Starting /dee2/code/volunteer_pipeline.sh SRR3727142 current disk space = 3110455885824 free memory = 1578099772 SRR3727142 SRAfilesize 9dad764d4f850d53bc246036af9bd42e SRR3727142.sra SRR3727142.sra file validated SRR3727142 is paired end SRR3727142 is conventional basespace SRR3727142 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2 34.0 31.0 34.0 31.0 34.0 2 32.5675 34.0 31.0 34.0 31.0 34.0 3 33.03825 34.0 31.0 34.0 31.0 34.0 4 36.52225 37.0 37.0 37.0 35.0 37.0 5 36.44475 37.0 37.0 37.0 35.0 37.0 6 35.97225 37.0 36.0 37.0 35.0 37.0 7 36.39425 37.0 37.0 37.0 35.0 37.0 8 36.45275 37.0 37.0 37.0 35.0 37.0 9 38.26525 39.0 39.0 39.0 37.0 39.0 10-14 38.6332 39.4 39.2 39.4 37.2 39.4 15-19 39.6051 40.8 39.6 41.0 37.2 41.0 20-24 39.60235000000001 41.0 39.4 41.0 37.0 41.0 25-29 39.32385000000001 40.0 39.0 41.0 36.2 41.0 30-34 39.30755 40.0 38.8 41.0 36.4 41.0 35-39 38.73630000000001 40.0 38.0 41.0 34.8 41.0 40-44 38.92205 40.0 38.0 41.0 35.4 41.0 45-49 39.17695 40.0 39.0 41.0 35.8 41.0 50-54 38.759249999999994 40.0 38.2 41.0 34.6 41.0 55-59 38.5039 40.0 38.0 41.0 34.6 41.0 60-64 37.8014 39.4 36.4 41.0 33.6 41.0 65-69 37.234750000000005 38.6 35.6 40.2 33.2 41.0 70-74 36.2273 36.8 35.0 39.2 32.2 40.8 75-79 34.90725 35.2 34.2 37.4 30.8 39.2 80-84 34.373450000000005 35.0 34.0 36.4 31.4 37.6 85-89 33.6318 35.0 34.0 35.2 30.6 36.4 90-94 33.38765 35.0 34.0 35.0 30.6 35.8 95-99 33.10465 35.0 34.0 35.0 30.0 35.0 100-104 32.85475 35.0 33.4 35.0 29.2 35.0 105-109 32.2247 34.4 32.6 35.0 27.0 35.0 110-114 32.27460000000001 34.0 32.6 35.0 28.6 35.0 115-119 31.97305 34.0 32.0 35.0 27.0 35.0 120-124 31.7782 34.0 32.0 35.0 25.8 35.0 125-129 30.93005 34.0 31.0 35.0 23.4 35.0 130-134 30.190000000000005 34.0 30.0 35.0 20.4 35.0 135-139 28.129849999999998 33.0 26.6 34.4 7.6 35.0 140-144 27.023649999999996 32.8 25.0 34.4 2.0 35.0 145-149 21.42125 29.4 3.0 34.0 2.0 35.0 150 15.722 2.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 3.0 11 6.0 12 1.0 13 6.0 14 11.0 15 5.0 16 2.0 17 5.0 18 3.0 19 10.0 20 5.0 21 12.0 22 20.0 23 13.0 24 16.0 25 21.0 26 29.0 27 42.0 28 52.0 29 65.0 30 89.0 31 123.0 32 181.0 33 285.0 34 438.0 35 826.0 36 1153.0 37 573.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.2885355219287 17.363426519620415 18.414978199538343 38.93305975891254 2 18.15 27.425 37.1 17.325 3 17.325 30.2 26.775 25.7 4 19.975 37.1 21.925 21.0 5 19.875 38.5 23.25 18.375 6 16.375 36.975 24.975 21.675 7 12.174999999999999 19.125 46.800000000000004 21.9 8 18.725 20.275000000000002 27.175 33.825 9 17.575 21.85 31.874999999999996 28.7 10-14 19.61 29.599999999999998 26.35 24.44 15-19 19.580000000000002 28.965000000000003 27.725 23.73 20-24 20.195 29.220000000000002 27.24 23.345 25-29 19.650000000000002 29.84 27.455000000000002 23.055 30-34 19.537930689603442 29.139370905635847 27.474121118167727 23.848577286592988 35-39 19.75098754937747 29.181459072953647 27.566378318915945 23.50117505875294 40-44 20.195 29.565 27.32 22.919999999999998 45-49 19.53 28.625 28.15 23.695 50-54 19.919999999999998 28.294999999999998 28.15 23.635 55-59 20.175 28.904999999999998 27.279999999999998 