Starting /dee2/code/volunteer_pipeline.sh SRR3727136 current disk space = 3112765440000 free memory = 1569820788 SRR3727136 SRAfilesize de322cc6df36f260cf23e3cbc7a76a69 SRR3727136.sra SRR3727136.sra file validated SRR3727136 is paired end SRR3727136 is conventional basespace SRR3727136 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.18775 34.0 33.0 34.0 31.0 34.0 2 32.65525 34.0 33.0 34.0 31.0 34.0 3 33.173 34.0 34.0 34.0 31.0 34.0 4 36.574 37.0 37.0 37.0 35.0 37.0 5 36.60825 37.0 37.0 37.0 35.0 37.0 6 36.5105 37.0 37.0 37.0 35.0 37.0 7 36.58 37.0 37.0 37.0 35.0 37.0 8 36.59525 37.0 37.0 37.0 35.0 37.0 9 38.488 39.0 39.0 39.0 37.0 39.0 10-14 38.641149999999996 39.4 39.2 39.4 37.2 39.4 15-19 39.8586 41.0 40.0 41.0 37.8 41.0 20-24 39.8181 41.0 40.0 41.0 38.0 41.0 25-29 39.72945 41.0 40.0 41.0 37.6 41.0 30-34 39.56 41.0 39.8 41.0 37.0 41.0 35-39 39.1308 40.0 38.6 41.0 36.0 41.0 40-44 39.185500000000005 40.2 39.0 41.0 36.2 41.0 45-49 39.42705000000001 41.0 39.4 41.0 36.6 41.0 50-54 39.245149999999995 41.0 39.0 41.0 35.8 41.0 55-59 38.9465 40.0 38.4 41.0 35.0 41.0 60-64 38.2595 39.8 37.2 41.0 34.4 41.0 65-69 37.4747 38.8 35.8 40.6 33.6 41.0 70-74 36.636 37.2 35.0 39.4 33.4 41.0 75-79 35.272349999999996 35.8 34.6 37.4 32.2 39.2 80-84 34.5788 35.0 34.6 36.4 31.8 37.8 85-89 34.1288 35.0 34.0 35.6 32.0 36.4 90-94 33.48225 35.0 34.0 35.0 30.6 36.0 95-99 33.3379 35.0 34.0 35.0 30.8 35.0 100-104 33.05605 35.0 34.0 35.0 29.6 35.0 105-109 32.889599999999994 35.0 33.6 35.0 29.6 35.0 110-114 32.630100000000006 35.0 33.0 35.0 29.0 35.0 115-119 32.18575 34.4 32.8 35.0 27.4 35.0 120-124 31.896950000000004 34.0 32.4 35.0 26.2 35.0 125-129 31.42745 34.0 31.6 35.0 24.8 35.0 130-134 31.0331 34.0 31.0 35.0 24.0 35.0 135-139 29.796250000000004 34.0 29.8 35.0 16.8 35.0 140-144 28.92285 33.8 28.6 35.0 12.0 35.0 145-149 27.314550000000004 33.0 27.0 34.8 2.0 35.0 150 20.386 27.0 2.0 33.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 2.0 9 0.0 10 4.0 11 3.0 12 0.0 13 2.0 14 2.0 15 6.0 16 3.0 17 5.0 18 3.0 19 9.0 20 11.0 21 11.0 22 14.0 23 20.0 24 14.0 25 26.0 26 25.0 27 33.0 28 33.0 29 49.0 30 60.0 31 83.0 32 115.0 33 189.0 34 278.0 35 590.0 36 1335.0 37 1063.0 38 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.19663648124192 18.783958602846056 11.539456662354464 33.479948253557566 2 17.563172379284463 26.845133850387793 38.10357768326244 17.4881160870653 3 16.150000000000002 30.95 27.55 25.35 4 21.15 36.575 22.325 19.950000000000003 5 20.075000000000003 36.4 23.375 20.150000000000002 6 15.9 36.775000000000006 23.599999999999998 23.724999999999998 7 12.9 19.025 45.800000000000004 22.275 8 17.675 20.200000000000003 29.5 32.625 9 17.625 20.474999999999998 30.349999999999998 31.55 10-14 20.015 29.875 26.275 23.835 15-19 19.720916274882462 28.19845953786136 27.868360508152445 24.21226367910373 20-24 19.900000000000002 28.74 28.139999999999997 23.22 25-29 20.14 29.255 27.605 23.0 30-34 20.06 28.810000000000002 27.32 23.810000000000002 35-39 20.135 28.585 27.700000000000003 23.580000000000002 40-44 20.22 28.605000000000004 27.395000000000003 23.78 45-49 19.91 28.465 28.105000000000004 