Starting /dee2/code/volunteer_pipeline.sh SRR3727139 current disk space = 3113310883840 free memory = 1414643280 SRR3727139 SRAfilesize c086a0a3b354f73493d5c18fedf46bbc SRR3727139.sra SRR3727139.sra file validated SRR3727139 is paired end SRR3727139 is conventional basespace SRR3727139 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86875 34.0 31.0 34.0 31.0 34.0 2 32.4375 34.0 31.0 34.0 31.0 34.0 3 32.7735 34.0 31.0 34.0 31.0 34.0 4 36.3355 37.0 37.0 37.0 35.0 37.0 5 36.2115 37.0 37.0 37.0 35.0 37.0 6 36.20225 37.0 37.0 37.0 35.0 37.0 7 36.299 37.0 37.0 37.0 35.0 37.0 8 36.31475 37.0 37.0 37.0 35.0 37.0 9 38.02175 39.0 38.0 39.0 35.0 39.0 10-14 38.275549999999996 39.4 38.2 39.4 35.2 39.4 15-19 39.247249999999994 40.6 38.8 41.0 36.0 41.0 20-24 39.2332 40.6 39.0 41.0 35.8 41.0 25-29 38.929449999999996 40.0 38.2 41.0 35.2 41.0 30-34 38.78795 40.0 38.0 41.0 35.0 41.0 35-39 38.6265 40.0 38.0 41.0 35.0 41.0 40-44 38.4784 40.0 38.0 41.0 34.6 41.0 45-49 38.36035 40.0 38.0 41.0 34.2 41.0 50-54 38.52795 40.0 38.0 41.0 34.0 41.0 55-59 38.13195 40.0 37.6 41.0 34.0 41.0 60-64 37.593900000000005 39.2 36.4 41.0 33.4 41.0 65-69 36.8604 38.2 35.4 40.0 32.0 41.0 70-74 35.70289999999999 36.6 34.6 39.0 30.8 40.6 75-79 34.392999999999994 35.2 33.8 37.2 30.0 39.0 80-84 34.09725 35.0 34.0 36.2 30.6 37.6 85-89 33.404 35.0 34.0 35.2 29.8 36.2 90-94 32.89545 35.0 33.2 35.0 29.0 35.6 95-99 32.47835 34.8 32.8 35.0 28.4 35.0 100-104 32.1012 34.2 32.2 35.0 26.6 35.0 105-109 32.04205 34.0 32.2 35.0 26.2 35.0 110-114 31.690350000000002 34.0 32.0 35.0 25.0 35.0 115-119 31.294150000000002 34.0 31.6 35.0 24.4 35.0 120-124 30.37485 34.0 30.4 35.0 21.4 35.0 125-129 29.83415 34.0 29.2 35.0 18.2 35.0 130-134 28.313049999999997 33.2 27.4 35.0 7.6 35.0 135-139 28.127050000000004 33.0 27.4 34.4 5.0 35.0 140-144 26.5118 32.2 24.0 34.0 2.0 35.0 145-149 20.91075 28.4 3.0 34.0 2.0 35.0 150 14.49475 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 3.0 9 3.0 10 1.0 11 4.0 12 7.0 13 11.0 14 5.0 15 6.0 16 8.0 17 5.0 18 9.0 19 13.0 20 12.0 21 20.0 22 21.0 23 29.0 24 23.0 25 23.0 26 38.0 27 66.0 28 73.0 29 71.0 30 106.0 31 176.0 32 207.0 33 300.0 34 433.0 35 768.0 36 1067.0 37 489.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.957699251998967 19.834923910239876 11.81325767345886 36.394119164302296 2 19.2 27.325 37.8 15.675 3 15.975 30.45 27.55 26.025 4 20.849999999999998 37.425000000000004 21.675 20.05 5 19.3 38.375 23.425 18.9 6 15.925 35.875 26.05 22.15 7 12.15 19.55 45.675 22.625 8 17.9 21.2 27.825 33.074999999999996 9 17.549999999999997 21.65 30.4 30.4 10-14 19.830000000000002 29.64 26.224999999999998 24.305 15-19 19.675 29.07 27.375 23.880000000000003 20-24 19.785 28.785 27.595 23.835 25-29 19.580000000000002 29.285 27.224999999999998 23.91 30-34 19.86 28.57 27.825 23.745 35-39 19.295 29.48 27.805000000000003 23.419999999999998 40-44 19.759999999999998 28.83 27.169999999999998 24.240000000000002 45-49 19.695 28.744999999999997 27.685 23.875 50-54 20.185 28.565 27.439999999999998 23.810000000000002 55-59 20.169999999999998 27.950000000000003 27.555000000000003 24.325 60-64 20.365 28.435 27.500000000000004 23.7 65-69 19.55 28.975 27.950000000000003 23.525 70-74 20.405 28.125 28.299999999999997 23.169999999999998 75-79 20.455000000000002 28.485 27.439999999999998 23.62 80-84 19.919999999999998 