23.64 60-64 20.595 28.16 27.389999999999997 23.855 65-69 20.25 28.575 27.525 23.65 70-74 20.305 28.04 28.000000000000004 23.655 75-79 20.365 27.939999999999998 27.98 23.715 80-84 20.46 28.355000000000004 27.839999999999996 23.345 85-89 20.705000000000002 28.53 27.224999999999998 23.54 90-94 19.880994049702487 28.496424821241064 27.166358317915893 24.456222811140556 95-99 20.435 28.095 27.785 23.685000000000002 100-104 20.205000000000002 28.205000000000002 27.700000000000003 23.89 105-109 20.294999999999998 28.605000000000004 27.765 23.335 110-114 20.621341737955877 28.015408474661065 27.475111311221173 23.88813847616189 115-119 20.84229480318111 28.970139548842095 27.21452508377932 22.97304056419747 120-124 20.146007300365017 28.751437571878597 27.376368818440923 23.726186309315466 125-129 20.9 28.105000000000004 27.134999999999998 23.86 130-134 20.995 27.915 27.765 23.325000000000003 135-139 19.46597329866493 28.441422071103556 27.901395069753487 24.191209560478026 140-144 19.75 28.634999999999998 28.38 23.235 145-149 18.62 29.84 27.24 24.3 150 8.725 33.775 29.299999999999997 28.199999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.5 22 3.5 23 3.5 24 3.0 25 2.5 26 4.0 27 6.0 28 8.5 29 13.0 30 21.5 31 26.5 32 35.0 33 50.0 34 64.0 35 82.0 36 108.5 37 127.5 38 143.5 39 185.5 40 206.5 41 215.5 42 234.0 43 255.0 44 276.0 45 273.0 46 247.0 47 215.5 48 212.0 49 199.0 50 163.0 51 133.5 52 111.0 53 89.0 54 75.0 55 56.0 56 35.5 57 25.5 58 15.0 59 12.0 60 13.5 61 10.5 62 6.5 63 5.5 64 4.0 65 2.5 66 1.5 67 2.0 68 2.5 69 1.5 70 0.5 71 0.5 72 1.5 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.055 115-119 0.034999999999999996 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 1.175 0.0 0.0 0.0 0.0 136-137 1.2625000000000002 0.0 0.0 0.0 0.0 138 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTTCA 10 0.0070099696 143.75 2 GACTCTC 10 0.0070099696 143.75 2 CTCGTTC 10 0.0070099696 143.75 1 >>END_MODULE SRR3727142 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3727142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81575 34.0 31.0 34.0 30.0 34.0 2 32.163 34.0 31.0 34.0 30.0 34.0 3 32.30125 34.0 31.0 34.0 31.0 34.0 4 35.76025 37.0 37.0 37.0 35.0 37.0 5 35.7555 37.0 37.0 37.0 35.0 37.0 6 35.8055 37.0 37.0 37.0 35.0 37.0 7 35.788 37.0 37.0 37.0 35.0 37.0 8 35.83625 37.0 37.0 37.0 35.0 37.0 9 37.666 39.0 39.0 39.0 35.0 39.0 10-14 37.77315 39.4 38.2 39.4 35.2 39.4 15-19 38.72350000000001 40.6 38.6 41.0 35.6 41.0 20-24 38.87945 41.0 39.0 41.0 36.0 41.0 25-29 38.5764 40.4 38.6 41.0 35.4 41.0 30-34 38.39835 40.0 38.0 41.0 35.0 41.0 35-39 38.292500000000004 40.0 38.0 41.0 34.2 41.0 40-44 37.98389999999999 40.0 38.0 41.0 33.6 41.0 45-49 37.6894 40.0 38.0 41.0 33.0 41.0 50-54 37.168549999999996 39.2 37.2 40.4 32.6 40.8 55-59 37.14045 39.4 36.6 41.0 32.2 41.0 60-64 37.169599999999996 39.0 36.0 41.0 32.8 41.0 65-69 36.407250000000005 38.2 35.4 40.2 32.2 41.0 70-74 35.4326 36.6 35.0 39.0 31.2 40.6 75-79 34.4304 35.4 34.4 37.2 30.8 39.0 80-84 33.36044999999999 35.0 34.0 36.2 29.2 37.4 85-89 32.8301 35.0 34.0 35.0 29.0 36.2 90-94 32.456050000000005 35.0 33.0 