Starting /dee2/code/volunteer_pipeline.sh SRR3727140 current disk space = 3113146073088 free memory = 1448895632 SRR3727140 SRAfilesize f8c049e02fd98c669d99182d9681255f SRR3727140.sra SRR3727140.sra file validated SRR3727140 is paired end SRR3727140 is conventional basespace SRR3727140 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9975 34.0 31.0 34.0 31.0 34.0 2 32.338 34.0 31.0 34.0 30.0 34.0 3 32.75525 34.0 31.0 34.0 31.0 34.0 4 36.265 37.0 37.0 37.0 35.0 37.0 5 36.14725 37.0 37.0 37.0 35.0 37.0 6 35.5025 37.0 35.0 37.0 33.0 37.0 7 36.06475 37.0 35.0 37.0 35.0 37.0 8 36.18775 37.0 36.0 37.0 35.0 37.0 9 37.92875 39.0 38.0 39.0 35.0 39.0 10-14 38.27570000000001 39.4 38.2 39.4 35.2 39.4 15-19 39.1678 40.4 38.6 41.0 35.8 41.0 20-24 39.1657 40.4 39.0 41.0 35.8 41.0 25-29 38.75985 40.0 38.0 41.0 34.6 41.0 30-34 38.82340000000001 40.0 38.0 41.0 35.0 41.0 35-39 38.1745 40.0 37.8 41.0 33.6 41.0 40-44 38.317150000000005 40.0 38.0 41.0 33.6 41.0 45-49 38.600649999999995 40.0 38.0 41.0 34.6 41.0 50-54 38.155899999999995 40.0 37.6 41.0 33.4 41.0 55-59 37.999249999999996 40.0 37.2 41.0 33.2 41.0 60-64 37.1897 39.0 36.2 41.0 31.8 41.0 65-69 36.72234999999999 38.4 35.2 40.2 31.6 41.0 70-74 35.67695 36.8 34.8 39.0 30.8 40.6 75-79 34.29025 35.2 33.6 37.2 29.6 39.0 80-84 33.844500000000004 35.0 34.0 36.2 29.6 37.4 85-89 33.037049999999994 35.0 33.4 35.2 29.0 36.2 90-94 32.82735 35.0 33.0 35.0 29.0 35.8 95-99 32.41955 35.0 33.0 35.0 28.4 35.0 100-104 32.212849999999996 34.8 32.8 35.0 27.4 35.0 105-109 31.484699999999997 34.0 31.6 35.0 24.4 35.0 110-114 31.589199999999998 34.0 32.0 35.0 25.0 35.0 115-119 31.43365 34.0 32.0 35.0 25.0 35.0 120-124 31.095800000000004 34.0 31.2 35.0 24.4 35.0 125-129 30.2472 34.0 30.2 35.0 20.0 35.0 130-134 29.321800000000003 33.4 29.6 35.0 12.8 35.0 135-139 26.785149999999998 32.4 24.0 34.4 2.6 35.0 140-144 25.682299999999998 32.0 19.6 34.0 2.0 35.0 145-149 20.20015 27.8 2.0 34.0 2.0 35.0 150 15.032 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 6.0 9 1.0 10 3.0 11 5.0 12 7.0 13 7.0 14 10.0 15 8.0 16 8.0 17 10.0 18 11.0 19 16.0 20 8.0 21 14.0 22 21.0 23 25.0 24 33.0 25 40.0 26 46.0 27 52.0 28 80.0 29 82.0 30 94.0 31 197.0 32 197.0 33 309.0 34 456.0 35 719.0 36 989.0 37 540.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.333759918095723 18.044535449193756 14.998720245712823 38.62298438699769 2 17.4 28.775000000000002 38.25 15.575 3 16.775000000000002 31.05 27.450000000000003 24.725 4 20.200000000000003 38.15 20.775 20.875 5 19.85 40.35 22.225 17.575 6 17.05 36.7 25.575 20.674999999999997 7 12.975 18.925 45.45 22.650000000000002 8 18.475 20.474999999999998 28.999999999999996 32.05 9 18.275 22.05 29.9 29.775000000000002 10-14 19.3 30.945 25.919999999999998 23.835 15-19 19.585 29.695 27.189999999999998 23.53 20-24 19.495 29.74 27.284999999999997 23.48 25-29 19.365 29.555 27.455000000000002 23.625 30-34 19.666966696669665 29.432943294329434 28.28782878287829 22.612261226122612 35-39 20.125 29.154999999999998 27.505000000000003 23.215 40-44 20.04 29.549999999999997 27.175 23.235 45-49 20.47 28.655 27.595 