Starting /dee2/code/volunteer_pipeline.sh SRR3727135 current disk space = 3113214447616 free memory = 1568493872 SRR3727135 SRAfilesize 7899b255ff33146c15c88186f0f02be4 SRR3727135.sra SRR3727135.sra file validated SRR3727135 is paired end SRR3727135 is conventional basespace SRR3727135 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1405 34.0 31.0 34.0 30.0 34.0 2 32.09 34.0 31.0 34.0 30.0 34.0 3 32.72975 34.0 31.0 34.0 30.0 34.0 4 36.2425 37.0 37.0 37.0 35.0 37.0 5 36.295 37.0 37.0 37.0 35.0 37.0 6 36.3585 37.0 37.0 37.0 35.0 37.0 7 36.25 37.0 37.0 37.0 35.0 37.0 8 36.29525 37.0 37.0 37.0 35.0 37.0 9 38.114 39.0 39.0 39.0 35.0 39.0 10-14 38.336 39.4 38.6 39.4 35.8 39.4 15-19 39.36245 40.8 39.2 41.0 36.2 41.0 20-24 39.2167 40.8 39.0 41.0 35.8 41.0 25-29 39.019 40.0 38.8 41.0 35.8 41.0 30-34 38.81325 40.0 38.2 41.0 34.8 41.0 35-39 38.61595 40.0 38.0 41.0 34.6 41.0 40-44 38.52185 40.0 38.0 41.0 34.2 41.0 45-49 38.4378 40.0 38.0 41.0 33.8 41.0 50-54 38.3743 40.0 38.0 41.0 34.0 41.0 55-59 38.06725 40.0 37.0 41.0 33.8 41.0 60-64 37.504000000000005 39.4 36.2 41.0 32.8 41.0 65-69 36.9193 38.6 35.2 40.4 32.2 41.0 70-74 35.768049999999995 36.6 35.0 39.2 31.2 40.6 75-79 34.582800000000006 35.2 34.0 37.4 30.4 39.2 80-84 33.99425 35.0 34.0 36.4 30.0 37.6 85-89 33.346599999999995 35.0 34.0 35.4 29.6 36.4 90-94 32.8285 35.0 33.4 35.0 29.0 35.6 95-99 32.721050000000005 35.0 33.0 35.0 29.0 35.0 100-104 32.457550000000005 35.0 33.0 35.0 28.6 35.0 105-109 32.1223 34.4 32.4 35.0 27.2 35.0 110-114 31.827499999999997 34.0 32.0 35.0 26.2 35.0 115-119 30.839299999999998 34.0 31.2 35.0 22.4 35.0 120-124 29.96085 34.0 29.8 35.0 18.2 35.0 125-129 29.299299999999995 34.0 29.2 35.0 12.6 35.0 130-134 28.2549 33.6 27.0 35.0 5.0 35.0 135-139 26.7856 32.6 24.8 34.8 2.0 35.0 140-144 24.34625 31.0 15.4 34.0 2.0 35.0 145-149 21.08295 29.0 2.0 34.0 2.0 35.0 150 15.05475 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 3.0 9 2.0 10 4.0 11 8.0 12 8.0 13 9.0 14 6.0 15 10.0 16 8.0 17 6.0 18 6.0 19 11.0 20 11.0 21 15.0 22 25.0 23 32.0 24 31.0 25 41.0 26 40.0 27 68.0 28 80.0 29 91.0 30 139.0 31 150.0 32 218.0 33 279.0 34 429.0 35 648.0 36 1045.0 37 575.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.70142180094787 19.79989468141127 10.215903106898368 37.2827804107425 2 17.549999999999997 25.6 39.825 17.025000000000002 3 15.55 30.375000000000004 27.85 26.224999999999998 4 19.75 38.675 22.3 19.275000000000002 5 20.65 36.85 23.05 19.45 6 16.75 34.75 24.825 23.674999999999997 7 12.725 19.2 47.099999999999994 20.974999999999998 8 18.525 18.875 28.425 34.175 9 18.224999999999998 21.05 29.25 31.474999999999998 10-14 19.950000000000003 29.975 25.790000000000003 24.285 15-19 20.165 27.665 27.805000000000003 24.365000000000002 20-24 20.18 28.435 26.935 24.45 25-29 20.349999999999998 28.615000000000002 27.245 23.79 30-34 19.925 29.075 27.16 23.84 35-39 20.47 28.515 27.3 23.715 40-44 20.955 27.58 27.935 23.53 45-49 20.424999999999997 28.52 26.945000000000004 24.11 50-54 20.369999999999997 28.49 26.950000000000003 24.19 55-59 20.305 27.800000000000004 27.85 24.044999999999998 60-64 20.044999999999998 28.205000000000002 27.21 24.54 65-69 20.57 27.85 27.474999999999998 24.104999999999997 70-74 20.715 28.53 