32026 0.13% 105 30727 0.12% 106 31601 0.13% 107 34654 0.14% 108 34895 0.14% 109 33364 0.14% 110 32470 0.13% 111 32506 0.13% 112 34450 0.14% 113 37508 0.15% 114 47363 0.19% 115 64293 0.26% 116 39001 0.16% 117 40563 0.16% 118 38837 0.16% 119 42911 0.17% 120 53973 0.22% 121 49777 0.20% 122 42134 0.17% 123 42004 0.17% 124 45720 0.19% 125 51004 0.21% 126 53486 0.22% 127 58080 0.24% 128 65525 0.27% 129 69648 0.28% 130 75062 0.30% 131 94007 0.38% 132 106139 0.43% 133 105007 0.42% 134 117698 0.48% 135 123106 0.50% 136 141652 0.57% 137 153111 0.62% 138 167622 0.68% 139 180113 0.73% 140 189317 0.77% 141 211738 0.86% 142 236920 0.96% 143 270858 1.10% 144 324650 1.31% 145 396080 1.60% 146 516207 2.09% 147 721963 2.92% 148 1108822 4.49% 149 3842029 15.55% 150 13884028 56.19% 24708982 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.38 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=33.15 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.5 sequence=TCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTGTTGCATTAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACCCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTGTCTTAACTTCAAATCCTTGAGCGCTTTAGTGGCAGCATTATACCAGGATGTGGTGATGGGAAGCCAGAAAACTTTCTTGGGTGCTTCATTTGGAGAGAACATGTTAATTGTCTCATACTCTACAGTCCCCAACAGGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=20 prefix-density=0.57 prefix-fanout=2.9 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=72.62 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=13.0 sequence=AGAGAGAAAGAGAAGACATGGCAACCAGAACTCCAAAGCTTGTGAAGCACACATTGTTGACTCGGTTCAAGGATGAGATCACACGAGAACAAATCGACAACTACATTAATGACTATACCAATCTGCTCGATCTCATTCCAACCATGAAGAGTTTCAATTGGGGCACGGATTTGGGCATGGAGTCTGCGGAGCTAAACCGAGGATACACTCATGCCTTTGAATCTACATTTGAGAGCAAGTCAGGTTTGCAAGAGTACCTCGATTCTGCTGCTCTTGCTGCATTTGCAGAAGGATTTTTGCCTACTTTGTCACAGCGTCTTGTGATAGACTACTTTCTCTACTAAATGCTCAGGAGTAACGACTTCGGCCGGGCTATTTCATGGGAATAAAGTAATGTAATGTGCAATAAATGCTGGTTTTG SRR3727134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:35:57 Started mapping on | Feb 14 11:35:58 Finished on | Feb 14 11:38:18 Mapping speed, Million of reads per hour | 635.37 Number of input reads | 24708982 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 23640659 Uniquely mapped reads % | 95.68% Average mapped length | 290.64 Number of splices: Total | 20343658 Number of splices: Annotated (sjdb) | 19944647 Number of splices: GT/AG | 20029744 Number of splices: GC/AG | 255419 Number of splices: AT/AC | 16908 Number of splices: Non-canonical | 41587 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 628317 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 44169 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 467934 467934 467934 N_multimapping 628317 628317 628317 N_noFeature 852269 23366938 990752 N_ambiguous 278055 1764 141735 UnstrandedReadsAssigned:22510335 PositiveStrandReadsAssigned:271957 NegativeStrandReadsAssigned:22508172 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR3727134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727134-trimmed-pair1.fastq SRR3727134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,708,982 reads, 22,649,627 reads pseudoaligned [quant] estimated average fragment length: 253.062 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR3727134.ke.tsv 34699 SRR3727134.se.tsv 87100 total ==> SRR3727134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.94 2157 46.4879 Potri.005G024800.1.v4.1 1035 782.938 866 42.0974 Potri.004G059700.1.v4.1 961 709.005 20 1.07361 Potri.007G009000.2.v4.1 1416 1163.94 0 0 Potri.003G141000.2.v4.1 2943 2690.94 658.322 9.31107 Potri.016G087400.1.v4.1 270 72.1792 1196 630.643 Potri.015G069301.1.v4.1 564 317.157 0 0 Potri.010G195200.1.v4.1 1773 1520.94 340 8.50809 Potri.012G127500.1.v4.1 977 724.986 22055 1157.82 ==> SRR3727134.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 431 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 666 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 244 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 271 SRR3727134 completed mapping pipeline successfully