Starting /dee2/code/volunteer_pipeline.sh SRR3727137 current disk space = 3115073556480 free memory = 1331116760 SRR3727137 SRAfilesize 3c3f136b9871343970dcff408846ea2e SRR3727137.sra SRR3727137.sra file validated SRR3727137 is paired end SRR3727137 is conventional basespace SRR3727137 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.313 34.0 31.0 34.0 31.0 34.0 2 32.776 34.0 33.0 34.0 31.0 34.0 3 33.08775 34.0 33.0 34.0 31.0 34.0 4 36.5415 37.0 37.0 37.0 35.0 37.0 5 36.45125 37.0 37.0 37.0 35.0 37.0 6 36.5095 37.0 37.0 37.0 35.0 37.0 7 36.49025 37.0 37.0 37.0 35.0 37.0 8 36.5115 37.0 37.0 37.0 35.0 37.0 9 38.35675 39.0 39.0 39.0 37.0 39.0 10-14 38.54635 39.4 39.0 39.4 36.8 39.4 15-19 39.69160000000001 41.0 40.0 41.0 37.4 41.0 20-24 39.6152 41.0 39.8 41.0 37.2 41.0 25-29 39.126 40.2 38.6 41.0 36.0 41.0 30-34 38.9981 40.0 38.2 41.0 35.6 41.0 35-39 38.91645 40.0 38.0 41.0 35.4 41.0 40-44 39.05655 40.0 38.6 41.0 35.6 41.0 45-49 39.240300000000005 40.6 39.0 41.0 36.0 41.0 50-54 38.9253 40.0 38.8 41.0 35.0 41.0 55-59 38.502 40.0 38.0 41.0 34.6 41.0 60-64 38.086349999999996 39.8 36.8 41.0 34.0 41.0 65-69 37.34875 38.8 35.8 40.4 33.2 41.0 70-74 36.3517 37.0 35.0 39.2 32.8 40.8 75-79 35.0037 35.2 34.4 37.4 31.4 39.2 80-84 34.53395 35.0 34.2 36.4 31.6 37.6 85-89 33.98435 35.0 34.0 35.4 31.2 36.4 90-94 33.50205 35.0 34.0 35.0 30.8 35.8 95-99 33.1849 35.0 34.0 35.0 30.0 35.0 100-104 32.951899999999995 35.0 33.6 35.0 29.6 35.0 105-109 32.72785 35.0 33.2 35.0 29.2 35.0 110-114 32.560700000000004 35.0 33.0 35.0 29.0 35.0 115-119 32.05615 34.0 32.0 35.0 26.2 35.0 120-124 31.792399999999997 34.0 31.6 35.0 25.8 35.0 125-129 31.503950000000003 34.0 31.6 35.0 25.0 35.0 130-134 31.051800000000004 34.0 31.0 35.0 24.6 35.0 135-139 30.331599999999998 34.0 30.4 35.0 21.6 35.0 140-144 28.864500000000003 33.4 28.4 35.0 9.0 35.0 145-149 27.27805 33.0 26.6 34.2 2.0 35.0 150 21.3485 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 1.0 9 1.0 10 1.0 11 4.0 12 4.0 13 4.0 14 4.0 15 2.0 16 3.0 17 6.0 18 7.0 19 12.0 20 7.0 21 11.0 22 7.0 23 13.0 24 22.0 25 24.0 26 33.0 27 40.0 28 52.0 29 41.0 30 65.0 31 95.0 32 130.0 33 188.0 34 320.0 35 593.0 36 1293.0 37 1013.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.250830989516746 18.000511378164152 12.682178470979288 40.066479161339814 2 18.224999999999998 28.4 38.574999999999996 14.799999999999999 3 17.224999999999998 31.15 26.700000000000003 24.925 4 20.200000000000003 38.0 21.099999999999998 20.7 5 20.25 37.6 22.5 19.650000000000002 6 15.975 37.2 25.474999999999998 21.349999999999998 7 12.425 18.375 46.275 22.925 8 18.525 19.7 27.474999999999998 34.300000000000004 9 17.974999999999998 21.55 30.625000000000004 29.849999999999998 10-14 19.35 29.575000000000003 27.125 23.95 15-19 19.625 28.46 27.815 24.099999999999998 20-24 19.78 28.53 27.894999999999996 23.794999999999998 25-29 19.985 28.560000000000002 28.535 22.919999999999998 30-34 19.99 28.804999999999996 27.565 23.64 35-39 19.96 28.560000000000002 28.13 23.35 40-44 19.775000000000002 29.154999999999998 27.27 23.799999999999997 