Starting /dee2/code/volunteer_pipeline.sh SRR3727141 current disk space = 3110627573760 free memory = 1570467992 SRR3727141 SRAfilesize aae0c6a9c38a89ba5863a6df9e61e960 SRR3727141.sra SRR3727141.sra file validated SRR3727141 is paired end SRR3727141 is conventional basespace SRR3727141 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23175 34.0 31.0 34.0 31.0 34.0 2 32.7425 34.0 33.0 34.0 31.0 34.0 3 33.15925 34.0 34.0 34.0 31.0 34.0 4 36.55725 37.0 37.0 37.0 35.0 37.0 5 36.52825 37.0 37.0 37.0 35.0 37.0 6 36.542 37.0 37.0 37.0 35.0 37.0 7 36.4785 37.0 37.0 37.0 35.0 37.0 8 36.51625 37.0 37.0 37.0 35.0 37.0 9 38.43325 39.0 39.0 39.0 37.0 39.0 10-14 38.660799999999995 39.4 39.2 39.4 37.2 39.4 15-19 39.797850000000004 41.0 40.0 41.0 37.8 41.0 20-24 39.677499999999995 41.0 40.0 41.0 37.2 41.0 25-29 39.5826 41.0 39.8 41.0 37.0 41.0 30-34 39.2539 40.0 39.0 41.0 36.2 41.0 35-39 39.1557 40.0 38.8 41.0 36.2 41.0 40-44 39.03595 40.0 38.6 41.0 35.8 41.0 45-49 39.0789 40.0 39.0 41.0 35.4 41.0 50-54 39.06975 40.0 39.0 41.0 35.2 41.0 55-59 38.71374999999999 40.0 38.0 41.0 34.8 41.0 60-64 38.16845 39.8 37.2 41.0 34.0 41.0 65-69 37.52305 38.8 36.0 40.6 34.0 41.0 70-74 36.31535 37.0 35.0 39.2 32.4 40.8 75-79 35.0377 35.4 34.4 37.4 31.4 39.2 80-84 34.576550000000005 35.0 34.0 36.4 32.0 37.6 85-89 33.9216 35.0 34.0 35.4 31.2 36.4 90-94 33.32215000000001 35.0 34.0 35.0 30.2 36.0 95-99 33.23965 35.0 34.0 35.0 30.2 35.0 100-104 33.00505 35.0 34.0 35.0 29.4 35.0 105-109 32.73145000000001 35.0 33.2 35.0 29.0 35.0 110-114 32.4816 34.8 32.8 35.0 28.6 35.0 115-119 31.606399999999997 34.0 32.0 35.0 24.4 35.0 120-124 30.869400000000002 34.0 30.8 35.0 23.0 35.0 125-129 30.038999999999998 34.0 30.0 35.0 18.6 35.0 130-134 29.04475 34.0 29.0 35.0 10.0 35.0 135-139 27.842600000000004 33.4 27.0 35.0 3.6 35.0 140-144 25.789949999999997 31.8 22.0 34.0 2.0 35.0 145-149 22.3071 29.8 3.6 34.0 2.0 35.0 150 15.80475 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 4.0 11 3.0 12 3.0 13 3.0 14 3.0 15 9.0 16 2.0 17 9.0 18 7.0 19 5.0 20 5.0 21 15.0 22 12.0 23 19.0 24 23.0 25 28.0 26 35.0 27 35.0 28 53.0 29 89.0 30 102.0 31 147.0 32 182.0 33 258.0 34 364.0 35 730.0 36 1206.0 37 645.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.058476532444214 18.568863811233648 13.77276224672993 39.5998974095922 2 17.625 28.325 39.125 14.924999999999999 3 16.525000000000002 31.5 26.5 25.474999999999998 4 20.474999999999998 38.05 20.25 21.224999999999998 5 21.575 37.724999999999994 22.5 18.2 6 16.8 35.949999999999996 25.424999999999997 21.825 7 12.375 19.1 45.875 22.650000000000002 8 17.9 20.3 28.799999999999997 33.0 9 18.875 20.325 30.4 30.4 10-14 20.015 30.680000000000003 26.195 23.11 15-19 19.950000000000003 29.485 26.935 23.630000000000003 20-24 19.259999999999998 29.349999999999998 27.495000000000005 23.895 25-29 19.7 29.995 27.134999999999998 23.169999999999998 30-34 19.591959195919593 30.13301330133013 27.032703270327037 23.242324232423243 35-39 19.57 29.095 27.765 23.57 40-44 20.175 29.23 27.015 23.580000000000002 45-49 20.05 28.310000000000002 27.744999999999997 