23.28 50-54 20.405 29.2 27.105 23.29 55-59 20.625 29.065 27.35 22.96 60-64 20.32 28.925 27.455000000000002 23.3 65-69 20.599999999999998 28.965000000000003 27.295 23.14 70-74 20.055 29.17 27.13 23.645 75-79 20.775 28.65 26.91 23.665 80-84 20.225 28.810000000000002 27.175 23.79 85-89 20.54 28.875 27.045 23.54 90-94 20.580000000000002 28.549999999999997 27.315 23.555 95-99 21.07 28.720000000000002 26.945000000000004 23.265 100-104 20.1 28.825 27.36 23.715 105-109 20.82 28.845 27.21 23.125 110-114 20.76226679337768 28.68503976391737 26.63932376331716 23.913369679387785 115-119 20.678101715257288 28.489273391008652 26.834025103765562 23.998599789968495 120-124 20.4 28.804999999999996 27.439999999999998 23.355 125-129 20.505000000000003 27.955000000000002 27.83 23.71 130-134 20.51 28.505000000000003 27.339999999999996 23.645 135-139 19.46 28.82 27.334999999999997 24.385 140-144 19.625 29.065 27.134999999999998 24.175 145-149 17.635 29.599999999999998 27.029999999999998 25.735000000000003 150 6.875000000000001 33.025 29.299999999999997 30.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 2.0 21 1.5 22 0.5 23 1.0 24 3.5 25 8.0 26 8.5 27 11.0 28 18.5 29 24.0 30 32.5 31 38.0 32 39.0 33 53.5 34 65.5 35 79.0 36 105.0 37 129.5 38 159.0 39 178.5 40 184.0 41 215.0 42 242.5 43 241.0 44 250.0 45 252.0 46 233.0 47 224.0 48 215.0 49 187.0 50 162.0 51 135.5 52 115.0 53 93.0 54 60.5 55 46.0 56 42.0 57 39.0 58 31.0 59 21.0 60 12.5 61 7.5 62 7.5 63 5.5 64 4.5 65 3.0 66 2.5 67 1.5 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.034999999999999996 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.425 0.0 0.0 0.0 0.0 138 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGCCC 10 0.0069772652 143.975 7 >>END_MODULE SRR3727140 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28575 33.0 31.0 34.0 28.0 34.0 2 31.67575 34.0 31.0 34.0 30.0 34.0 3 31.87325 34.0 31.0 34.0 30.0 34.0 4 35.23425 37.0 35.0 37.0 33.0 37.0 5 35.29375 37.0 35.0 37.0 33.0 37.0 6 35.35475 37.0 35.0 37.0 35.0 37.0 7 35.3315 37.0 35.0 37.0 33.0 37.0 8 35.4275 37.0 36.0 37.0 35.0 37.0 9 37.0865 39.0 38.0 39.0 35.0 39.0 10-14 37.2077 39.2 37.6 39.4 34.4 39.4 15-19 38.09140000000001 40.2 38.2 41.0 33.8 41.0 20-24 38.2022 40.0 38.6 41.0 34.2 41.0 25-29 37.878150000000005 40.0 38.0 41.0 33.4 41.0 30-34 37.7467 40.0 38.0 41.0 33.0 41.0 35-39 37.617000000000004 40.0 38.0 41.0 32.8 41.0 40-44 37.2059 40.0 37.6 41.0 32.2 41.0 45-49 36.88265 40.0 37.0 41.0 31.0 41.0 50-54 36.31535 39.0 36.0 40.0 30.4 40.6 55-59 36.31755 39.0 36.0 40.0 30.4 41.0 60-64 36.38765 39.0 35.8 41.0 31.0 41.0 65-69 35.62495 37.8 35.0 40.0 30.4 41.0 70-74 34.653299999999994 36.4 34.6 38.8 29.4 40.6 75-79 33.639950000000006 35.2 34.0 37.0 29.0 39.0 80-84 32.52345 35.0 33.2 35.8 26.8 37.0 85-89 32.0556 35.0 33.0 35.0 26.0 36.0 90-94 31.690700000000003 35.0 32.6 35.0 25.6 35.2 95-99 31.176700000000004 34.2 32.0 35.0 24.2 35.0 100-104 31.0733 34.0 32.0 35.0 23.8 35.0 105-109 30.8976 34.0 31.6 35.0 23.2 35.0 110-114 30.363850000000003 34.0 30.8 35.0 19.2 35.0 115-119 29.76245 34.0 29.8 35.0 17.4 35.0 120-124 29.449449999999995 34.0 29.4 35.0 13.4 35.0 125-129 28.840600000000002 33.8 28.6 35.0 6.8 35.0 130-134 28.1822 33.0 27.8 35.0 2.0 35.0 135-139 27.60025 32.8 26.2 34.4 2.0 35.0 140-144 26.616149999999998 32.0 25.0 34.0 2.0 35.0 145-149 24.55155 31.0 15.6 34.0 2.0 35.0 150 21.09125 27.