23.52 50-54 20.255000000000003 28.465 27.51 23.77 55-59 20.095 28.345 28.27 23.29 60-64 20.325 28.249999999999996 27.400000000000002 24.025 65-69 20.02 28.26 28.13 23.59 70-74 20.585 27.905 27.57 23.94 75-79 20.495 28.754999999999995 27.54 23.21 80-84 20.68 28.255000000000003 27.54 23.525 85-89 20.31 28.720000000000002 27.52 23.45 90-94 20.625 28.810000000000002 27.1 23.465 95-99 20.244999999999997 28.660000000000004 27.67 23.425 100-104 20.445 28.470000000000002 27.665 23.419999999999998 105-109 20.995 28.060000000000002 27.05 23.895 110-114 20.94 28.01 27.345000000000002 23.705000000000002 115-119 20.974999999999998 27.93 27.72 23.375 120-124 20.415 27.884999999999998 28.21 23.49 125-129 20.32 28.115000000000002 27.884999999999998 23.68 130-134 21.425 28.515 27.305 22.755 135-139 20.424999999999997 28.46 27.66 23.455000000000002 140-144 20.905 27.665 27.575 23.855 145-149 20.76 28.549999999999997 27.04 23.65 150 8.799999999999999 34.325 28.625 28.249999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 3.0 26 5.5 27 11.0 28 18.0 29 18.5 30 22.5 31 26.5 32 36.5 33 44.0 34 54.0 35 63.5 36 84.5 37 125.0 38 141.5 39 160.5 40 191.0 41 207.0 42 235.5 43 268.5 44 286.5 45 290.5 46 269.5 47 241.5 48 223.5 49 201.5 50 168.0 51 136.5 52 112.0 53 90.5 54 69.0 55 53.0 56 39.0 57 24.5 58 18.5 59 15.5 60 11.0 61 7.5 62 5.5 63 5.0 64 3.5 65 3.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.05 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2625 0.0 0.0 0.0 0.0 132-133 1.3875 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGTC 10 0.0069772652 143.975 9 >>END_MODULE SRR3727136 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.117 34.0 31.0 34.0 30.0 34.0 2 31.24975 34.0 31.0 34.0 28.0 34.0 3 31.576 34.0 31.0 34.0 30.0 34.0 4 34.903 37.0 37.0 37.0 33.0 37.0 5 34.9745 37.0 37.0 37.0 35.0 37.0 6 34.979 37.0 37.0 37.0 35.0 37.0 7 35.044 37.0 37.0 37.0 35.0 37.0 8 34.9215 37.0 37.0 37.0 35.0 37.0 9 36.7995 39.0 39.0 39.0 35.0 39.0 10-14 36.979549999999996 39.4 39.0 39.4 35.0 39.4 15-19 38.165600000000005 41.0 40.0 41.0 35.8 41.0 20-24 38.033 41.0 39.6 41.0 35.4 41.0 25-29 37.544500000000006 40.4 38.6 41.0 33.4 41.0 30-34 37.2468 40.0 38.0 41.0 32.2 41.0 35-39 37.29645000000001 40.0 38.0 41.0 32.8 41.0 40-44 36.87235 40.0 38.0 41.0 31.2 41.0 45-49 36.6573 40.0 37.6 41.0 31.0 41.0 50-54 36.12925 39.2 37.0 40.2 30.6 40.6 55-59 36.18315 39.6 36.4 41.0 30.0 41.0 60-64 36.0978 39.2 36.4 40.8 30.2 41.0 65-69 35.28665 38.0 35.0 40.0 28.8 41.0 70-74 34.22795 36.6 34.8 38.8 28.4 40.6 75-79 33.16165 35.4 34.0 37.2 26.8 39.0 80-84 32.452 35.0 34.0 36.0 26.4 37.2 85-89 32.09685 35.0 34.0 35.0 26.6 36.2 90-94 31.71185 35.0 33.4 35.0 25.6 35.6 95-99 31.334500000000002 35.0 33.0 35.0 24.6 35.0 100-104 31.0454 35.0 32.6 35.0 22.6 35.0 105-109 30.8419 35.0 32.2 35.0 20.6 35.0 110-114 30.4012 34.0 31.6 35.0 18.0 35.0 115-119 29.7363 34.0 30.2 35.0 8.6 35.0 120-124 29.20735 34.0 29.6 35.0 3.2 35.0 125-129 28.437450000000002 33.8 28.6 35.0 2.0 35.0 130-134 28.045050000000003 33.8 28.2 35.0 2.0 35.0 135-139 27.63575 33.0 26.6 35.0 2.0 35.0 140-144 27.0868 33.0 25.4 34.8 2.0 35.0 145-149 