23.895 50-54 20.095 29.330000000000002 26.865 23.71 55-59 19.955000000000002 29.82 26.615 23.61 60-64 19.545 29.595 27.245 23.615 65-69 19.875 28.925 27.27 23.93 70-74 20.125 28.849999999999998 27.310000000000002 23.715 75-79 20.54 28.660000000000004 27.185 23.615 80-84 19.8 28.96 27.63 23.61 85-89 20.075000000000003 28.449999999999996 27.860000000000003 23.615 90-94 20.14 28.375 27.825 23.66 95-99 19.925 28.599999999999998 27.625 23.849999999999998 100-104 20.335 28.335 27.425 23.905 105-109 20.23 28.095 27.91 23.765 110-114 20.537053705370536 27.93779377937794 27.512751275127513 24.012401240124014 115-119 20.657065706570656 28.232823282328233 27.33273327332733 23.77737773777378 120-124 20.275000000000002 28.065 28.035 23.625 125-129 19.915 28.84 27.58 23.665 130-134 19.6 28.475 28.439999999999998 23.485 135-139 19.78 28.49 27.634999999999998 24.095 140-144 19.064999999999998 29.01 27.58 24.345 145-149 18.38 29.95 27.43 24.240000000000002 150 7.9 34.425 28.675 28.999999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 2.0 22 2.5 23 2.5 24 4.0 25 5.5 26 6.0 27 9.5 28 13.5 29 15.0 30 18.0 31 27.5 32 35.5 33 47.0 34 64.5 35 87.0 36 111.0 37 138.5 38 161.0 39 172.5 40 195.0 41 209.5 42 228.0 43 249.5 44 270.5 45 283.0 46 255.0 47 231.5 48 212.5 49 178.0 50 160.0 51 145.0 52 117.0 53 84.0 54 61.5 55 50.0 56 36.0 57 28.5 58 20.5 59 13.0 60 12.0 61 8.0 62 7.0 63 7.5 64 3.5 65 1.5 66 1.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.425 0.025 0.0 0.0 0.0 122-123 0.45 0.025 0.0 0.0 0.0 124-125 0.4625 0.025 0.0 0.0 0.0 126-127 0.6625 0.025 0.0 0.0 0.0 128-129 0.7 0.025 0.0 0.0 0.0 130-131 0.75 0.025 0.0 0.0 0.0 132-133 0.8 0.025 0.0 0.0 0.0 134-135 0.875 0.025 0.0 0.0 0.0 136-137 1.025 0.025 0.0 0.0 0.0 138 1.225 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATATG 10 0.006973645 144.0 4 >>END_MODULE SRR3727141 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12175 34.0 31.0 34.0 31.0 34.0 2 32.313 34.0 31.0 34.0 31.0 34.0 3 32.2695 34.0 31.0 34.0 31.0 34.0 4 35.536 37.0 37.0 37.0 35.0 37.0 5 35.684 37.0 37.0 37.0 35.0 37.0 6 35.4775 37.0 37.0 37.0 35.0 37.0 7 35.63125 37.0 37.0 37.0 35.0 37.0 8 35.70275 37.0 37.0 37.0 35.0 37.0 9 37.50125 39.0 39.0 39.0 35.0 39.0 10-14 37.66225 39.4 38.8 39.4 35.2 39.4 15-19 38.63895 40.8 39.4 41.0 35.6 41.0 20-24 38.582449999999994 40.8 38.8 41.0 35.6 41.0 25-29 38.64425 41.0 39.0 41.0 36.0 41.0 30-34 38.1851 40.2 38.6 41.0 34.6 41.0 35-39 38.193850000000005 40.0 38.0 41.0 34.6 41.0 40-44 37.724 40.0 38.0 41.0 33.2 41.0 45-49 37.41545000000001 40.0 38.0 41.0 32.8 41.0 50-54 36.92815 39.4 37.0 40.4 32.2 40.8 55-59 36.8132 39.2 36.2 41.0 31.4 41.0 60-64 36.826299999999996 39.2 36.0 41.0 32.0 41.0 65-69 36.1152 38.0 35.0 40.2 31.2 41.0 70-74 35.101 36.6 34.6 39.0 30.4 40.6 75-79 34.087900000000005 35.4 34.0 37.2 29.8 39.0 80-84 33.08345 35.0 33.8 36.0 28.4 37.0 85-89 32.629599999999996 35.0 33.8 35.2 28.6 36.2 90-94 32.040350000000004 35.0 33.0 35.0 26.6 35.4 95-99 31.961749999999995 35.0 33.0 35.0 26.6 35.0 100-104 31.58925 34.6 32.6 35.0 25.4 35.0 105-109 31.3645 34.4 32.2 35.0 24.8 35.0 110-114 31.047649999999997 34.0 32.0 35.0 24.0 35.0 115-119 30.29235 34.0 30.6 35.0 19.0 35.0 120-124 29.605900000000002 34.0 29.4 35.0 14.8 35.0 125-129 29.046699999999998 33.8 28.8 35.0 9.2 35.0 130-134 28.66685 33.6 28.6 35.0 5.2 35.0 135-139 28.031799999999997 33.2 27.4 35.0 2.0 35.0 140-144 27.082299999999996 32.4 25.0 34.0 2.0 35.0 145-149 26.056149999999995 32.0 24.4 34.0 2.0 35.0 150 22.6185 29.0 15.