28.595 27.495000000000005 23.990000000000002 85-89 20.855 28.634999999999998 27.41 23.1 90-94 20.330000000000002 28.349999999999998 27.439999999999998 23.880000000000003 95-99 20.19903980796159 28.110622124424882 28.21564312862572 23.4746949389878 100-104 20.34 27.88 27.894999999999996 23.885 105-109 20.549999999999997 28.64 27.029999999999998 23.78 110-114 20.54 28.395 27.505000000000003 23.56 115-119 20.91 28.57 27.005000000000003 23.515 120-124 20.27 28.38 27.215 24.135 125-129 20.674999999999997 28.13 27.67 23.525 130-134 19.465 28.395 27.985 24.154999999999998 135-139 20.24702470247025 27.987798779877988 27.647764776477647 24.117411741174116 140-144 19.605 28.84 27.865000000000002 23.69 145-149 17.854999999999997 29.235 27.815 25.095 150 7.425 33.800000000000004 29.125 29.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 3.5 26 5.5 27 7.0 28 9.0 29 14.5 30 17.0 31 25.5 32 41.0 33 51.0 34 59.5 35 79.0 36 107.0 37 124.0 38 143.0 39 169.0 40 198.0 41 211.0 42 225.5 43 269.0 44 271.5 45 260.0 46 258.5 47 247.5 48 223.5 49 204.0 50 171.0 51 130.0 52 118.0 53 89.5 54 64.0 55 49.0 56 35.0 57 29.5 58 23.5 59 18.5 60 14.5 61 6.5 62 4.0 63 4.5 64 3.0 65 1.5 66 1.5 67 1.0 68 2.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.025 0.0 104-105 0.23750000000000002 0.0 0.0 0.025 0.0 106-107 0.3375 0.0 0.0 0.025 0.0 108-109 0.4125 0.0 0.0 0.025 0.0 110-111 0.48750000000000004 0.0 0.0 0.025 0.0 112-113 0.6625 0.0 0.0 0.025 0.0 114-115 0.75 0.0 0.0 0.025 0.0 116-117 0.85 0.0 0.0 0.025 0.0 118-119 0.9125 0.0 0.0 0.025 0.0 120-121 1.0875 0.0 0.0 0.025 0.0 122-123 1.25 0.0 0.0 0.025 0.0 124-125 1.4125 0.0 0.0 0.025 0.0 126-127 1.5875 0.0 0.0 0.025 0.0 128-129 1.7375 0.0 0.0 0.025 0.0 130-131 1.9500000000000002 0.0 0.0 0.025 0.0 132-133 2.0999999999999996 0.0 0.0 0.025 0.0 134-135 2.2875 0.0 0.0 0.025 0.0 136-137 2.4875 0.0 0.0 0.025 0.0 138 2.7 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR3727139 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47475 33.0 31.0 34.0 30.0 34.0 2 31.498 34.0 31.0 34.0 30.0 34.0 3 31.62225 34.0 31.0 34.0 30.0 34.0 4 35.0835 37.0 35.0 37.0 33.0 37.0 5 35.0845 37.0 35.0 37.0 33.0 37.0 6 35.129 37.0 35.0 37.0 33.0 37.0 7 35.1985 37.0 36.0 37.0 35.0 37.0 8 35.09225 37.0 35.0 37.0 33.0 37.0 9 36.758 39.0 38.0 39.0 34.0 39.0 10-14 36.919 39.4 37.4 39.4 33.4 39.4 15-19 37.91515 40.0 38.2 41.0 33.2 41.0 20-24 37.895399999999995 40.0 38.6 41.0 33.8 41.0 25-29 37.4538 40.0 38.0 41.0 32.4 41.0 30-34 37.44925 40.0 38.0 41.0 32.6 41.0 35-39 37.1183 40.0 38.0 41.0 31.6 41.0 40-44 36.872949999999996 40.0 37.4 41.0 31.0 41.0 45-49 36.363 39.2 36.6 40.6 30.2 41.0 50-54 35.94675 38.8 35.8 40.0 29.8 40.6 55-59 36.065250000000006 39.0 36.0 40.4 29.4 41.0 60-64 35.92535 38.8 35.4 40.8 29.8 41.0 65-69 35.117900000000006 37.4 34.8 39.8 28.4 41.0 70-74 34.03744999999999 36.0 34.0 38.8 27.8 40.4 75-79 33.1632 35.0 34.0 36.8 27.0 38.8 80-84 32.2791 35.0 33.4 35.6 26.2 37.0 85-89 31.708299999999998 35.0 33.0 35.0 25.6 36.0 90-94 31.1638 34.6 32.2 35.0 24.0 35.4 95-99 30.833799999999997 34.0 32.0 35.0 22.4 35.0 100-104 30.58155 34.0 31.2 35.0 20.4 35.0 105-109 30.251300000000004 34.0 31.0 35.0 18.2 35.0 110-114 29.841950000000004 34.0 30.6 35.0 15.0 35.0 115-119 29.403750000000002 34.0 29.6 35.0 9.2 35.0 120-124 28.89825 34.0 29.0 35.0 