25.488599999999998 32.4 20.8 34.0 2.0 35.0 150 21.65525 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 155.0 3 11.0 4 6.0 5 2.0 6 4.0 7 7.0 8 12.0 9 3.0 10 4.0 11 6.0 12 8.0 13 5.0 14 7.0 15 6.0 16 4.0 17 4.0 18 11.0 19 14.0 20 16.0 21 17.0 22 22.0 23 15.0 24 28.0 25 28.0 26 38.0 27 41.0 28 45.0 29 55.0 30 80.0 31 99.0 32 148.0 33 190.0 34 323.0 35 591.0 36 1193.0 37 795.0 38 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.77983487615712 16.61245934450838 13.309982486865149 30.297723292469353 2 22.275 23.825 36.425000000000004 17.474999999999998 3 19.8 25.174999999999997 31.125000000000004 23.9 4 25.474999999999998 33.775 20.325 20.424999999999997 5 22.275 37.574999999999996 21.025 19.125 6 16.325 38.175 24.525 20.974999999999998 7 16.400000000000002 15.65 46.9 21.05 8 19.675 20.275000000000002 28.025 32.025 9 22.025 23.724999999999998 27.175 27.075 10-14 22.68 28.815 26.529999999999998 21.975 15-19 22.505 28.410000000000004 27.700000000000003 21.385 20-24 22.775000000000002 27.72 28.499999999999996 21.005 25-29 22.835 28.365000000000002 27.450000000000003 21.349999999999998 30-34 22.835 28.720000000000002 27.77 20.674999999999997 35-39 22.814999999999998 28.470000000000002 27.639999999999997 21.075 40-44 22.935 27.810000000000002 28.395 20.86 45-49 23.085 27.365000000000002 27.825 21.725 50-54 22.605 27.465 28.970000000000002 20.96 55-59 22.765 27.265 28.935 21.035 60-64 22.88 28.12 29.07 19.93 65-69 22.900000000000002 27.98 28.305000000000003 20.815 70-74 22.515 28.395 28.315 20.775 75-79 23.369999999999997 27.54 28.155 20.935000000000002 80-84 23.119999999999997 27.415 28.49 20.974999999999998 85-89 23.085 27.400000000000002 28.23 21.285 90-94 23.04 28.389999999999997 27.694999999999997 20.875 95-99 23.075000000000003 27.589999999999996 28.525 20.810000000000002 100-104 23.095 27.985 28.299999999999997 20.62 105-109 23.09 27.939999999999998 28.32 20.65 110-114 23.235 27.700000000000003 28.449999999999996 20.615 115-119 23.244999999999997 27.894999999999996 27.800000000000004 21.060000000000002 120-124 23.595 28.035 27.615000000000002 20.755000000000003 125-129 24.08667801020919 27.32459213291963 27.87508757882094 20.713642278050244 130-134 23.880447319592797 28.203199438343113 27.365728900255753 20.550624341808334 135-139 23.50847287676727 27.534342725358467 28.316454426952774 20.640729970921488 140-144 23.751253761283852 27.818455366098295 27.698094282848544 20.73219658976931 145-149 24.849699398797593 28.42685370741483 26.59819639278557 20.125250501002004 150 24.98748122183275 29.34401602403605 26.214321482223333 19.45418127190786 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.5 12 1.5 13 1.5 14 1.0 15 2.5 16 2.0 17 0.5 18 3.0 19 4.0 20 3.0 21 2.0 22 2.0 23 3.5 24 5.5 25 4.5 26 5.0 27 8.0 28 11.0 29 13.5 30 17.0 31 21.0 32 25.5 33 37.5 34 39.5 35 44.0 36 79.5 37 108.0 38 131.0 39 169.0 40 212.0 41 238.0 42 239.0 43 256.5 44 271.5 45 275.5 46 267.5 47 247.0 48 241.0 49 205.0 50 161.5 51 131.5 52 99.0 53 84.0 54 70.5 55 55.0 56 41.0 57 31.0 58 28.5 59 20.5 60 13.5 61 15.0 62 10.5 63 4.5 64 4.5 65 5.0 66 3.5 67 2.5 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 1.