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 75.0 3 4.0 4 4.0 5 3.0 6 2.0 7 2.0 8 6.0 9 7.0 10 4.0 11 7.0 12 6.0 13 4.0 14 13.0 15 9.0 16 5.0 17 8.0 18 7.0 19 15.0 20 18.0 21 13.0 22 24.0 23 23.0 24 20.0 25 30.0 26 35.0 27 46.0 28 45.0 29 83.0 30 73.0 31 122.0 32 152.0 33 188.0 34 368.0 35 602.0 36 1227.0 37 747.0 38 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.15 13.225000000000001 14.299999999999999 36.325 2 21.8 23.5 38.824999999999996 15.875 3 21.0 26.125 28.925 23.95 4 23.95 36.575 20.4 19.075 5 23.325000000000003 37.25 22.625 16.8 6 16.8 38.5 24.5 20.200000000000003 7 16.8 13.875000000000002 46.725 22.6 8 20.125 20.65 28.9 30.325000000000003 9 22.575 21.425 28.275 27.725 10-14 22.66 28.310000000000002 27.275 21.755 15-19 23.07 27.47 28.74 20.72 20-24 22.869999999999997 28.365000000000002 27.71 21.055 25-29 22.685 28.084999999999997 27.884999999999998 21.345 30-34 23.09 27.694999999999997 27.97 21.245 35-39 22.235 28.265 28.139999999999997 21.36 40-44 23.11 27.92 28.065 20.905 45-49 23.22 27.834999999999997 28.03 20.915 50-54 23.49 28.105000000000004 27.845 20.560000000000002 55-59 23.46 27.485 28.485 20.57 60-64 23.71 27.089999999999996 27.92 21.279999999999998 65-69 22.505 27.939999999999998 28.17 21.385 70-74 23.09 27.615000000000002 28.439999999999998 20.855 75-79 23.235 27.68 28.299999999999997 20.785 80-84 22.905 28.110000000000003 28.18 20.805 85-89 23.580000000000002 27.875 27.38 21.165 90-94 23.72 27.68 27.82 20.78 95-99 23.69 27.700000000000003 27.625 20.985 100-104 23.32 27.82 28.03 20.830000000000002 105-109 23.27 27.88 28.095 20.755000000000003 110-114 23.5 27.815 27.634999999999998 21.05 115-119 23.549999999999997 27.74 27.900000000000002 20.810000000000002 120-124 24.035 27.87 27.92 20.175 125-129 23.735681056475414 27.467360312140464 28.55785103296483 20.239107598419288 130-134 23.07 27.195000000000004 28.735 21.0 135-139 23.655 26.834999999999997 28.735 20.775 140-144 23.835 27.605 28.405 20.155 145-149 24.58 27.215 27.92 20.285 150 23.95 27.474999999999998 28.125 20.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 2.0 20 2.0 21 2.0 22 3.0 23 2.5 24 2.5 25 3.0 26 6.5 27 8.0 28 5.0 29 10.0 30 15.0 31 19.0 32 30.0 33 30.5 34 34.5 35 52.5 36 70.0 37 95.5 38 128.0 39 152.0 40 183.5 41 228.0 42 250.5 43 258.5 44 256.0 45 276.5 46 302.0 47 274.5 48 251.5 49 215.0 50 171.5 51 149.0 52 120.0 53 95.5 54 72.5 55 53.5 56 38.5 57 31.0 58 26.5 59 19.0 60 15.0 61 10.0 62 6.5 63 6.5 64 4.