35.0 29.0 35.6 95-99 32.077999999999996 35.0 33.0 35.0 27.0 35.0 100-104 31.96685 35.0 33.0 35.0 27.0 35.0 105-109 31.76495 34.6 32.6 35.0 25.6 35.0 110-114 31.2774 34.0 31.8 35.0 24.6 35.0 115-119 30.858150000000002 34.0 31.0 35.0 23.6 35.0 120-124 30.55265 34.0 31.0 35.0 22.4 35.0 125-129 30.066099999999995 34.0 30.0 35.0 19.2 35.0 130-134 29.520799999999998 34.0 29.2 35.0 17.6 35.0 135-139 28.874200000000002 33.2 28.6 34.8 8.8 35.0 140-144 27.912600000000005 33.0 27.0 34.0 2.0 35.0 145-149 25.886149999999997 31.8 23.2 34.0 2.0 35.0 150 22.14175 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 1.0 4 3.0 5 5.0 6 4.0 7 2.0 8 5.0 9 4.0 10 6.0 11 4.0 12 8.0 13 7.0 14 4.0 15 7.0 16 8.0 17 7.0 18 9.0 19 10.0 20 6.0 21 5.0 22 17.0 23 20.0 24 21.0 25 29.0 26 40.0 27 42.0 28 48.0 29 62.0 30 81.0 31 114.0 32 160.0 33 200.0 34 390.0 35 658.0 36 1252.0 37 703.0 38 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.099999999999998 12.775 21.525 36.6 2 23.7 22.075 37.65 16.575 3 19.8 25.974999999999998 30.225 24.0 4 23.674999999999997 35.825 21.224999999999998 19.275000000000002 5 22.900000000000002 34.975 22.55 19.575 6 16.6 38.925 24.099999999999998 20.375 7 16.5 14.7 47.075 21.725 8 21.675 21.5 26.275 30.55 9 21.4 22.45 29.175 26.974999999999998 10-14 22.650000000000002 28.49 26.625 22.235 15-19 22.755 27.21 28.395 21.64 20-24 22.695 27.794999999999998 27.98 21.529999999999998 25-29 23.055 27.765 27.474999999999998 21.705 30-34 22.634999999999998 28.025 28.215 21.125 35-39 22.595000000000002 28.355000000000004 27.865000000000002 21.185000000000002 40-44 22.84 28.04 28.02 21.099999999999998 45-49 22.32 28.07 28.189999999999998 21.42 50-54 23.285 27.560000000000002 28.115000000000002 21.04 55-59 23.06 27.35 28.46 21.13 60-64 23.27 27.655 28.134999999999998 20.94 65-69 22.685 27.98 27.939999999999998 21.395 70-74 23.055 27.41 28.46 21.075 75-79 22.63 27.655 28.565 21.15 80-84 23.53 27.71 28.13 20.630000000000003 85-89 23.405 27.865000000000002 28.175 20.555 90-94 23.22 27.41 28.110000000000003 21.26 95-99 23.630000000000003 27.744999999999997 27.77 20.855 100-104 23.599999999999998 27.67 28.305000000000003 20.424999999999997 105-109 23.330000000000002 27.93 28.26 20.48 110-114 23.385 27.644999999999996 28.175 20.794999999999998 115-119 23.18 27.91 28.015 20.895 120-124 23.785 27.375 27.82 21.02 125-129 24.18 27.834999999999997 27.145000000000003 20.84 130-134 23.455000000000002 27.38 28.585 20.580000000000002 135-139 23.695 27.560000000000002 27.99 20.755000000000003 140-144 24.044999999999998 27.994999999999997 27.73 20.23 145-149 24.005000000000003 28.754999999999995 26.919999999999998 20.32 150 24.675 27.875 26.724999999999998 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 3.0 26 2.5 27 4.0 28 10.0 29 13.0 30 15.0 31 17.0 32 21.5 33 34.5 34 48.0 35 58.0 36 76.5 37 105.5 38 144.0 39 179.0 40 202.0 41 216.0 42 242.0 43 259.5 44 265.0 45 271.5 46 267.5 47 251.0 48 225.5 49 217.0 50 186.0 51 139.5 52 121.0 53 93.5 54 71.0 55 62.0 56 39.5 57 25.5 58 22.0 59 17.5 60 12.5 61 9.5 62 7.5 63 6.0 64 5.0 65 4.0 66 3.0 67 4.0 68 4.0 69 2.5 70 1.0 71 0.