27.445000000000004 23.31 75-79 20.349999999999998 28.4 26.845000000000002 24.404999999999998 80-84 20.885 27.865000000000002 27.47 23.78 85-89 20.46 28.825 27.250000000000004 23.465 90-94 20.72 28.265 27.12 23.895 95-99 20.48 28.16 27.445000000000004 23.915 100-104 20.77 28.67 26.884999999999998 23.674999999999997 105-109 20.5 28.37 27.005000000000003 24.125 110-114 20.63103155157758 28.001400070003502 26.896344817240863 24.47122356117806 115-119 20.621031051552578 28.506425321266065 27.02135106755338 23.851192559627982 120-124 20.165 28.189999999999998 26.924999999999997 24.72 125-129 19.855 28.485 27.855 23.805 130-134 19.45 28.075 27.495000000000005 24.98 135-139 19.41 28.09 27.49 25.009999999999998 140-144 19.355 28.33 27.32 24.995 145-149 17.555 29.020000000000003 27.48 25.945 150 6.8500000000000005 34.075 28.525 30.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 3.0 27 4.5 28 7.0 29 12.0 30 24.0 31 31.5 32 32.5 33 36.0 34 50.5 35 66.0 36 86.5 37 114.0 38 144.5 39 169.0 40 196.0 41 223.5 42 250.5 43 277.0 44 260.0 45 259.5 46 272.0 47 249.0 48 222.5 49 190.0 50 159.5 51 122.5 52 97.0 53 85.5 54 56.5 55 37.0 56 33.0 57 31.0 58 25.5 59 19.0 60 18.5 61 16.0 62 11.0 63 14.5 64 15.0 65 13.5 66 14.0 67 9.0 68 7.0 69 8.0 70 6.0 71 4.5 72 3.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 1.0 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.050000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.037500000000000006 0.025 0.0 0.0 0.0 84-85 0.05 0.025 0.0 0.0 0.0 86-87 0.05 0.025 0.0 0.0 0.0 88-89 0.0875 0.025 0.0 0.0 0.0 90-91 0.1125 0.025 0.0 0.0 0.0 92-93 0.125 0.025 0.0 0.0 0.0 94-95 0.15 0.025 0.0 0.0 0.0 96-97 0.2375 0.025 0.0 0.0 0.0 98-99 0.2625 0.025 0.0 0.0 0.0 100-101 0.35 0.025 0.0 0.0 0.0 102-103 0.3875 0.025 0.0 0.0 0.0 104-105 0.475 0.025 0.0 0.0 0.0 106-107 0.5874999999999999 0.025 0.0 0.0 0.0 108-109 0.725 0.025 0.0 0.0 0.0 110-111 0.8875 0.025 0.0 0.0 0.0 112-113 1.025 0.025 0.0 0.0 0.0 114-115 1.1124999999999998 0.025 0.0 0.0 0.0 116-117 1.225 0.025 0.0 0.0 0.0 118-119 1.2875 0.025 0.0 0.0 0.0 120-121 1.375 0.025 0.0 0.0 0.0 122-123 1.525 0.025 0.0 0.0 0.0 124-125 1.775 0.025 0.0 0.0 0.0 126-127 2.0875 0.025 0.0 0.0 0.0 128-129 2.2375 0.025 0.0 0.0 0.0 130-131 2.4125 0.025 0.0 0.0 0.0 132-133 2.675 0.025 0.0 0.0 0.0 134-135 3.05 0.025 0.0 0.0 0.0 136-137 3.375 0.025 0.0 0.0 0.0 138 3.5 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCAAG 10 0.0069790767 143.96251 6 >>END_MODULE SRR3727135 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5175 34.0 31.0 34.0 30.0 34.0 2 31.68675 34.0 31.0 34.0 30.0 34.0 3 31.64075 34.0 31.0 34.0 30.0 34.0 4 34.8305 37.0 35.0 37.0 32.0 37.0 5 35.06425 37.0 35.0 37.0 33.0 37.0 6 34.85 37.0 35.0 37.0 32.0 37.0 7 34.988 37.0 35.0 37.0 33.0 37.0 8 35.0535 37.0 35.0 37.0 33.0 37.0 9 36.7905 39.0 38.0 39.0 34.0 39.0 10-14 36.89755 39.4 37.8 39.4 33.6 39.4 15-19 37.7213 40.6 38.2 41.0 32.8 41.0 20-24 37.652150000000006 40.0 38.0 41.0 33.2 41.0 25-29 37.7493 40.0 38.0 41.0 33.6 41.0 30-34 37.22644999999999 40.0 37.8 41.0 31.4 41.0 35-39 37.2038 40.0 38.0 41.0 32.0 41.0 40-44 36.65845 40.0 37.0 41.0 30.6 41.0 45-49 36.34205 39.6 36.6 41.0 29.8 41.0 50-54 35.79705 39.0 35.6 40.0 29.0 40.6 55-59 35.6515 39.0 