45-49 19.88 28.76 28.134999999999998 23.225 50-54 20.244999999999997 28.76 27.73 23.265 55-59 20.055 28.53 27.744999999999997 23.669999999999998 60-64 20.145 28.54 27.529999999999998 23.785 65-69 20.605 27.860000000000003 28.325 23.21 70-74 20.43 28.53 27.48 23.56 75-79 20.150000000000002 29.035 27.22 23.595 80-84 20.72 28.015 27.465 23.799999999999997 85-89 19.99 28.73 27.62 23.66 90-94 20.685000000000002 28.935 27.279999999999998 23.1 95-99 20.01 28.555000000000003 28.025 23.41 100-104 19.869999999999997 28.189999999999998 28.549999999999997 23.39 105-109 20.215 28.444999999999997 28.345 22.994999999999997 110-114 19.985 28.904999999999998 27.455000000000002 23.655 115-119 20.43 28.22 28.04 23.31 120-124 20.380000000000003 28.58 27.705000000000002 23.335 125-129 20.835 28.43 27.139999999999997 23.595 130-134 20.645 28.59 27.389999999999997 23.375 135-139 20.96 28.134999999999998 27.644999999999996 23.26 140-144 20.935000000000002 27.825 27.92 23.32 145-149 20.52 28.65 27.250000000000004 23.580000000000002 150 10.45 33.175 27.975 28.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 2.0 22 2.0 23 1.5 24 3.5 25 4.5 26 4.0 27 6.0 28 7.5 29 11.0 30 19.0 31 28.5 32 34.0 33 33.5 34 44.5 35 65.5 36 93.5 37 129.5 38 149.0 39 165.5 40 207.0 41 247.5 42 280.0 43 280.5 44 288.0 45 301.0 46 272.0 47 233.0 48 200.5 49 168.0 50 153.5 51 139.0 52 105.5 53 78.5 54 53.5 55 43.0 56 37.0 57 30.0 58 21.0 59 12.5 60 7.5 61 6.0 62 6.5 63 4.5 64 3.0 65 3.0 66 4.0 67 3.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.5125 0.0 0.0 0.0 0.0 130-131 0.5375000000000001 0.0 0.0 0.0 0.0 132-133 0.6625 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAGC 10 0.0067147487 145.81013 1 CATAAGT 10 0.0067147487 145.81013 1 AGCCTGC 10 0.0069754543 143.9875 5 CCAAGCC 10 0.0069754543 143.9875 2 >>END_MODULE SRR3727137 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.54575 34.0 31.0 34.0 30.0 34.0 2 32.08075 34.0 31.0 34.0 30.0 34.0 3 32.097 34.0 31.0 34.0 30.0 34.0 4 35.63525 37.0 37.0 37.0 35.0 37.0 5 35.57925 37.0 37.0 37.0 35.0 37.0 6 35.538 37.0 37.0 37.0 35.0 37.0 7 35.5225 37.0 37.0 37.0 35.0 37.0 8 35.51675 37.0 37.0 37.0 35.0 37.0 9 37.328 39.0 39.0 39.0 35.0 39.0 10-14 37.451350000000005 39.4 38.4 39.4 35.0 39.4 15-19 38.61875 41.0 39.0 41.0 35.8 41.0 20-24 38.4713 40.8 39.0 41.0 35.2 41.0 25-29 38.299549999999996 40.2 38.8 41.0 34.8 41.0 30-34 38.18655 40.0 38.6 41.0 34.6 41.0 35-39 37.9591 40.0 38.0 41.0 33.8 41.0 40-44 37.66375 40.0 38.0 41.0 33.0 41.0 45-49 37.417649999999995 40.0 38.0 41.0 32.8 41.0 50-54 36.847899999999996 39.4 37.0 40.4 31.8 40.8 55-59 36.8778 39.8 36.8 41.0 31.4 41.0 60-64 36.7698 39.0 36.2 41.0 31.8 41.0 65-69 36.1201 38.2 35.2 40.2 31.6 41.0 70-74 35.18444999999999 36.6 35.0 39.2 31.0 40.8 75-79 34.11435 35.6 34.4 37.2 29.8 39.0 80-84 33.207300000000004 35.0 34.0 36.2 29.0 37.4 85-89 32.6004 35.0 34.0 35.0 28.8 36.2 90-94 32.1757 35.0 33.4 35.0 27.2 35.8 95-99 31.68315 35.0 32.6 35.0 25.6 35.0 100-104 31.4192 35.0 32.4 35.0 24.8 35.0 105-109 31.4046 35.0 32.4 35.0 24.6 35.0 110-114 30.6094 34.2 31.2 35.0 21.4 35.0 115-119 30.5077 34.0 31.0 35.0 20.0 35.0 120-124 30.21785 34.0 30.8 35.0 18.4 35.0 125-129 29.860449999999997 34.0 30.4 35.0 17.4 35.0 130-134 29.312899999999996 34.0 29.4 35.0 10.8 35.0 135-139 28.946649999999998 34.0 29.0 35.0 5.6 35.0 140-144 28.08795 33.2 27.8 35.0 2.0 35.0 145-149 27.205550000000006 33.0 26.2 34.8 2.0 35.0 150 23.17775 29.0 18.