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 81.0 3 10.0 4 5.0 5 5.0 6 4.0 7 6.0 8 7.0 9 3.0 10 7.0 11 8.0 12 7.0 13 3.0 14 9.0 15 13.0 16 15.0 17 16.0 18 10.0 19 15.0 20 17.0 21 17.0 22 15.0 23 20.0 24 33.0 25 44.0 26 40.0 27 40.0 28 72.0 29 84.0 30 114.0 31 119.0 32 182.0 33 227.0 34 362.0 35 636.0 36 1155.0 37 597.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.650000000000006 13.325000000000001 15.7 37.325 2 23.150000000000002 21.975 39.900000000000006 14.975 3 21.375 23.575 32.074999999999996 22.975 4 25.624999999999996 34.65 19.55 20.175 5 24.474999999999998 36.1 21.925 17.5 6 17.599999999999998 35.8 25.4 21.2 7 16.575 15.65 45.7 22.075 8 20.724999999999998 20.424999999999997 26.950000000000003 31.900000000000002 9 21.6 22.925 29.025000000000002 26.450000000000003 10-14 23.080000000000002 28.335 26.815 21.77 15-19 22.67 27.66 28.075 21.595 20-24 22.814999999999998 27.425 27.685 22.075 25-29 23.43 28.299999999999997 27.345000000000002 20.925 30-34 22.455 27.32 28.49 21.735 35-39 23.255 27.405 27.93 21.41 40-44 23.294999999999998 27.544999999999998 27.915 21.245 45-49 23.535 27.750000000000004 27.54 21.175 50-54 23.225 27.735 27.815 21.224999999999998 55-59 23.27 27.48 27.83 21.42 60-64 23.315 26.974999999999998 28.444999999999997 21.265 65-69 23.205000000000002 27.68 27.834999999999997 21.279999999999998 70-74 23.150000000000002 27.575 27.85 21.425 75-79 23.005 27.365000000000002 28.095 21.535 80-84 23.544999999999998 27.33 28.139999999999997 20.985 85-89 23.735 27.29 27.815 21.16 90-94 23.255 27.055 28.444999999999997 21.245 95-99 23.24 27.279999999999998 28.4 21.08 100-104 23.080000000000002 27.775 28.33 20.815 105-109 23.955000000000002 26.790000000000003 28.444999999999997 20.810000000000002 110-114 23.62 27.295 28.315 20.77 115-119 23.150000000000002 27.655 27.99 21.205 120-124 23.77 27.22 28.249999999999996 20.76 125-129 24.26 27.575 28.134999999999998 20.03 130-134 23.380000000000003 27.435 28.294999999999998 20.89 135-139 24.215 26.729999999999997 28.725 20.330000000000002 140-144 24.75 27.195000000000004 27.589999999999996 20.465 145-149 24.735 26.83 27.634999999999998 20.8 150 24.325 26.924999999999997 27.725 21.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 2.0 22 2.0 23 1.0 24 2.0 25 2.0 26 4.0 27 7.0 28 7.0 29 10.0 30 17.0 31 22.5 32 24.5 33 32.0 34 45.5 35 55.0 36 70.5 37 101.5 38 127.0 39 159.5 40 195.5 41 209.5 42 218.0 43 253.0 44 257.5 45 233.0 46 254.5 47 262.0 48 240.5 49 223.0 50 183.0 51 148.5 52 126.0 53 109.5 54 94.5 55 64.0 56 49.5 57 39.5 58 30.0 59 28.0 60 26.0 61 19.5 62 12.0 63 8.0 64 5.5 65 3.0 66 2.