35.0 40.2 27.8 41.0 60-64 35.684250000000006 38.8 34.8 40.8 28.6 41.0 65-69 34.9948 37.4 34.8 40.0 28.2 41.0 70-74 34.048649999999995 36.2 33.8 38.8 27.8 40.6 75-79 33.036199999999994 35.0 33.8 37.0 26.2 39.0 80-84 32.003099999999996 35.0 32.8 36.0 24.6 37.0 85-89 31.616899999999998 35.0 32.8 35.0 24.6 36.2 90-94 30.86255 34.6 32.0 35.0 21.2 35.4 95-99 30.81515 34.4 31.8 35.0 22.0 35.0 100-104 30.3202 34.0 31.0 35.0 18.2 35.0 105-109 30.199450000000002 34.0 31.0 35.0 17.8 35.0 110-114 29.8166 34.0 30.8 35.0 14.8 35.0 115-119 29.01355 34.0 29.2 35.0 6.6 35.0 120-124 28.2916 33.4 27.4 35.0 2.6 35.0 125-129 27.671450000000004 32.6 26.6 34.6 2.0 35.0 130-134 27.2659 32.8 25.4 34.8 2.0 35.0 135-139 26.57895 32.2 24.8 34.0 2.0 35.0 140-144 25.6056 31.6 21.8 34.0 2.0 35.0 145-149 24.419099999999997 31.0 12.2 34.0 2.0 35.0 150 20.752 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 109.0 3 12.0 4 8.0 5 5.0 6 9.0 7 6.0 8 9.0 9 6.0 10 7.0 11 10.0 12 17.0 13 13.0 14 13.0 15 8.0 16 17.0 17 12.0 18 13.0 19 19.0 20 11.0 21 15.0 22 20.0 23 30.0 24 31.0 25 36.0 26 50.0 27 61.0 28 70.0 29 98.0 30 110.0 31 134.0 32 187.0 33 223.0 34 357.0 35 619.0 36 1080.0 37 569.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 16.225 11.774999999999999 33.25 2 21.6 24.375 38.550000000000004 15.475 3 19.650000000000002 25.25 30.625000000000004 24.474999999999998 4 24.8 35.3 20.549999999999997 19.35 5 22.95 37.775 20.599999999999998 18.675 6 17.1 37.075 25.825 20.0 7 17.275 15.6 45.875 21.25 8 20.4 20.4 28.025 31.175000000000004 9 21.8 22.475 28.9 26.825 10-14 22.705000000000002 27.76 27.065 22.470000000000002 15-19 22.665 27.575 27.839999999999996 21.92 20-24 23.01 27.48 28.125 21.385 25-29 22.735 27.975 28.1 21.19 30-34 22.745 27.355 28.275 21.625 35-39 23.215 27.29 27.805000000000003 21.69 40-44 23.93 28.389999999999997 26.83 20.849999999999998 45-49 23.515 28.185 27.42 20.880000000000003 50-54 23.915 27.51 27.325 21.25 55-59 23.405 27.76 28.1 20.735 60-64 23.53 28.12 27.665 20.685000000000002 65-69 24.224999999999998 27.169999999999998 27.169999999999998 21.435000000000002 70-74 23.86 27.605 27.365000000000002 21.17 75-79 23.11 28.105000000000004 28.189999999999998 20.595 80-84 23.745 28.060000000000002 27.47 20.724999999999998 85-89 23.305 28.065 27.68 20.95 90-94 23.35 27.73 27.76 21.16 95-99 23.7 27.565 27.889999999999997 20.845 100-104 24.235 27.089999999999996 27.955000000000002 20.72 105-109 23.74 27.48 27.694999999999997 21.085 110-114 23.93 26.889999999999997 28.17 21.01 115-119 24.025 27.365000000000002 27.500000000000004 21.11 120-124 24.05 27.894999999999996 27.644999999999996 20.41 125-129 23.75831541039364 26.854399039663885 28.229880458160356 21.157405091782124 130-134 24.51 27.415 27.37 20.705000000000002 135-139 24.745 27.24 27.500000000000004 20.515 140-144 24.6 27.150000000000002 27.584999999999997 20.665 145-149 24.52 27.705000000000002 27.24 20.535 150 25.6 27.650000000000002 26.400000000000002 20.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 3.0 25 2.5 26 1.0 27 1.5 28 6.5 29 11.0 30 14.5 31 16.5 32 24.5 33 35.5 34 45.0 35 66.5 36 88.0 37 116.0 38 129.5 39 151.5 40 201.5 41 237.0 42 261.5 43 264.0 44 279.0 45 278.5 46 240.5 47 233.5 48 214.5 49 186.5 50 166.0 51 125.5 52 95.5 53 77.5 54 69.5 55 55.5 56 35.5 57 31.5 58 30.0 59 26.0 60 21.5 61 19.5 62 20.0 63 16.0 64 14.5 65 15.0 66 14.5 67 11.0 68 6.0 69 6.0 70 5.5 71 3.5 72 2.0 73 2.0 74 1.5 75 0.5 76 1.0 77 1.0 78 0.5 79 0.5 80 1.