Starting /dee2/code/volunteer_pipeline.sh SRR3727138 current disk space = 3111715090432 free memory = 1579776028 SRR3727138 SRAfilesize 72d32e5925538a872ea80da40dbca2a0 SRR3727138.sra SRR3727138.sra file validated SRR3727138 is paired end SRR3727138 is conventional basespace SRR3727138 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.643 34.0 34.0 34.0 31.0 34.0 2 33.0275 34.0 34.0 34.0 31.0 34.0 3 33.3965 34.0 34.0 34.0 31.0 34.0 4 36.72 37.0 37.0 37.0 35.0 37.0 5 36.7115 37.0 37.0 37.0 35.0 37.0 6 36.6825 37.0 37.0 37.0 35.0 37.0 7 36.70825 37.0 37.0 37.0 35.0 37.0 8 36.7185 37.0 37.0 37.0 36.0 37.0 9 38.58575 39.0 39.0 39.0 38.0 39.0 10-14 38.852250000000005 39.4 39.2 39.4 37.4 39.4 15-19 40.112649999999995 41.0 40.0 41.0 38.0 41.0 20-24 40.067099999999996 41.0 40.0 41.0 38.0 41.0 25-29 39.9634 41.0 40.0 41.0 38.0 41.0 30-34 39.8163 41.0 40.0 41.0 38.0 41.0 35-39 39.41755 40.0 39.0 41.0 36.8 41.0 40-44 39.498599999999996 40.2 39.2 41.0 37.4 41.0 45-49 39.7246 41.0 40.0 41.0 37.6 41.0 50-54 39.4656 41.0 39.2 41.0 36.6 41.0 55-59 39.210150000000006 40.4 39.0 41.0 35.6 41.0 60-64 38.5877 40.0 37.6 41.0 34.8 41.0 65-69 37.7647 39.0 36.2 40.8 34.0 41.0 70-74 36.8827 37.2 35.0 39.4 34.0 41.0 75-79 35.5647 36.0 34.8 37.4 32.8 39.2 80-84 34.93035 35.0 35.0 36.4 33.0 37.8 85-89 34.31685 35.0 34.6 35.6 32.8 36.6 90-94 33.86515 35.0 34.0 35.0 31.4 36.0 95-99 33.6961 35.0 34.0 35.0 31.6 35.2 100-104 33.4182 35.0 34.0 35.0 31.0 35.0 105-109 33.3246 35.0 34.0 35.0 30.6 35.0 110-114 33.13369999999999 35.0 34.0 35.0 30.2 35.0 115-119 32.71145 35.0 33.0 35.0 29.0 35.0 120-124 32.3745 34.4 32.6 35.0 27.8 35.0 125-129 32.04265 34.0 32.6 35.0 26.6 35.0 130-134 31.64855 34.0 32.0 35.0 25.4 35.0 135-139 30.535350000000005 34.0 30.4 35.0 21.4 35.0 140-144 29.69045 34.0 29.4 35.0 17.0 35.0 145-149 27.95985 33.6 28.0 35.0 4.2 35.0 150 20.8035 27.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 2.0 10 2.0 11 3.0 12 1.0 13 0.0 14 2.0 15 2.0 16 4.0 17 5.0 18 9.0 19 1.0 20 4.0 21 7.0 22 6.0 23 6.0 24 11.0 25 16.0 26 23.0 27 19.0 28 23.0 29 41.0 30 61.0 31 70.0 32 102.0 33 155.0 34 284.0 35 590.0 36 1350.0 37 1186.0 38 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.31370038412292 17.797695262483995 13.725992317541614 33.162612035851474 2 17.658829414707352 26.338169084542272 38.519259629814904 17.483741870935468 3 16.5 31.974999999999998 27.0 24.525 4 21.5 37.2 21.9 19.400000000000002 5 19.900000000000002 39.275 22.45 18.375 6 17.05 35.675000000000004 25.1 22.175 7 13.0 19.325 46.150000000000006 21.525 8 18.25 19.950000000000003 29.599999999999998 32.2 9 17.9 22.75 30.525000000000002 28.825 10-14 18.93 30.455 26.605 24.01 15-19 19.36193619361936 28.972897289728973 28.012801280128013 23.652365236523654 20-24 19.580000000000002 28.854999999999997 27.939999999999998 23.625 25-29 19.509999999999998 29.404999999999998 27.235 23.849999999999998 30-34 19.794999999999998 29.160000000000004 28.265 22.78 35-39 19.875 28.895 27.265 23.965 40-44 20.064999999999998 28.595 28.185 23.155 45-49 20.44 28.54 27.62 23.400000000000002 50-54 19.900000000000002 28.854999999999997 27.529999999999998 