6.0 35.0 125-129 28.32915 33.2 28.6 35.0 2.0 35.0 130-134 27.64275 33.0 26.6 34.8 2.0 35.0 135-139 26.3821 31.8 24.6 34.0 2.0 35.0 140-144 25.48675 31.6 22.2 34.0 2.0 35.0 145-149 23.18705 30.6 5.2 34.0 2.0 35.0 150 19.66525 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 109.0 3 9.0 4 7.0 5 7.0 6 3.0 7 5.0 8 5.0 9 12.0 10 6.0 11 8.0 12 10.0 13 9.0 14 5.0 15 13.0 16 19.0 17 17.0 18 16.0 19 16.0 20 16.0 21 21.0 22 15.0 23 28.0 24 31.0 25 40.0 26 37.0 27 57.0 28 73.0 29 79.0 30 103.0 31 143.0 32 190.0 33 272.0 34 379.0 35 632.0 36 1080.0 37 526.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 13.750000000000002 12.775 35.175 2 22.425 23.525 37.05 17.0 3 21.075 26.025 30.775000000000002 22.125 4 24.7 36.7 19.35 19.25 5 23.775 37.075 20.8 18.35 6 17.9 37.75 24.625 19.725 7 17.05 15.6 45.95 21.4 8 20.424999999999997 20.674999999999997 27.875 31.025000000000002 9 23.175 23.724999999999998 27.525 25.575 10-14 22.813422013301995 28.90433565034755 26.19892983947592 22.08331249687453 15-19 23.265 27.615000000000002 27.689999999999998 21.43 20-24 22.575 28.134999999999998 28.060000000000002 21.23 25-29 22.955000000000002 28.34 27.810000000000002 20.895 30-34 22.665 28.18 27.565 21.59 35-39 23.055 28.685 27.189999999999998 21.07 40-44 23.765 28.15 27.145000000000003 20.94 45-49 23.35 27.415 28.59 20.645 50-54 23.328499274891236 27.69415412311847 27.86417962694404 21.11316697504626 55-59 23.385523485568505 27.752488619878946 28.43779700865389 20.424190885898653 60-64 23.895973993498373 27.696924231057764 27.206801700425103 21.200300075018756 65-69 23.544999999999998 28.025 27.834999999999997 20.595 70-74 23.52705811743523 27.91337401220366 28.078423527058117 20.48114434330299 75-79 23.753313659780922 28.114840194067924 27.689691391987196 20.44215475416396 80-84 23.747124137241173 27.568270481144342 27.95838751625488 20.726217865359608 85-89 23.718557783667553 28.164224633695056 27.804170625593837 20.313046957043557 90-94 23.197398048536403 27.140355266449838 28.7215411558669 20.94070552914686 95-99 23.340171111222293 27.97818582078351 27.84309801370891 20.838545054285284 100-104 23.7 27.985 27.85 20.465 105-109 23.82857428614292 28.064209631444715 27.539130869630448 20.568085212781916 110-114 23.86670669468628 27.46422495747023 27.93955769038327 20.729510657460224 115-119 23.369999999999997 27.495000000000005 28.315 20.82 120-124 24.025 27.810000000000002 28.12 20.044999999999998 125-129 24.19862979446917 27.559133870080508 27.89418412761914 20.348052207831174 130-134 24.138449208575434 27.54458024443999 28.200761370466843 20.11620917651773 135-139 23.88239426019768 28.101951733480508 27.695549646279666 20.320104360042144 140-144 24.256258465860633 28.04896402949882 27.44193046706467 20.25284703757588 145-149 24.315102860010036 28.46462619167085 27.235323632714504 19.984947315604614 150 23.92235946559113 27.82959415175195 27.07335518023696 21.174691202419964 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 4.0 24 5.0 25 3.5 26 5.5 27 6.0 28 5.5 29 6.0 30 10.5 31 21.5 32 28.0 33 34.5 34 40.0 35 57.5 36 83.0 37 92.5 38 114.0 39 145.5 40 188.0 41 235.5 42 257.0 43 252.0 44 266.0 45 282.0 46 275.5 47 254.5 48 236.0 49 216.0 50 175.0 51 144.0 52 123.0 53 102.0 54 82.0 55 65.0 56 46.5 57 28.0 58 20.0 59 16.0 60 12.5 61 12.0 62 10.5 63 8.0 64 6.0 65 5.