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 78.0 3 10.0 4 2.0 5 7.0 6 2.0 7 4.0 8 5.0 9 5.0 10 3.0 11 4.0 12 9.0 13 11.0 14 14.0 15 8.0 16 10.0 17 10.0 18 13.0 19 12.0 20 10.0 21 9.0 22 15.0 23 14.0 24 20.0 25 22.0 26 33.0 27 47.0 28 49.0 29 45.0 30 88.0 31 99.0 32 126.0 33 201.0 34 328.0 35 581.0 36 1174.0 37 919.0 38 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6 14.45 14.75 34.2 2 22.85 23.825 37.175000000000004 16.150000000000002 3 19.650000000000002 27.474999999999998 30.425 22.45 4 22.725 35.725 21.025 20.525 5 22.625 37.375 21.95 18.05 6 15.925 37.974999999999994 24.875 21.224999999999998 7 17.1 15.225 45.425 22.25 8 20.0 20.9 29.175 29.925 9 21.7 22.575 29.425 26.3 10-14 22.575 28.595 26.43 22.400000000000002 15-19 22.79 27.79 28.310000000000002 21.11 20-24 22.900000000000002 28.110000000000003 27.905 21.085 25-29 22.575 28.165000000000003 28.244999999999997 21.015 30-34 22.625 28.265 28.1 21.01 35-39 22.869999999999997 28.23 28.26 20.64 40-44 22.955000000000002 28.33 28.025 20.69 45-49 22.725 27.975 28.365000000000002 20.935000000000002 50-54 22.814999999999998 28.125 28.105000000000004 20.955 55-59 23.36 28.225 27.560000000000002 20.855 60-64 22.715 28.470000000000002 28.32 20.495 65-69 23.365 27.985 27.905 20.745 70-74 23.315 28.395 27.595 20.695 75-79 23.125 27.72 28.29 20.865000000000002 80-84 23.265 27.99 28.439999999999998 20.305 85-89 23.445 27.905 28.189999999999998 20.46 90-94 22.955000000000002 28.249999999999996 28.315 20.48 95-99 23.77 26.93 28.62 20.68 100-104 23.095 28.044999999999998 28.115000000000002 20.745 105-109 23.330000000000002 27.405 28.775000000000002 20.49 110-114 23.345 28.110000000000003 27.98 20.565 115-119 23.51 27.99 28.084999999999997 20.415 120-124 22.97 27.305 28.71 21.015 125-129 23.33350002500375 27.919187878181727 28.309246386958044 20.438065709856478 130-134 22.855 28.294999999999998 28.075 20.775 135-139 23.7 27.11 28.405 20.785 140-144 23.810000000000002 27.474999999999998 27.925 20.79 145-149 24.27 27.93 27.595 20.205000000000002 150 23.025000000000002 27.675 28.000000000000004 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.0 21 1.5 22 4.0 23 4.0 24 3.5 25 4.0 26 4.5 27 8.0 28 9.5 29 8.0 30 14.0 31 23.5 32 27.0 33 28.5 34 39.5 35 55.5 36 78.0 37 104.5 38 135.5 39 175.5 40 208.0 41 237.5 42 262.5 43 276.5 44 279.0 45 291.0 46 293.0 47 259.0 48 225.0 49 193.0 50 155.0 51 122.0 52 99.5 53 84.5 54 67.5 55 47.5 56 35.0 57 34.0 58 27.0 59 16.5 60 10.5 61 6.5 62 7.0 63 7.0 64 7.0 65 5.5 66 3.