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.5125 0.0 0.0 0.0 0.0 136-137 5.0125 0.0 0.0 0.0 0.0 138 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGCGG 10 0.006973645 144.0 2 TTTACAT 10 0.006973645 144.0 7 >>END_MODULE Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022662 spots for SRR3727140.sra Written 1022662 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra Read 1022660 spots for SRR3727140.sra Written 1022660 spots for SRR3727140.sra SRR ids: ['SRR3727140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_za_s5oz9 SRR3727140.sra spots: 20453202 blocks: [[1, 1022660], [1022661, 2045320], [2045321, 3067980], [3067981, 4090640], [4090641, 5113300], [5113301, 6135960], [6135961, 7158620], [7158621, 8181280], [8181281, 9203940], [9203941, 10226600], [10226601, 11249260], [11249261, 12271920], [12271921, 13294580], [13294581, 14317240], [14317241, 15339900], [15339901, 16362560], [16362561, 17385220], [17385221, 18407880], [18407881, 19430540], [19430541, 20453202]] SRR3727140 file size 6869271 SRR3727140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727140 SRR3727140_1.fastq SRR3727140_2.fastq Input file: SRR3727140_1.fastq Paired file: SRR3727140_2.fastq trimmed: SRR3727140-trimmed-pair1.fastq, SRR3727140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:57:19 2025 >> started Fri Feb 14 11:57:53 2025 >> done (33.868s) 20453202 read pairs processed; of these: 100380 ( 0.49%) short read pairs filtered out after trimming by size control 401493 ( 1.96%) empty read pairs filtered out after trimming by size control 19951329 (97.55%) read pairs available; of these: 9258868 (46.41%) trimmed read pairs available after processing 10692461 (53.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 14 0.00% 21 19 0.00% 22 30 0.00% 23 40 0.00% 24 56 0.00% 25 71 0.00% 26 85 0.00% 27 121 0.00% 28 148 0.00% 29 157 0.00% 30 198 0.00% 31 192 0.00% 32 247 0.00% 33 294 0.00% 34 342 0.00% 35 381 0.00% 36 406 0.00% 37 471 0.00% 38 479 0.00% 39 585 0.00% 40 613 0.00% 41 755 0.00% 42 822 0.00% 43 854 0.00% 44 945 0.00% 45 1012 0.01% 46 1076 0.01% 47 1155 0.01% 48 1260 0.01% 49 1301 0.01% 50 1369 0.01% 51 1487 0.01% 52 1578 0.01% 53 1620 0.01% 54 1713 0.01% 55 1798 0.01% 56 1973 0.01% 57 2015 0.01% 58 2101 0.01% 59 2211 0.01% 60 2274 0.01% 61 2522 0.01% 62 2563 0.01% 63 2684 0.01% 64 2956 0.01% 65 2986 0.01% 66 3160 0.02% 67 3370 0.02% 68 3529 0.02% 69 3765 0.02% 70 3947 0.02% 71 4271 0.02% 72 4501 0.02% 73 4777 0.02% 74 5274 0.03% 75 5349 0.03% 76 5806 0.03% 77 6303 0.03% 78 6693 0.03% 79 7068 0.04% 80 7587 0.04% 81 8066 0.04% 82 8745 0.04% 83 9564 0.05% 84 14875 0.07% 85 15547 0.08% 86 16259 0.08% 87 16874 0.08% 88 17166 0.09% 89 18145 0.09% 90 19811 0.10% 91 22657 0.11% 92 22749 0.11% 93 22261 0.11% 94 22263 0.11% 95 24874 0.12% 96 26216 0.13% 97 29792 0.15% 98 33489 0.17% 99 28328 0.14% 100 26153 0.13% 101 27285 0.14% 102 29199 0.15% 103 29415 0.15% 104 32750 0.16% 105 41513 0.21% 106 34800 0.17% 107 43241 0.22% 108 39937 0.20% 109 42719 0.21% 110 38974 0.20% 111 36175 0.18% 112 34657 0.17% 113 38630 0.19% 114 48981 0.25% 115 61624 0.31% 116 54655 0.27% 117 46862 0.23% 118 47582 0.24% 119 41805 0.21% 120 41957 0.21% 121 44824 0.22% 122 58622 0.29% 123 58993 0.30% 124 55922 0.28% 125 63068 0.32% 126 64549 