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 1.0 72 2.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.045 60-64 0.025 65-69 0.0 70-74 0.03 75-79 0.034999999999999996 80-84 0.03 85-89 0.015 90-94 0.075 95-99 0.065 100-104 0.0 105-109 0.015 110-114 0.06999999999999999 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.18 135-139 0.345 140-144 0.335 145-149 0.35000000000000003 150 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.3625 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138 3.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302876 spots for SRR3727139.sra Written 1302876 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra Read 1302857 spots for SRR3727139.sra Written 1302857 spots for SRR3727139.sra SRR ids: ['SRR3727139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b7a6wbl5 SRR3727139.sra spots: 26057159 blocks: [[1, 1302857], [1302858, 2605714], [2605715, 3908571], [3908572, 5211428], [5211429, 6514285], [6514286, 7817142], [7817143, 9119999], [9120000, 10422856], [10422857, 11725713], [11725714, 13028570], [13028571, 14331427], [14331428, 15634284], [15634285, 16937141], [16937142, 18239998], [18239999, 19542855], [19542856, 20845712], [20845713, 22148569], [22148570, 23451426], [23451427, 24754283], [24754284, 26057159]] SRR3727139 file size 8757322 SRR3727139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727139 SRR3727139_1.fastq SRR3727139_2.fastq Input file: SRR3727139_1.fastq Paired file: SRR3727139_2.fastq trimmed: SRR3727139-trimmed-pair1.fastq, SRR3727139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:57:57 2025 >> started Fri Feb 14 11:58:35 2025 >> done (38.017s) 26057159 read pairs processed; of these: 148198 ( 0.57%) short read pairs filtered out after trimming by size control 617132 ( 2.37%) empty read pairs filtered out after trimming by size control 25291829 (97.06%) read pairs available; of these: 13239480 (52.35%) trimmed read pairs available after processing 12052349 (47.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 7 0.00% 21 24 0.00% 22 28 0.00% 23 53 0.00% 24 76 0.00% 25 84 0.00% 26 121 0.00% 27 136 0.00% 28 128 0.00% 29 175 0.00% 30 224 0.00% 31 301 0.00% 32 327 0.00% 33 357 0.00% 34 420 0.00% 35 476 0.00% 36 560 0.00% 37 645 0.00% 38 750 0.00% 39 810 0.00% 40 891 0.00% 41 965 0.00% 42 1079 0.00% 43 1188 0.00% 44 1253 0.00% 45 1432 0.01% 46 1609 0.01% 47 1632 0.01% 48 1797 0.01% 49 1843 0.01% 50 2028 0.01% 51 2260 0.01% 52 2331 0.01% 53 2441 0.01% 54 2611 0.01% 55 2760 0.01% 56 2912 0.01% 57 3085 0.01% 58 3228 0.01% 59 3502 0.01% 60 3596 0.01% 61 3862 0.02% 62 4217 0.02% 63 4382 0.02% 64 4570 0.02% 65 4912 0.02% 66 5001 0.02% 67 5335 0.02% 68 5752 0.02% 69 5995 0.02% 70 6485 0.03% 71 6782 0.03% 72 7136 0.03% 73 7653 0.03% 74 8283 0.03% 75 8579 0.03% 76 9342 0.04% 77 9942 0.04% 78 10586 0.04% 79 11513 0.05% 80 12262 0.05% 81 13074 0.05% 82 13850 0.05% 83 15187 0.06% 84 21661 0.09% 85 22285 0.09% 86 23009 0.09% 87 23823 0.09% 88 24652 0.10% 89 26125 0.10% 90 27460 0.11% 91 27885 0.11% 92 29487 0.12% 93 29594 0.12% 94 31315 0.12% 95 32580 0.13% 96 33423 0.13% 97 35415 0.14% 98 34284 0.14% 99 35834 0.14% 100 36976 0.15% 101 38167 0.15% 102 39806 0.16% 103 38784 0.15% 104 41464 0.16% 105 42782 0.17% 106 47486 0.19% 107 50951 0.20% 108 51298 0.20% 109 54473 0.22% 110 52529 