Starting /dee2/code/volunteer_pipeline.sh SRR4237572 current disk space = 3049587544064 free memory = 1303891120 SRR4237572 SRAfilesize cf9681776dfe0c795b01d21dfa19162f SRR4237572.sra SRR4237572.sra file validated SRR4237572 is paired end SRR4237572 is conventional basespace SRR4237572 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237572_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.70425 33.0 33.0 34.0 2.0 34.0 2 32.44075 34.0 33.0 34.0 28.0 34.0 3 32.7345 34.0 33.0 34.0 30.0 34.0 4 33.0315 34.0 33.0 34.0 32.0 34.0 5 32.157 33.0 33.0 34.0 31.0 34.0 6 36.394 38.0 37.0 38.0 34.0 38.0 7 36.996 38.0 38.0 38.0 36.0 38.0 8 37.17 38.0 38.0 38.0 36.0 38.0 9 37.266 38.0 38.0 38.0 37.0 38.0 10-14 37.319849999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.3221 38.0 38.0 38.0 37.0 38.0 20-24 37.1958 38.0 38.0 38.0 36.6 38.0 25-29 36.477149999999995 38.0 37.4 38.0 33.4 38.0 30-34 37.151199999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.865500000000004 38.0 38.0 38.0 35.2 38.0 40-44 37.06345 38.0 38.0 38.0 36.0 38.0 45-49 36.981350000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.4861 38.0 37.6 38.0 33.8 38.0 55-59 34.271100000000004 37.4 33.6 38.0 24.0 38.0 60-64 34.31105 36.4 31.2 38.0 28.4 38.0 65-69 36.84765 38.0 38.0 38.0 35.4 38.0 70-74 35.126599999999996 37.6 34.6 38.0 29.4 38.0 75-79 36.1128 38.0 37.4 38.0 31.8 38.0 80-84 35.820049999999995 38.0 36.8 38.0 29.4 38.0 85-89 36.0978 38.0 37.4 38.0 32.6 38.0 90-94 35.83525000000001 38.0 37.0 38.0 31.2 38.0 95-99 36.4852 38.0 38.0 38.0 34.0 38.0 100-104 36.406850000000006 38.0 37.8 38.0 34.0 38.0 105-109 36.29855 38.0 38.0 38.0 34.0 38.0 110-114 36.21435 38.0 37.8 38.0 33.8 38.0 115-119 36.0443 38.0 37.2 38.0 33.4 38.0 120-124 35.82379999999999 38.0 37.0 38.0 32.2 38.0 125-129 34.51335 38.0 34.4 38.0 25.8 38.0 130-134 35.45655000000001 38.0 36.2 38.0 30.6 38.0 135-139 31.98335 36.0 28.0 38.0 20.6 38.0 140-144 30.337799999999998 35.0 24.8 38.0 16.6 38.0 145-149 33.275400000000005 37.6 33.8 38.0 22.8 38.0 150 29.42775 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 4.0 18 3.0 19 2.0 20 6.0 21 3.0 22 9.0 23 8.0 24 11.0 25 26.0 26 29.0 27 32.0 28 53.0 29 47.0 30 62.0 31 83.0 32 100.0 33 162.0 34 256.0 35 460.0 36 1124.0 37 1511.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.20412716118238 11.572783045175683 8.449525934188511 41.773563859453425 2 22.225 15.725 35.4 26.650000000000002 3 20.45 18.85 25.974999999999998 34.725 4 23.549999999999997 28.95 22.25 25.25 5 22.3 33.7 23.775 20.225 6 17.7 36.375 25.15 20.775 7 14.799999999999999 27.224999999999998 40.6 17.375 8 16.7 27.400000000000002 31.874999999999996 24.025 9 18.275 24.975 32.824999999999996 23.925 10-14 19.27 31.525 27.045 22.16 15-19 19.005 29.82 27.54 23.635 20-24 19.285 29.735 27.355 23.625 25-29 19.495 29.24 27.810000000000002 23.455000000000002 30-34 18.875 29.935000000000002 27.55 23.64 35-39 19.585 29.505 27.474999999999998 23.435 40-44 19.64 29.175 27.794999999999998 23.39 45-49 20.235 29.17 27.365000000000002 23.23 50-54 19.39 30.19 