23.715 55-59 20.18 29.26 27.485 23.075000000000003 60-64 20.095 28.76 27.345000000000002 23.799999999999997 65-69 20.185 28.505000000000003 27.76 23.549999999999997 70-74 19.84 29.154999999999998 27.73 23.275000000000002 75-79 20.375 28.994999999999997 27.175 23.455000000000002 80-84 20.41 28.794999999999998 27.250000000000004 23.544999999999998 85-89 20.155 28.655 27.495000000000005 23.695 90-94 20.205000000000002 28.68 27.534999999999997 23.580000000000002 95-99 19.925 28.749999999999996 27.450000000000003 23.875 100-104 20.225 28.754999999999995 27.375 23.645 105-109 20.845 28.475 27.465 23.215 110-114 20.68 28.46 27.115000000000002 23.745 115-119 20.775 28.9 27.505000000000003 22.82 120-124 20.990000000000002 28.7 26.985 23.325000000000003 125-129 21.125 27.88 27.505000000000003 23.49 130-134 21.125 27.715 28.095 23.064999999999998 135-139 20.71 27.96 27.42 23.91 140-144 21.09 28.725 26.665 23.52 145-149 21.54 28.845 26.490000000000002 23.125 150 9.700000000000001 34.150000000000006 28.175 27.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 2.0 24 3.0 25 2.5 26 7.5 27 11.0 28 12.0 29 21.0 30 30.0 31 35.5 32 42.0 33 48.5 34 59.5 35 89.5 36 108.5 37 121.5 38 159.5 39 175.5 40 198.0 41 234.5 42 254.0 43 257.0 44 259.0 45 260.0 46 245.0 47 221.0 48 192.0 49 174.0 50 155.0 51 139.5 52 109.5 53 84.5 54 71.0 55 53.5 56 45.5 57 33.5 58 21.0 59 13.0 60 12.0 61 9.5 62 4.5 63 4.5 64 2.5 65 2.0 66 3.5 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.7875 0.0 0.0 0.0 0.0 138 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAGCA 10 0.0069772652 143.975 7 >>END_MODULE SRR3727138 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36975 34.0 31.0 34.0 30.0 34.0 2 31.5765 34.0 31.0 34.0 30.0 34.0 3 31.926 34.0 31.0 34.0 31.0 34.0 4 35.268 37.0 37.0 37.0 35.0 37.0 5 35.30275 37.0 37.0 37.0 35.0 37.0 6 35.269 37.0 37.0 37.0 35.0 37.0 7 35.302 37.0 37.0 37.0 35.0 37.0 8 35.316 37.0 37.0 37.0 35.0 37.0 9 37.1605 39.0 39.0 39.0 37.0 39.0 10-14 37.4067 39.4 39.2 39.4 36.6 39.4 15-19 38.64905 41.0 40.0 41.0 37.4 41.0 20-24 38.52165 41.0 40.0 41.0 36.8 41.0 25-29 38.133449999999996 40.8 39.0 41.0 35.4 41.0 30-34 37.7688 40.0 38.4 41.0 34.4 41.0 35-39 37.8426 40.0 38.4 41.0 34.8 41.0 40-44 37.49015 40.0 38.0 41.0 33.6 41.0 45-49 37.28535 40.0 38.0 41.0 33.0 41.0 50-54 36.73094999999999 39.4 37.4 40.2 32.4 40.8 55-59 36.7154 40.0 37.0 41.0 31.6 41.0 60-64 36.6894 39.6 36.4 41.0 32.6 41.0 65-69 35.78845 38.2 35.0 40.4 30.8 41.0 70-74 34.755250000000004 36.8 34.8 39.0 30.0 40.6 75-79 33.7268 35.6 34.6 37.2 29.8 39.0 80-84 32.904399999999995 35.0 34.0 36.0 29.0 37.2 85-89 32.58845 35.0 34.0 35.2 29.0 36.2 90-94 32.1868 35.0 34.0 35.0 28.2 35.8 95-99 31.83895 35.0 33.6 35.0 26.2 35.0 100-104 31.621100000000002 35.0 33.0 35.0 25.0 35.0 105-109 31.450350000000004 35.0 33.0 35.0 25.0 35.0 110-114 31.048899999999996 34.8 32.4 35.0 23.0 35.0 115-119 30.434450000000005 34.0 31.2 35.0 19.0 35.0 120-124 30.0245 34.0 30.8 35.0 17.6 35.0 125-129 29.265300000000003 34.0 29.4 35.0 10.4 35.0 130-134 28.8976 34.0 29.0 35.0 3.6 35.0 135-139 28.54185 33.8 29.0 35.0 2.0 35.0 140-144 28.026899999999994 33.4 28.2 35.0 2.0 35.0 145-149 26.488799999999998 32.6 25.4 34.6 2.0 35.0 150 22.76775 29.0 15.