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.034999999999999996 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.8375000000000004 0.0 0.0 0.0 0.0 138 4.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539608 spots for SRR3727135.sra Written 1539608 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra Read 1539594 spots for SRR3727135.sra Written 1539594 spots for SRR3727135.sra SRR ids: ['SRR3727135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_27i77dc7 SRR3727135.sra spots: 30791894 blocks: [[1, 1539594], [1539595, 3079188], [3079189, 4618782], [4618783, 6158376], [6158377, 7697970], [7697971, 9237564], [9237565, 10777158], [10777159, 12316752], [12316753, 13856346], [13856347, 15395940], [15395941, 16935534], [16935535, 18475128], [18475129, 20014722], [20014723, 21554316], [21554317, 23093910], [23093911, 24633504], [24633505, 26173098], [26173099, 27712692], [27712693, 29252286], [29252287, 30791894]] SRR3727135 file size 10352521 SRR3727135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727135 SRR3727135_1.fastq SRR3727135_2.fastq Input file: SRR3727135_1.fastq Paired file: SRR3727135_2.fastq trimmed: SRR3727135-trimmed-pair1.fastq, SRR3727135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:08:41 2025 >> started Fri Feb 14 12:09:15 2025 >> done (34.525s) 30791894 read pairs processed; of these: 177207 ( 0.58%) short read pairs filtered out after trimming by size control 787980 ( 2.56%) empty read pairs filtered out after trimming by size control 29826707 (96.87%) read pairs available; of these: 14588138 (48.91%) trimmed read pairs available after processing 15238569 (51.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 29 0.00% 21 32 0.00% 22 62 0.00% 23 86 0.00% 24 104 0.00% 25 141 0.00% 26 187 0.00% 27 204 0.00% 28 246 0.00% 29 304 0.00% 30 368 0.00% 31 449 0.00% 32 508 0.00% 33 560 0.00% 34 667 0.00% 35 758 0.00% 36 820 0.00% 37 928 0.00% 38 1021 0.00% 39 1121 0.00% 40 1194 0.00% 41 1273 0.00% 42 1406 0.00% 43 1517 0.01% 44 1590 0.01% 45 1829 0.01% 46 1940 0.01% 47 2021 0.01% 48 2164 0.01% 49 2306 0.01% 50 2469 0.01% 51 2574 0.01% 52 2734 0.01% 53 3006 0.01% 54 3056 0.01% 55 3240 0.01% 56 3363 0.01% 57 3420 0.01% 58 3802 0.01% 59 4008 0.01% 60 4033 0.01% 61 4229 0.01% 62 4520 0.02% 63 4748 0.02% 64 5141 0.02% 65 5346 0.02% 66 5611 0.02% 67 5915 0.02% 68 6286 0.02% 69 6614 0.02% 70 6776 0.02% 71 7528 0.03% 72 7890 0.03% 73 8433 0.03% 74 9016 0.03% 75 9533 0.03% 76 10113 0.03% 77 10809 0.04% 78 11389 0.04% 79 12028 0.04% 80 12934 0.04% 81 13960 0.05% 82 15184 0.05% 83 16816 0.06% 84 25137 0.08% 85 26060 0.09% 86 27232 0.09% 87 29086 0.10% 88 29816 0.10% 89 31635 0.11% 90 33600 0.11% 91 33481 0.11% 92 33968 0.11% 93 35350 0.12% 94 38409 0.13% 95 38924 0.13% 96 38887 0.13% 97 39603 0.13% 98 40425 0.14% 99 42439 0.14% 100 44378 0.15% 101 48725 0.16% 102 48124 0.16% 103 46378 0.16% 104 49465 0.17% 105 54340 0.18% 106 60397 0.20% 107 64123 0.21% 108 66837 0.22% 109 61968 0.21% 110 59963 0.20% 111 63151 