26.979999999999997 23.44 55-59 19.74 29.64 27.055 23.565 60-64 19.885 28.99 27.365000000000002 23.76 65-69 19.595000000000002 29.695 27.639999999999997 23.07 70-74 19.955000000000002 29.95 26.919999999999998 23.175 75-79 20.25 29.07 27.435 23.244999999999997 80-84 20.155 29.17 27.034999999999997 23.64 85-89 19.68 29.349999999999998 27.315 23.655 90-94 20.11 28.849999999999998 27.265 23.775 95-99 19.84 28.994999999999997 27.77 23.395 100-104 19.895 29.025000000000002 27.435 23.645 105-109 20.44 28.294999999999998 26.93 24.335 110-114 19.439999999999998 29.349999999999998 26.775 24.435000000000002 115-119 20.57 29.4 27.015 23.015 120-124 20.849999999999998 28.525 26.529999999999998 24.095 125-129 20.445 28.970000000000002 26.955000000000002 23.630000000000003 130-134 20.24 28.305000000000003 27.165 24.29 135-139 20.794999999999998 28.360000000000003 27.284999999999997 23.56 140-144 20.19 28.29 27.1 24.42 145-149 20.195 28.83 26.77 24.205 150 19.7 28.575 27.325 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 2.0 20 2.0 21 0.0 22 1.5 23 2.5 24 2.0 25 2.5 26 9.0 27 16.0 28 15.5 29 13.5 30 19.0 31 30.5 32 45.5 33 61.5 34 80.5 35 85.0 36 85.0 37 106.0 38 144.5 39 184.5 40 215.5 41 237.5 42 246.5 43 250.0 44 267.0 45 268.0 46 254.0 47 233.0 48 206.5 49 183.0 50 158.5 51 132.5 52 104.5 53 91.0 54 66.5 55 46.5 56 36.0 57 27.0 58 20.5 59 16.5 60 11.0 61 4.0 62 3.5 63 3.0 64 2.0 65 1.0 66 2.0 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0125 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.0625 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.15 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.16249999999999998 0.0 0.0 0.025 0.0 84-85 0.1875 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88-89 0.2625 0.0 0.0 0.025 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.3875 0.0 0.0 0.025 0.0 94-95 0.4375 0.0 0.0 0.025 0.0 96-97 0.5375000000000001 0.0 0.0 0.025 0.0 98-99 0.6875 0.0 0.0 0.025 0.0 100-101 0.8375 0.0 0.0 0.025 0.0 102-103 0.9875 0.0 0.0 0.025 0.0 104-105 1.0625 0.0 0.0 0.025 0.0 106-107 1.1625 0.0 0.0 0.025 0.0 108-109 1.3 0.0 0.0 0.025 0.0 110-111 1.525 0.0 0.0 0.025 0.0 112-113 1.775 0.0 0.0 0.025 0.0 114-115 2.075 0.0 0.0 0.025 0.0 116-117 2.325 0.0 0.0 0.025 0.0 118-119 2.6500000000000004 0.0 0.0 0.025 0.0 120-121 3.05 0.0 0.0 0.025 0.0 122-123 3.3625 0.0 0.0 0.025 0.0 124-125 3.6 0.0 0.0 0.025 0.0 126-127 4.025 0.0 0.0 0.025 0.0 128-129 4.5375 0.0 0.0 0.025 0.0 130-131 4.8875 0.0 0.0 0.025 0.0 132-133 5.175 0.0 0.0 0.025 0.0 134-135 5.5 0.0 0.0 0.025 0.0 136-137 5.85 0.0 0.0 0.025 0.0 138 6.25 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237572 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237572_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65075 33.0 33.0 34.0 32.0 34.0 2 32.73075 33.0 33.0 34.0 32.0 34.0 3 32.7045 33.0 33.0 34.0 32.0 34.0 4 32.73825 33.0 33.0 34.0 32.0 34.0 5 32.75575 33.0 33.0 34.0 32.0 34.0 6 36.71325 38.0 38.0 38.0 35.0 38.0 7 36.77925 38.0 38.0 38.0 36.0 38.0 8 36.797 38.0 38.0 38.0 36.0 38.0 9 36.88225 38.0 38.0 