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 140.0 3 1.0 4 4.0 5 6.0 6 3.0 7 2.0 8 7.0 9 4.0 10 3.0 11 3.0 12 4.0 13 10.0 14 4.0 15 5.0 16 6.0 17 5.0 18 6.0 19 12.0 20 6.0 21 13.0 22 18.0 23 13.0 24 11.0 25 23.0 26 26.0 27 36.0 28 51.0 29 50.0 30 62.0 31 66.0 32 118.0 33 202.0 34 304.0 35 649.0 36 1245.0 37 873.0 38 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.23430857714429 15.003750937734434 16.30407601900475 31.45786446611653 2 21.725 23.7 38.2 16.375 3 20.349999999999998 25.575 31.7 22.375 4 24.375 35.55 21.099999999999998 18.975 5 23.150000000000002 36.575 21.475 18.8 6 18.15 37.8 24.15 19.900000000000002 7 17.150000000000002 14.95 45.7 22.2 8 20.875 21.05 27.700000000000003 30.375000000000004 9 23.025000000000002 23.5 28.225 25.25 10-14 22.38 28.87 26.83 21.92 15-19 22.884999999999998 27.67 27.700000000000003 21.745 20-24 23.07 28.015 27.644999999999996 21.27 25-29 22.775000000000002 27.800000000000004 27.875 21.55 30-34 22.7 27.58 28.17 21.55 35-39 23.36 27.36 27.68 21.6 40-44 22.935 27.965 27.49 21.61 45-49 23.21 27.644999999999996 27.805000000000003 21.34 50-54 22.785 27.435 28.115000000000002 21.665 55-59 22.58 27.534999999999997 28.144999999999996 21.740000000000002 60-64 22.925 27.860000000000003 27.744999999999997 21.47 65-69 23.169999999999998 27.74 27.79 21.3 70-74 22.785 27.595 28.249999999999996 21.37 75-79 22.985 27.49 28.155 21.37 80-84 23.015 27.515 28.13 21.34 85-89 22.82 27.534999999999997 28.62 21.025 90-94 23.025000000000002 27.625 28.265 21.085 95-99 22.95 28.155 28.17 20.724999999999998 100-104 23.195 27.925 28.225 20.655 105-109 23.57 28.055000000000003 27.700000000000003 20.674999999999997 110-114 23.005 28.22 27.83 20.945 115-119 23.549999999999997 26.93 28.64 20.880000000000003 120-124 23.905 28.105000000000004 27.82 20.169999999999998 125-129 23.328997398439064 27.91675005003002 27.896738042825696 20.857514508705226 130-134 23.509070862984867 27.99438709030771 27.909191139621132 20.5873509070863 135-139 23.33633994788535 29.08398476648627 27.119663259170174 20.46001202645821 140-144 23.80188490074193 28.263485061159017 27.752155604571886 20.18247443352717 145-149 23.50495842932986 28.59861765000501 27.52178703796454 20.374636882700592 150 24.3993993993994 28.178178178178175 26.5015015015015 20.92092092092092 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.5 10 1.5 11 1.5 12 1.0 13 1.0 14 1.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.0 23 3.0 24 4.0 25 5.0 26 5.0 27 4.0 28 8.5 29 12.5 30 11.0 31 15.5 32 27.0 33 35.5 34 49.0 35 52.0 36 60.5 37 98.5 38 133.0 39 165.5 40 183.0 41 184.5 42 225.5 43 269.0 44 275.0 45 281.5 46 283.5 47 262.0 48 239.5 49 217.5 50 179.5 51 151.5 52 125.0 53 93.5 54 75.5 55 59.5 56 45.0 57 34.5 58 24.0 59 17.0 60 15.0 61 12.5 62 6.5 63 6.0 64 5.5 65 3.0 66 2.0 67 1.5 68 3.0 69 3.