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.045 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.7875000000000001 0.0 0.0 0.0 0.0 134-135 0.9624999999999999 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGTT 10 0.006973645 144.0 1 ATGCTGG 10 0.006973645 144.0 6 >>END_MODULE Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162417 spots for SRR3727141.sra Written 1162417 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra Read 1162415 spots for SRR3727141.sra Written 1162415 spots for SRR3727141.sra SRR ids: ['SRR3727141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n1e7kvji SRR3727141.sra spots: 23248302 blocks: [[1, 1162415], [1162416, 2324830], [2324831, 3487245], [3487246, 4649660], [4649661, 5812075], [5812076, 6974490], [6974491, 8136905], [8136906, 9299320], [9299321, 10461735], [10461736, 11624150], [11624151, 12786565], [12786566, 13948980], [13948981, 15111395], [15111396, 16273810], [16273811, 17436225], [17436226, 18598640], [18598641, 19761055], [19761056, 20923470], [20923471, 22085885], [22085886, 23248302]] SRR3727141 file size 7810979 SRR3727141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727141 SRR3727141_1.fastq SRR3727141_2.fastq Input file: SRR3727141_1.fastq Paired file: SRR3727141_2.fastq trimmed: SRR3727141-trimmed-pair1.fastq, SRR3727141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:15:09 2025 >> started Fri Feb 14 13:15:36 2025 >> done (26.969s) 23248302 read pairs processed; of these: 104562 ( 0.45%) short read pairs filtered out after trimming by size control 393843 ( 1.69%) empty read pairs filtered out after trimming by size control 22749897 (97.86%) read pairs available; of these: 10635311 (46.75%) trimmed read pairs available after processing 12114586 (53.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 10 0.00% 21 17 0.00% 22 35 0.00% 23 48 0.00% 24 39 0.00% 25 60 0.00% 26 79 0.00% 27 101 0.00% 28 122 0.00% 29 168 0.00% 30 193 0.00% 31 209 0.00% 32 242 0.00% 33 285 0.00% 34 325 0.00% 35 372 0.00% 36 381 0.00% 37 486 0.00% 38 492 0.00% 39 581 0.00% 40 678 0.00% 41 708 0.00% 42 794 0.00% 43 806 0.00% 44 984 0.00% 45 1081 0.00% 46 1102 0.00% 47 1180 0.01% 48 1204 0.01% 49 1281 0.01% 50 1428 0.01% 51 1570 0.01% 52 1591 0.01% 53 1641 0.01% 54 1772 0.01% 55 1877 0.01% 56 1973 0.01% 57 2067 0.01% 58 2305 0.01% 59 2401 0.01% 60 2506 0.01% 61 2582 0.01% 62 2729 0.01% 63 2925 0.01% 64 2989 0.01% 65 3189 0.01% 66 3322 0.01% 67 3435 0.02% 68 3799 0.02% 69 3938 0.02% 70 4191 0.02% 71 4562 0.02% 72 4627 0.02% 73 4999 0.02% 74 5391 0.02% 75 5728 0.03% 76 6181 0.03% 77 6474 0.03% 78 6957 0.03% 79 7456 0.03% 80 7927 0.03% 81 8579 0.04% 82 9338 0.04% 83 10602 0.05% 84 15858 0.07% 85 16164 0.07% 86 16904 0.07% 87 18189 0.08% 88 18422 0.08% 89 18906 0.08% 90 20145 0.09% 91 21423 0.09% 92 21758 0.10% 93 22747 0.10% 94 23654 0.10% 95 24929 0.11% 96 25434 0.11% 97 26500 0.12% 98 26247 0.12% 99 26591 0.12% 100 27055 0.12% 101 28338 0.12% 102 32040 0.14% 103 32498 0.14% 104 32700 0.14% 105 36169 0.16% 106 34471 0.15% 107 35969 0.16% 108 39575 0.17% 109 46451 0.20% 110 42146 0.19% 111 42408 0.19% 112 43420 0.19% 113 44435 0.20% 114 45973 0.20% 115 57613 0.25% 116 48019 0.21% 117 44137 0.19% 118 42705 0.19% 119 43326 0.19% 120 49134 0.22% 121 54553 0.24% 122 53816 0.24% 123 