38.0 36.0 38.0 10-14 36.4858 38.0 37.8 38.0 34.0 38.0 15-19 36.5299 38.0 38.0 38.0 34.2 38.0 20-24 34.42275 37.8 34.4 38.0 23.4 38.0 25-29 36.2915 38.0 37.6 38.0 33.0 38.0 30-34 36.71335 38.0 38.0 38.0 35.2 38.0 35-39 36.642250000000004 38.0 38.0 38.0 35.0 38.0 40-44 36.565000000000005 38.0 38.0 38.0 34.4 38.0 45-49 36.264599999999994 38.0 37.6 38.0 32.6 38.0 50-54 35.3917 38.0 35.6 38.0 29.2 38.0 55-59 36.4227 38.0 38.0 38.0 33.8 38.0 60-64 36.27355 38.0 38.0 38.0 33.8 38.0 65-69 36.40245 38.0 38.0 38.0 34.0 38.0 70-74 35.3315 38.0 35.8 38.0 29.0 38.0 75-79 34.81845 38.0 35.4 38.0 25.0 38.0 80-84 36.17885 38.0 37.8 38.0 33.4 38.0 85-89 36.1817 38.0 38.0 38.0 33.6 38.0 90-94 35.8708 38.0 37.8 38.0 32.2 38.0 95-99 35.9693 38.0 38.0 38.0 33.0 38.0 100-104 35.736450000000005 38.0 37.6 38.0 32.0 38.0 105-109 35.58935 38.0 37.2 38.0 31.0 38.0 110-114 33.94885 37.8 33.6 38.0 25.0 38.0 115-119 33.461400000000005 37.4 32.2 38.0 22.4 38.0 120-124 34.99535 38.0 36.4 38.0 27.6 38.0 125-129 34.8791 38.0 36.0 38.0 27.6 38.0 130-134 34.47165 38.0 35.2 38.0 24.2 38.0 135-139 34.60085 38.0 36.0 38.0 26.8 38.0 140-144 33.71895 38.0 34.8 38.0 21.0 38.0 145-149 32.56865 38.0 33.0 38.0 11.4 38.0 150 26.5765 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 4.0 6 0.0 7 1.0 8 0.0 9 4.0 10 4.0 11 4.0 12 3.0 13 2.0 14 5.0 15 6.0 16 6.0 17 3.0 18 13.0 19 9.0 20 7.0 21 7.0 22 13.0 23 14.0 24 15.0 25 26.0 26 37.0 27 36.0 28 49.0 29 68.0 30 78.0 31 83.0 32 106.0 33 129.0 34 181.0 35 346.0 36 756.0 37 1976.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.05 19.675 14.05 28.225 2 27.800000000000004 25.45 32.025 14.725 3 22.95 27.55 31.0 18.5 4 25.474999999999998 33.650000000000006 23.7 17.175 5 26.150000000000002 36.15 21.775 15.925 6 20.525 40.325 22.775000000000002 16.375 7 20.724999999999998 20.75 39.725 18.8 8 21.65 25.474999999999998 28.65 24.224999999999998 9 22.25 24.525 30.15 23.075000000000003 10-14 24.11 28.115000000000002 26.71 21.065 15-19 24.13 27.584999999999997 28.09 20.195 20-24 23.380000000000003 28.694999999999997 27.47 20.455000000000002 25-29 23.72 27.925 27.965 20.39 30-34 23.36 28.315 27.950000000000003 20.375 35-39 23.26 27.615000000000002 28.49 20.635 40-44 23.755000000000003 27.589999999999996 27.565 21.09 45-49 23.68 28.055000000000003 28.144999999999996 20.119999999999997 50-54 23.71 27.67 27.965 20.655 55-59 24.01 27.21 28.395 20.385 60-64 23.66 27.810000000000002 28.09 20.44 65-69 23.28 27.6 28.694999999999997 20.424999999999997 70-74 23.575 27.589999999999996 28.285 20.549999999999997 75-79 23.200000000000003 27.6 28.804999999999996 20.395 80-84 23.86 27.16 28.185 20.794999999999998 85-89 23.625 27.595 28.865000000000002 19.915 90-94 24.05 27.66 28.349999999999998 19.939999999999998 95-99 23.599999999999998 27.32 28.7 20.380000000000003 100-104 23.84 27.334999999999997 28.685 20.14 105-109 23.76 28.134999999999998 28.275 19.830000000000002 110-114 24.16 26.945000000000004 28.38 20.515 115-119 24.335 27.46 28.505000000000003 19.7 120-124 24.044999999999998 28.075 28.194999999999997 19.685 125-129 23.830000000000002 27.82 28.349999999999998 20.0 130-134 24.19 27.800000000000004 27.605 20.405 135-139 24.385 28.26 27.83 19.525000000000002 140-144 24.82 27.26 27.855 20.064999999999998 145-149 25.155 27.944999999999997 27.445000000000004 19.455 150 25.874999999999996 28.749999999999996 27.875 17.