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATGC 10 0.006973645 144.0 5 >>END_MODULE Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918864 spots for SRR3727142.sra Written 918864 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra Read 918860 spots for SRR3727142.sra Written 918860 spots for SRR3727142.sra SRR ids: ['SRR3727142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ww5ny5xl SRR3727142.sra spots: 18377204 blocks: [[1, 918860], [918861, 1837720], [1837721, 2756580], [2756581, 3675440], [3675441, 4594300], [4594301, 5513160], [5513161, 6432020], [6432021, 7350880], [7350881, 8269740], [8269741, 9188600], [9188601, 10107460], [10107461, 11026320], [11026321, 11945180], [11945181, 12864040], [12864041, 13782900], [13782901, 14701760], [14701761, 15620620], [15620621, 16539480], [16539481, 17458340], [17458341, 18377204]] SRR3727142 file size 6169838 SRR3727142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3727142 SRR3727142_1.fastq SRR3727142_2.fastq Input file: SRR3727142_1.fastq Paired file: SRR3727142_2.fastq trimmed: SRR3727142-trimmed-pair1.fastq, SRR3727142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:18:39 2025 >> started Fri Feb 14 13:18:58 2025 >> done (19.632s) 18377204 read pairs processed; of these: 64975 ( 0.35%) short read pairs filtered out after trimming by size control 267389 ( 1.46%) empty read pairs filtered out after trimming by size control 18044840 (98.19%) read pairs available; of these: 7781786 (43.12%) trimmed read pairs available after processing 10263054 (56.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 7 0.00% 21 15 0.00% 22 22 0.00% 23 20 0.00% 24 34 0.00% 25 34 0.00% 26 47 0.00% 27 60 0.00% 28 70 0.00% 29 85 0.00% 30 93 0.00% 31 109 0.00% 32 139 0.00% 33 137 0.00% 34 170 0.00% 35 168 0.00% 36 210 0.00% 37 224 0.00% 38 245 0.00% 39 309 0.00% 40 306 0.00% 41 343 0.00% 42 365 0.00% 43 454 0.00% 44 454 0.00% 45 508 0.00% 46 527 0.00% 47 560 0.00% 48 563 0.00% 49 672 0.00% 50 680 0.00% 51 735 0.00% 52 826 0.00% 53 782 0.00% 54 929 0.01% 55 899 0.00% 56 1014 0.01% 57 1035 0.01% 58 1097 0.01% 59 1161 0.01% 60 1243 0.01% 61 1316 0.01% 62 1455 0.01% 63 1450 0.01% 64 1631 0.01% 65 1636 0.01% 66 1731 0.01% 67 1844 0.01% 68 2023 0.01% 69 2122 0.01% 70 2287 0.01% 71 2445 0.01% 72 2521 0.01% 73 2790 0.02% 74 3009 0.02% 75 3342 0.02% 76 3510 0.02% 77 3582 0.02% 78 3842 0.02% 79 4073 0.02% 80 4200 0.02% 81 4404 0.02% 82 4936 0.03% 83 5635 0.03% 84 9476 0.05% 85 9952 0.06% 86 10662 0.06% 87 11980 0.07% 88 11544 0.06% 89 11729 0.06% 90 12384 0.07% 91 13572 0.08% 92 13843 0.08% 93 14092 0.08% 94 14302 0.08% 95 14734 0.08% 96 15355 0.09% 97 16374 0.09% 98 18655 0.10% 99 16617 0.09% 100 15954 0.09% 101 18199 0.10% 102 18024 0.10% 103 18044 0.10% 104 19037 0.11% 105 30316 0.17% 106 19023 0.11% 107 21017 0.12% 108 19702 0.11% 109 22721 0.13% 110 20770 0.12% 111 22275 0.12% 112 21452 0.12% 113 22929 0.13% 114 37873 0.21% 115 50340 0.28% 116 25344 0.14% 117 22016 0.12% 118 23442 0.13% 119 23798 0.13% 120 28575 0.16% 121 34377 0.19% 122 31632 0.18% 123 27335 0.15% 124 27480 0.15% 125 33112 0.18% 126 33909 