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.06 130-134 0.22999999999999998 135-139 0.22 140-144 0.26 145-149 0.16999999999999998 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.44999999999999996 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.3250000000000002 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.8875000000000002 0.0 0.0 0.0 0.0 138 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGCCT 10 0.006973645 144.0 8 CAGCCTC 10 0.006973645 144.0 9 >>END_MODULE Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707035 spots for SRR3727138.sra Written 707035 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra Read 707027 spots for SRR3727138.sra Written 707027 spots for SRR3727138.sra SRR ids: ['SRR3727138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_le8rgoth SRR3727138.sra spots: 14140548 blocks: [[1, 707027], [707028, 1414054], [1414055, 2121081], [2121082, 2828108], [2828109, 3535135], [3535136, 4242162], [4242163, 4949189], [4949190, 5656216], [5656217, 6363243], [6363244, 7070270], [7070271, 7777297], [7777298, 8484324], [8484325, 9191351], [9191352, 9898378], [9898379, 10605405], [10605406, 11312432], [11312433, 12019459], [12019460, 12726486], [12726487, 13433513], [13433514, 14140548]] SRR3727138 file size 4742449 SRR3727138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727138 SRR3727138_1.fastq SRR3727138_2.fastq Input file: SRR3727138_1.fastq Paired file: SRR3727138_2.fastq trimmed: SRR3727138-trimmed-pair1.fastq, SRR3727138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:28:36 2025 >> started Fri Feb 14 12:28:51 2025 >> done (15.143s) 14140548 read pairs processed; of these: 70039 ( 0.50%) short read pairs filtered out after trimming by size control 391264 ( 2.77%) empty read pairs filtered out after trimming by size control 13679245 (96.74%) read pairs available; of these: 5233608 (38.26%) trimmed read pairs available after processing 8445637 (61.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 7 0.00% 21 11 0.00% 22 15 0.00% 23 24 0.00% 24 37 0.00% 25 41 0.00% 26 40 0.00% 27 37 0.00% 28 41 0.00% 29 45 0.00% 30 58 0.00% 31 52 0.00% 32 68 0.00% 33 95 0.00% 34 110 0.00% 35 125 0.00% 36 134 0.00% 37 131 0.00% 38 123 0.00% 39 167 0.00% 40 169 0.00% 41 197 0.00% 42 224 0.00% 43 226 0.00% 44 267 0.00% 45 284 0.00% 46 301 0.00% 47 299 0.00% 48 322 0.00% 49 317 0.00% 50 360 0.00% 51 369 0.00% 52 403 0.00% 53 425 0.00% 54 450 0.00% 55 485 0.00% 56 542 0.00% 57 550 0.00% 58 546 0.00% 59 616 0.00% 60 621 0.00% 61 628 0.00% 62 704 0.01% 63 775 0.01% 64 794 0.01% 65 869 0.01% 66 932 0.01% 67 949 0.01% 68 1045 0.01% 69 1132 0.01% 70 1261 0.01% 71 1317 0.01% 72 1407 0.01% 73 1589 0.01% 74 1711 0.01% 75 1932 0.01% 76 2050 0.01% 77 2206 0.02% 78 2209 0.02% 79 2461 0.02% 80 2582 0.02% 81 2696 0.02% 82 2872 0.02% 83 3403 0.02% 84 7759 0.06% 85 7690 0.06% 86 8021 0.06% 87 8363 0.06% 88 8530 0.06% 89 10096 0.07% 90 8600 0.06% 91 8843 0.06% 92 9272 0.07% 93 9936 0.07% 94 9835 0.07% 95 9945 0.07% 96 10272 0.08% 97 10530 0.08% 98 10804 0.08% 99 11315 0.08% 100 12096 0.09% 101 10389 0.08% 102 10684 0.08% 103 12053 0.09% 104 11135 0.08% 105 12510 0.09% 106 14203 0.10% 107 21520 0.16% 108 13010 0.10% 109 13664 0.10% 110 14346 0.10% 111 15439 0.11% 112 13322 0.10% 113 12906 0.09% 114 16188 0.12% 