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.09 130-134 0.295 135-139 0.27 140-144 0.3 145-149 0.2 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.9249999999999999 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.4249999999999998 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138 2.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATC 10 0.006973645 144.0 2 TCTCACC 10 0.006973645 144.0 7 >>END_MODULE Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra Read 871353 spots for SRR3727136.sra Written 871353 spots for SRR3727136.sra SRR ids: ['SRR3727136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wc_o010w SRR3727136.sra spots: 17427060 blocks: [[1, 871353], [871354, 1742706], [1742707, 2614059], [2614060, 3485412], [3485413, 4356765], [4356766, 5228118], [5228119, 6099471], [6099472, 6970824], [6970825, 7842177], [7842178, 8713530], [8713531, 9584883], [9584884, 10456236], [10456237, 11327589], [11327590, 12198942], [12198943, 13070295], [13070296, 13941648], [13941649, 14813001], [14813002, 15684354], [15684355, 16555707], [16555708, 17427060]] SRR3727136 file size 5849721 SRR3727136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727136 SRR3727136_1.fastq SRR3727136_2.fastq Input file: SRR3727136_1.fastq Paired file: SRR3727136_2.fastq trimmed: SRR3727136-trimmed-pair1.fastq, SRR3727136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:06:12 2025 >> started Fri Feb 14 12:06:31 2025 >> done (18.734s) 17427060 read pairs processed; of these: 95987 ( 0.55%) short read pairs filtered out after trimming by size control 530132 ( 3.04%) empty read pairs filtered out after trimming by size control 16800941 (96.41%) read pairs available; of these: 6668125 (39.69%) trimmed read pairs available after processing 10132816 (60.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 14 0.00% 21 11 0.00% 22 21 0.00% 23 28 0.00% 24 27 0.00% 25 35 0.00% 26 40 0.00% 27 43 0.00% 28 54 0.00% 29 64 0.00% 30 86 0.00% 31 84 0.00% 32 111 0.00% 33 119 0.00% 34 139 0.00% 35 164 0.00% 36 159 0.00% 37 199 0.00% 38 211 0.00% 39 230 0.00% 40 286 0.00% 41 326 0.00% 42 309 0.00% 43 327 0.00% 44 396 0.00% 45 415 0.00% 46 442 0.00% 47 445 0.00% 48 522 0.00% 49 556 0.00% 50 523 0.00% 51 596 0.00% 52 624 0.00% 53 656 0.00% 54 723 0.00% 55 763 0.00% 56 829 0.00% 57 885 0.01% 58 859 0.01% 59 892 0.01% 60 966 0.01% 61 1052 0.01% 62 1069 0.01% 63 1230 0.01% 64 1195 0.01% 65 1304 0.01% 66 1417 0.01% 67 1436 0.01% 68 1581 0.01% 69 1708 0.01% 70 1779 0.01% 71 1936 0.01% 72 2142 0.01% 73 2229 0.01% 74 2423 0.01% 75 2542 0.02% 76 2705 0.02% 77 3108 0.02% 78 3198 0.02% 79 3299 0.02% 80 3523 0.02% 81 3655 0.02% 82 4082 0.02% 83 5043 0.03% 84 10535 0.06% 85 10526 0.06% 86 10704 0.06% 87 11382 0.07% 88 11530 0.07% 89 11273 0.07% 90 11706 0.07% 91 11982 0.07% 92 14084 0.08% 93 13257 0.08% 94 13545 0.08% 95 13664 0.08% 96 13968 0.08% 97 14640 0.09% 98 16081 0.10% 99 17911 0.11% 100 14138 0.08% 101 14099 0.08% 102 19191 0.11% 103 15453 0.09% 104 15107 0.09% 105 18779 0.11% 106 23663 0.14% 107 17733 0.11% 108 17996 0.11% 109 17712 0.11% 110 18965 0.11% 