0.21% 111 57026 0.23% 112 55486 0.22% 113 56902 0.22% 114 58310 0.23% 115 68875 0.27% 116 62644 0.25% 117 64154 0.25% 118 65403 0.26% 119 67218 0.27% 120 71924 0.28% 121 74096 0.29% 122 72461 0.29% 123 73555 0.29% 124 81755 0.32% 125 86583 0.34% 126 90010 0.36% 127 92718 0.37% 128 96994 0.38% 129 105146 0.42% 130 113353 0.45% 131 121961 0.48% 132 131429 0.52% 133 141200 0.56% 134 152794 0.60% 135 164422 0.65% 136 176710 0.70% 137 193202 0.76% 138 211012 0.83% 139 234553 0.93% 140 253828 1.00% 141 284460 1.12% 142 320175 1.27% 143 372240 1.47% 144 444390 1.76% 145 547586 2.17% 146 720733 2.85% 147 992491 3.92% 148 1474759 5.83% 149 3598519 14.23% 150 12052349 47.65% 25291829 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=9.47 fanout-score-rank=5 prefix-density=0.30 prefix-fanout=5.4 sequence=AAAGCAACAGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=377.03 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=36.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=2.9 sequence=CAAATTGAGAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=82.42 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=17.3 sequence=CAGCAGCAGCAA SRR3727139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:59:31 Started mapping on | Feb 14 11:59:31 Finished on | Feb 14 12:04:17 Mapping speed, Million of reads per hour | 318.36 Number of input reads | 25291829 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 24036308 Uniquely mapped reads % | 95.04% Average mapped length | 287.31 Number of splices: Total | 23229239 Number of splices: Annotated (sjdb) | 22812917 Number of splices: GT/AG | 22812759 Number of splices: GC/AG | 353889 Number of splices: AT/AC | 19475 Number of splices: Non-canonical | 43116 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 762642 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 67514 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.60% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 523888 523888 523888 N_multimapping 762642 762642 762642 N_noFeature 650668 23768795 782114 N_ambiguous 257354 1283 120498 UnstrandedReadsAssigned:23128286 PositiveStrandReadsAssigned:266230 NegativeStrandReadsAssigned:23133696 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR3727139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727139-trimmed-pair1.fastq SRR3727139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,291,829 reads, 23,498,047 reads pseudoaligned [quant] estimated average fragment length: 248.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR3727139.ke.tsv 34699 SRR3727139.se.tsv 87100 total ==> SRR3727139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.76 615 12.1397 Potri.005G024800.1.v4.1 1035 787.755 93 4.12653 Potri.004G059700.1.v4.1 961 713.778 81 3.96657 Potri.007G009000.2.v4.1 1416 1168.76 7 0.209347 Potri.003G141000.2.v4.1 2943 2695.76 685 8.88184 Potri.016G087400.1.v4.1 270 73.0004 2335.06 1118.06 Potri.015G069301.1.v4.1 564 320.869 0 0 Potri.010G195200.1.v4.1 1773 1525.76 15 0.343637 Potri.012G127500.1.v4.1 977 729.767 5682 272.151 ==> SRR3727139.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 467 Potri.001G212900.v4.1 31 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 563 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3727139 completed mapping pipeline successfully