0.19% 127 33428 0.19% 128 35935 0.20% 129 59901 0.33% 130 50790 0.28% 131 45196 0.25% 132 60041 0.33% 133 82304 0.46% 134 74585 0.41% 135 71117 0.39% 136 92608 0.51% 137 104198 0.58% 138 118478 0.66% 139 132661 0.74% 140 135034 0.75% 141 153761 0.85% 142 168102 0.93% 143 191337 1.06% 144 237114 1.31% 145 291806 1.62% 146 372411 2.06% 147 538569 2.98% 148 831817 4.61% 149 2913486 16.15% 150 10263054 56.88% 18044840 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.41 prefix-fanout=2.1 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=13.82 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.0 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=16 prefix-density=0.47 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=32.49 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.7 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR3727142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:20:09 Started mapping on | Feb 14 13:20:09 Finished on | Feb 14 13:21:52 Mapping speed, Million of reads per hour | 630.69 Number of input reads | 18044840 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17210126 Uniquely mapped reads % | 95.37% Average mapped length | 291.64 Number of splices: Total | 15547705 Number of splices: Annotated (sjdb) | 15278030 Number of splices: GT/AG | 15311274 Number of splices: GC/AG | 192567 Number of splices: AT/AC | 12182 Number of splices: Non-canonical | 31682 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.03% Deletion average length | 1.91 Insertion rate per base | 0.02% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441992 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 41933 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 409059 409059 409059 N_multimapping 441992 441992 441992 N_noFeature 560219 17011436 663010 N_ambiguous 199073 1594 101961 UnstrandedReadsAssigned:16450834 PositiveStrandReadsAssigned:197096 NegativeStrandReadsAssigned:16445155 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR3727142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR3727142-trimmed-pair1.fastq SRR3727142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,044,840 reads, 16,529,692 reads pseudoaligned [quant] estimated average fragment length: 256.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR3727142.ke.tsv 34699 SRR3727142.se.tsv 87100 total ==> SRR3727142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.62 1412 43.7522 Potri.005G024800.1.v4.1 1035 779.621 396 27.7419 Potri.004G059700.1.v4.1 961 705.666 17 1.31575 Potri.007G009000.2.v4.1 1416 1160.62 0 0 Potri.003G141000.2.v4.1 2943 2687.62 541.507 11.0042 Potri.016G087400.1.v4.1 270 71.8219 796 605.313 Potri.015G069301.1.v4.1 564 314.455 0 0 Potri.010G195200.1.v4.1 1773 1517.62 232 8.34928 Potri.012G127500.1.v4.1 977 721.651 10917 826.229 ==> SRR3727142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 171 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 455 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 102 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 213 SRR3727142 completed mapping pipeline successfully