111 17636 0.10% 112 17860 0.11% 113 17411 0.10% 114 19773 0.12% 115 38903 0.23% 116 20333 0.12% 117 21798 0.13% 118 19165 0.11% 119 19434 0.12% 120 20158 0.12% 121 30352 0.18% 122 39068 0.23% 123 26684 0.16% 124 22434 0.13% 125 23074 0.14% 126 29050 0.17% 127 28752 0.17% 128 27554 0.16% 129 30674 0.18% 130 58263 0.35% 131 44349 0.26% 132 38995 0.23% 133 62897 0.37% 134 79950 0.48% 135 64371 0.38% 136 78578 0.47% 137 87638 0.52% 138 101392 0.60% 139 109686 0.65% 140 117358 0.70% 141 130426 0.78% 142 149758 0.89% 143 164871 0.98% 144 187886 1.12% 145 228634 1.36% 146 302004 1.80% 147 428689 2.55% 148 670432 3.99% 149 2624372 15.62% 150 10132816 60.31% 16800941 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.36 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=3.5 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=50.50 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=14.2 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=1.9 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=25.83 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.9 sequence=ATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGGACTATCTCCCAGACCACAATGA SRR3727136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:07:34 Started mapping on | Feb 14 12:07:34 Finished on | Feb 14 12:09:02 Mapping speed, Million of reads per hour | 687.31 Number of input reads | 16800941 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16092177 Uniquely mapped reads % | 95.78% Average mapped length | 292.18 Number of splices: Total | 15870822 Number of splices: Annotated (sjdb) | 15622723 Number of splices: GT/AG | 15632256 Number of splices: GC/AG | 201137 Number of splices: AT/AC | 11620 Number of splices: Non-canonical | 25809 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396746 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 23252 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 338344 338344 338344 N_multimapping 396746 396746 396746 N_noFeature 430080 15897322 550705 N_ambiguous 150804 1216 75633 UnstrandedReadsAssigned:15511293 PositiveStrandReadsAssigned:193639 NegativeStrandReadsAssigned:15465839 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727136-trimmed-pair1.fastq SRR3727136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,800,941 reads, 15,546,653 reads pseudoaligned [quant] estimated average fragment length: 258.528 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR3727136.ke.tsv 34699 SRR3727136.se.tsv 87100 total ==> SRR3727136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.47 947 35.2487 Potri.005G024800.1.v4.1 1035 777.472 312 26.2961 Potri.004G059700.1.v4.1 961 703.598 66 6.14669 Potri.007G009000.2.v4.1 1416 1158.47 0 0 Potri.003G141000.2.v4.1 2943 2685.47 727 17.7393 Potri.016G087400.1.v4.1 270 74.3235 717 632.142 Potri.015G069301.1.v4.1 564 316.001 0 0 Potri.010G195200.1.v4.1 1773 1515.47 179.919 7.77949 Potri.012G127500.1.v4.1 977 719.557 1660 151.17 ==> SRR3727136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 65 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 136 SRR3727136 completed mapping pipeline successfully