58167 0.26% 124 63169 0.28% 125 67299 0.30% 126 72041 0.32% 127 74531 0.33% 128 73157 0.32% 129 83128 0.37% 130 86883 0.38% 131 88742 0.39% 132 101317 0.45% 133 121188 0.53% 134 127672 0.56% 135 129945 0.57% 136 145154 0.64% 137 160149 0.70% 138 170734 0.75% 139 185866 0.82% 140 199018 0.87% 141 221863 0.98% 142 251090 1.10% 143 283843 1.25% 144 336353 1.48% 145 414330 1.82% 146 528989 2.33% 147 723288 3.18% 148 1091948 4.80% 149 3317509 14.58% 150 12114586 53.25% 22749897 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=23.64 fanout-score-rank=11 prefix-density=0.41 prefix-fanout=9.3 sequence=ACACCAGCAATGATTGTCTGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=470.84 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=34.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=39 prefix-density=0.17 prefix-fanout=2.1 sequence=ATGTACCCAGACTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=408.93 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=33.5 sequence=AAGAAGAAGAAA SRR3727141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:16:44 Started mapping on | Feb 14 13:16:44 Finished on | Feb 14 13:18:55 Mapping speed, Million of reads per hour | 625.19 Number of input reads | 22749897 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 21791104 Uniquely mapped reads % | 95.79% Average mapped length | 289.22 Number of splices: Total | 19917766 Number of splices: Annotated (sjdb) | 19554373 Number of splices: GT/AG | 19594012 Number of splices: GC/AG | 270492 Number of splices: AT/AC | 16457 Number of splices: Non-canonical | 36805 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 487666 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 26146 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 495084 495084 495084 N_multimapping 487666 487666 487666 N_noFeature 739353 21515084 860374 N_ambiguous 278070 1363 122329 UnstrandedReadsAssigned:20773681 PositiveStrandReadsAssigned:274657 NegativeStrandReadsAssigned:20808401 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727141-trimmed-pair1.fastq SRR3727141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,749,897 reads, 20,959,383 reads pseudoaligned [quant] estimated average fragment length: 255.865 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR3727141.ke.tsv 34699 SRR3727141.se.tsv 87100 total ==> SRR3727141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.14 609 13.9574 Potri.005G024800.1.v4.1 1035 780.135 262 13.5708 Potri.004G059700.1.v4.1 961 706.18 56 3.20439 Potri.007G009000.2.v4.1 1416 1161.14 1 0.0348009 Potri.003G141000.2.v4.1 2943 2688.14 772.272 11.6089 Potri.016G087400.1.v4.1 270 72.0464 2078.54 1165.79 Potri.015G069301.1.v4.1 564 315.843 0 0 Potri.010G195200.1.v4.1 1773 1518.14 37 0.984838 Potri.012G127500.1.v4.1 977 722.155 7841 438.747 ==> SRR3727141.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 668 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 499 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 439 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3727141 completed mapping pipeline successfully