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.3770739064856712 0.75 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.4875 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 1.2625000000000002 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155679 spots for SRR3727137.sra Written 1155679 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra Read 1155669 spots for SRR3727137.sra Written 1155669 spots for SRR3727137.sra SRR ids: ['SRR3727137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4wq6h61c SRR3727137.sra spots: 23113390 blocks: [[1, 1155669], [1155670, 2311338], [2311339, 3467007], [3467008, 4622676], [4622677, 5778345], [5778346, 6934014], [6934015, 8089683], [8089684, 9245352], [9245353, 10401021], [10401022, 11556690], [11556691, 12712359], [12712360, 13868028], [13868029, 15023697], [15023698, 16179366], [16179367, 17335035], [17335036, 18490704], [18490705, 19646373], [19646374, 20802042], [20802043, 21957711], [21957712, 23113390]] SRR3727137 file size 7765525 SRR3727137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727137 SRR3727137_1.fastq SRR3727137_2.fastq Input file: SRR3727137_1.fastq Paired file: SRR3727137_2.fastq trimmed: SRR3727137-trimmed-pair1.fastq, SRR3727137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:16:40 2025 >> started Fri Feb 14 11:17:11 2025 >> done (31.275s) 23113390 read pairs processed; of these: 118583 ( 0.51%) short read pairs filtered out after trimming by size control 431863 ( 1.87%) empty read pairs filtered out after trimming by size control 22562944 (97.62%) read pairs available; of these: 9639245 (42.72%) trimmed read pairs available after processing 12923699 (57.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 9 0.00% 21 14 0.00% 22 39 0.00% 23 39 0.00% 24 58 0.00% 25 72 0.00% 26 90 0.00% 27 103 0.00% 28 153 0.00% 29 156 0.00% 30 174 0.00% 31 228 0.00% 32 249 0.00% 33 261 0.00% 34 331 0.00% 35 362 0.00% 36 405 0.00% 37 515 0.00% 38 552 0.00% 39 580 0.00% 40 700 0.00% 41 724 0.00% 42 821 0.00% 43 881 0.00% 44 963 0.00% 45 1061 0.00% 46 1121 0.00% 47 1236 0.01% 48 1296 0.01% 49 1396 0.01% 50 1387 0.01% 51 1564 0.01% 52 1576 0.01% 53 1700 0.01% 54 1796 0.01% 55 1962 0.01% 56 1910 0.01% 57 2011 0.01% 58 2146 0.01% 59 2284 0.01% 60 2363 0.01% 61 2561 0.01% 62 2580 0.01% 63 2837 0.01% 64 2965 0.01% 65 3149 0.01% 66 3220 0.01% 67 3407 0.02% 68 3565 0.02% 69 3714 0.02% 70 3958 0.02% 71 4144 0.02% 72 4520 0.02% 73 4795 0.02% 74 5215 0.02% 75 5447 0.02% 76 5843 0.03% 77 6235 0.03% 78 6614 0.03% 79 7150 0.03% 80 7715 0.03% 81 8495 0.04% 82 9158 0.04% 83 10069 0.04% 84 15677 0.07% 85 15700 0.07% 86 16719 0.07% 87 17508 0.08% 88 17813 0.08% 89 18469 0.08% 90 19615 0.09% 91 20747 0.09% 92 21560 0.10% 93 22004 0.10% 94 23611 0.10% 95 23847 0.11% 96 24548 0.11% 97 25333 0.11% 98 25348 0.11% 99 25976 0.12% 100 25280 0.11% 101 26192 0.12% 102 28239 0.13% 103 31239 0.14% 104 40856 0.18% 105 32880 0.15% 106 30358 0.13% 107 33343 0.15% 108 35403 0.16% 109 38968 0.17% 110 38971 0.17% 111 38569 0.17% 112 40919 0.18% 113 39335 0.17% 114 43335 0.19% 115 51750 0.23% 116 42229 0.19% 117 34860 0.15% 118 33026 0.15% 119 34636 0.15% 120 39691 0.18% 121 45959 0.20% 122 48063 0.21% 123 51317 0.23% 124 49580 