0.32% 127 68204 0.34% 128 73187 0.37% 129 80863 0.41% 130 82672 0.41% 131 85171 0.43% 132 96388 0.48% 133 108170 0.54% 134 114147 0.57% 135 118457 0.59% 136 127127 0.64% 137 135258 0.68% 138 143639 0.72% 139 153180 0.77% 140 162508 0.81% 141 178414 0.89% 142 200856 1.01% 143 228107 1.14% 144 270982 1.36% 145 330706 1.66% 146 425745 2.13% 147 602733 3.02% 148 906156 4.54% 149 2880234 14.44% 150 10692461 53.59% 19951329 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.4 sequence=AACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=21.53 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.9 sequence=CACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGAACCGAGTCAACAATGTGTGCTTCACAAGCTTTGGAGTTCTGGTTGCCATGTCTTCTCTTTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=43 prefix-density=0.21 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=92.08 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.0 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCT SRR3727140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:58:45 Started mapping on | Feb 14 11:58:45 Finished on | Feb 14 12:00:59 Mapping speed, Million of reads per hour | 536.01 Number of input reads | 19951329 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19000509 Uniquely mapped reads % | 95.23% Average mapped length | 288.51 Number of splices: Total | 16403208 Number of splices: Annotated (sjdb) | 16097889 Number of splices: GT/AG | 16097709 Number of splices: GC/AG | 257128 Number of splices: AT/AC | 11329 Number of splices: Non-canonical | 37042 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 596031 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 65223 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378583 378583 378583 N_multimapping 596031 596031 596031 N_noFeature 582002 18746725 702945 N_ambiguous 235428 1122 101914 UnstrandedReadsAssigned:18183079 PositiveStrandReadsAssigned:252662 NegativeStrandReadsAssigned:18195650 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR3727140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727140-trimmed-pair1.fastq SRR3727140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,951,329 reads, 18,553,297 reads pseudoaligned [quant] estimated average fragment length: 237.186 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR3727140.ke.tsv 34699 SRR3727140.se.tsv 87100 total ==> SRR3727140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.81 444 12.1798 Potri.005G024800.1.v4.1 1035 798.814 82 5.01749 Potri.004G059700.1.v4.1 961 724.828 42 2.83226 Potri.007G009000.2.v4.1 1416 1179.81 4 0.165716 Potri.003G141000.2.v4.1 2943 2706.81 424 7.65642 Potri.016G087400.1.v4.1 270 79.0304 1343.56 830.963 Potri.015G069301.1.v4.1 564 331.448 0 0 Potri.010G195200.1.v4.1 1773 1536.81 7 0.222636 Potri.012G127500.1.v4.1 977 740.819 2839 187.315 ==> SRR3727140.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 378 Potri.001G212900.v4.1 105 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 443 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3727140 completed mapping pipeline successfully