115 29790 0.22% 116 15660 0.11% 117 14102 0.10% 118 13462 0.10% 119 13675 0.10% 120 14379 0.11% 121 17170 0.13% 122 22686 0.17% 123 35100 0.26% 124 21749 0.16% 125 18831 0.14% 126 18294 0.13% 127 23388 0.17% 128 23802 0.17% 129 23612 0.17% 130 27502 0.20% 131 45734 0.33% 132 39212 0.29% 133 39116 0.29% 134 54279 0.40% 135 66379 0.49% 136 67547 0.49% 137 73760 0.54% 138 76055 0.56% 139 85492 0.62% 140 88981 0.65% 141 100647 0.74% 142 114953 0.84% 143 128070 0.94% 144 144408 1.06% 145 174800 1.28% 146 231197 1.69% 147 329771 2.41% 148 518604 3.79% 149 2121261 15.51% 150 8445637 61.74% 13679245 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=445.61 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=34.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.0 sequence=ATGTACCCAGACTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=382.46 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=29.4 sequence=GAAGAAGAAATTGAGAAACACATAAAAGACTACGCCAATCTGCTCAACCACATCGAACA SRR3727138 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:29:44 Started mapping on | Feb 14 12:29:54 Finished on | Feb 14 12:31:02 Mapping speed, Million of reads per hour | 724.20 Number of input reads | 13679245 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13140109 Uniquely mapped reads % | 96.06% Average mapped length | 292.76 Number of splices: Total | 11794249 Number of splices: Annotated (sjdb) | 11548408 Number of splices: GT/AG | 11580992 Number of splices: GC/AG | 178054 Number of splices: AT/AC | 10192 Number of splices: Non-canonical | 25011 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334710 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 44018 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.08% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 225310 225310 225310 N_multimapping 334710 334710 334710 N_noFeature 490366 12952994 586298 N_ambiguous 167091 973 75324 UnstrandedReadsAssigned:12482652 PositiveStrandReadsAssigned:186142 NegativeStrandReadsAssigned:12478487 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR3727138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727138-trimmed-pair1.fastq SRR3727138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,679,245 reads, 12,609,577 reads pseudoaligned [quant] estimated average fragment length: 251.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR3727138.ke.tsv 34699 SRR3727138.se.tsv 87100 total ==> SRR3727138.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.23 424 16.4897 Potri.005G024800.1.v4.1 1035 784.227 195 17.0896 Potri.004G059700.1.v4.1 961 710.307 66 6.38612 Potri.007G009000.2.v4.1 1416 1165.23 1 0.0589832 Potri.003G141000.2.v4.1 2943 2692.23 497 12.6877 Potri.016G087400.1.v4.1 270 74.1433 1184 1097.54 Potri.015G069301.1.v4.1 564 319.49 0 0 Potri.010G195200.1.v4.1 1773 1522.23 122 5.50832 Potri.012G127500.1.v4.1 977 726.287 3739 353.823 ==> SRR3727138.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 250 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 176 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR3727138 completed mapping pipeline successfully