0.22% 125 52645 0.23% 126 54512 0.24% 127 58946 0.26% 128 68163 0.30% 129 68321 0.30% 130 66302 0.29% 131 70764 0.31% 132 86347 0.38% 133 95320 0.42% 134 100449 0.45% 135 109952 0.49% 136 119844 0.53% 137 127865 0.57% 138 137960 0.61% 139 150022 0.66% 140 162142 0.72% 141 180567 0.80% 142 206523 0.92% 143 235552 1.04% 144 284064 1.26% 145 349431 1.55% 146 457942 2.03% 147 646706 2.87% 148 1000353 4.43% 149 3306431 14.65% 150 12923699 57.28% 22562944 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=26 prefix-density=0.36 prefix-fanout=2.1 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=22.53 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.7 sequence=ATCAACCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=2.9 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=17.56 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.8 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR3727137 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:18:05 Started mapping on | Feb 14 11:18:17 Finished on | Feb 14 11:21:55 Mapping speed, Million of reads per hour | 372.60 Number of input reads | 22562944 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 21555542 Uniquely mapped reads % | 95.54% Average mapped length | 290.30 Number of splices: Total | 19670286 Number of splices: Annotated (sjdb) | 19317185 Number of splices: GT/AG | 19362731 Number of splices: GC/AG | 253130 Number of splices: AT/AC | 15467 Number of splices: Non-canonical | 38958 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.03% Deletion average length | 1.84 Insertion rate per base | 0.02% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 539026 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 43772 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 492588 492588 492588 N_multimapping 539026 539026 539026 N_noFeature 782299 21328445 897576 N_ambiguous 236371 1533 123537 UnstrandedReadsAssigned:20536872 PositiveStrandReadsAssigned:225564 NegativeStrandReadsAssigned:20534429 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727137-trimmed-pair1.fastq SRR3727137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,562,944 reads, 20,636,190 reads pseudoaligned [quant] estimated average fragment length: 255.921 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR3727137.ke.tsv 34699 SRR3727137.se.tsv 87100 total ==> SRR3727137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.08 2019 53.4327 Potri.005G024800.1.v4.1 1035 780.079 386 23.0883 Potri.004G059700.1.v4.1 961 706.145 16 1.05723 Potri.007G009000.2.v4.1 1416 1161.08 0 0 Potri.003G141000.2.v4.1 2943 2688.08 784.349 13.6148 Potri.016G087400.1.v4.1 270 71.0802 926.53 608.211 Potri.015G069301.1.v4.1 564 314.688 0 0 Potri.010G195200.1.v4.1 1773 1518.08 443.866 13.6427 Potri.012G127500.1.v4.1 977 722.103 11035 713.043 ==> SRR3727137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 164 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 509 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 421 SRR3727137 completed mapping pipeline successfully