0.21% 112 59743 0.20% 113 59585 0.20% 114 67119 0.23% 115 85991 0.29% 116 70822 0.24% 117 61404 0.21% 118 60960 0.20% 119 70203 0.24% 120 75191 0.25% 121 83903 0.28% 122 86017 0.29% 123 94831 0.32% 124 110277 0.37% 125 110986 0.37% 126 108799 0.36% 127 104619 0.35% 128 112041 0.38% 129 122439 0.41% 130 129064 0.43% 131 144508 0.48% 132 161921 0.54% 133 170441 0.57% 134 178336 0.60% 135 188477 0.63% 136 205528 0.69% 137 220005 0.74% 138 237266 0.80% 139 255676 0.86% 140 272570 0.91% 141 303404 1.02% 142 340450 1.14% 143 384621 1.29% 144 457203 1.53% 145 560747 1.88% 146 712158 2.39% 147 970967 3.26% 148 1448779 4.86% 149 4226816 14.17% 150 15238569 51.09% 29826707 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=26.88 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.6 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.12 fanout-score-rank=8 prefix-density=0.35 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=20.44 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.0 sequence=ATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGGACTATCTCCCAGACCACAATGA SRR3727135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:10:11 Started mapping on | Feb 14 12:10:12 Finished on | Feb 14 12:14:24 Mapping speed, Million of reads per hour | 426.10 Number of input reads | 29826707 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 27457713 Uniquely mapped reads % | 92.06% Average mapped length | 288.17 Number of splices: Total | 26488586 Number of splices: Annotated (sjdb) | 26067784 Number of splices: GT/AG | 26088759 Number of splices: GC/AG | 336806 Number of splices: AT/AC | 19152 Number of splices: Non-canonical | 43869 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 643599 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 46004 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.57% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1767698 1767698 1767698 N_multimapping 643599 643599 643599 N_noFeature 812161 27139340 1005122 N_ambiguous 254034 1719 127366 UnstrandedReadsAssigned:26391518 PositiveStrandReadsAssigned:316654 NegativeStrandReadsAssigned:26325225 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR3727135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727135-trimmed-pair1.fastq SRR3727135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,826,707 reads, 26,465,495 reads pseudoaligned [quant] estimated average fragment length: 256.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR3727135.ke.tsv 34699 SRR3727135.se.tsv 87100 total ==> SRR3727135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.78 1582 35.5126 Potri.005G024800.1.v4.1 1035 779.783 450 22.8356 Potri.004G059700.1.v4.1 961 705.882 78 4.37257 Potri.007G009000.2.v4.1 1416 1160.78 0 0 Potri.003G141000.2.v4.1 2943 2687.78 1223.33 18.0105 Potri.016G087400.1.v4.1 270 74.9201 1189 627.998 Potri.015G069301.1.v4.1 564 316.843 0 0 Potri.010G195200.1.v4.1 1773 1517.78 246 6.41357 Potri.012G127500.1.v4.1 977 721.841 3768 206.559 ==> SRR3727135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 113 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 618 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 198 SRR3727135 completed mapping pipeline successfully