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 0.5 24 1.5 25 3.5 26 3.0 27 5.0 28 6.0 29 9.0 30 14.0 31 21.5 32 25.0 33 27.0 34 43.5 35 61.0 36 91.0 37 110.5 38 125.0 39 163.0 40 205.0 41 225.0 42 246.0 43 263.5 44 272.0 45 289.0 46 285.5 47 270.5 48 250.0 49 207.5 50 167.5 51 140.0 52 117.5 53 97.0 54 65.5 55 46.0 56 38.0 57 30.0 58 22.0 59 15.0 60 10.5 61 6.0 62 3.0 63 2.5 64 3.0 65 2.0 66 1.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4500000000000002 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.9749999999999999 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.449999999999999 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 6.074999999999999 0.0 0.0 0.0 0.0 138 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTTA 10 0.006973645 144.0 3 CCACAAG 10 0.006973645 144.0 1 AGATGAG 10 0.006973645 144.0 8 >>END_MODULE Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669903 spots for SRR4237572.sra Written 3669903 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra Read 3669898 spots for SRR4237572.sra Written 3669898 spots for SRR4237572.sra SRR ids: ['SRR4237572.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_luj4rv4o SRR4237572.sra spots: 73397965 blocks: [[1, 3669898], [3669899, 7339796], [7339797, 11009694], [11009695, 14679592], [14679593, 18349490], [18349491, 22019388], [22019389, 25689286], [25689287, 29359184], [29359185, 33029082], [33029083, 36698980], [36698981, 40368878], [40368879, 44038776], [44038777, 47708674], [47708675, 51378572], [51378573, 55048470], [55048471, 58718368], [58718369, 62388266], [62388267, 66058164], [66058165, 69728062], [69728063, 73397965]] SRR4237572 file size 24707106 SRR4237572 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237572 SRR4237572_1.fastq SRR4237572_2.fastq Input file: SRR4237572_1.fastq Paired file: SRR4237572_2.fastq trimmed: SRR4237572-trimmed-pair1.fastq, SRR4237572-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:02:15 2025 >> started Wed Feb 12 10:03:35 2025 >> done (79.679s) 73397965 read pairs processed; of these: 79644 ( 0.11%) short read pairs filtered out after trimming by size control 71836 ( 0.10%) empty read pairs filtered out after trimming by size control 73246485 (99.79%) read pairs available; of these: 27191119 (37.12%) trimmed read pairs available after processing 46055366 (62.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 20 0.00% 20 10 0.00% 21 11 0.00% 22 14 0.00% 23 9 0.00% 24 14 0.00% 25 17 0.00% 26 25 0.00% 27 28 0.00% 28 15 0.00% 29 25 0.00% 30 32 0.00% 31 36 0.00% 32 35 0.00% 33 40 0.00% 34 49 0.00% 35 40 0.00% 36 59 0.00% 37 66 0.00% 38 71 0.00% 39 64 0.00% 40 78 0.00% 41 91 0.00% 42 83 0.00% 43 110 0.00% 44 133 0.00% 45 155 0.00% 46 161 0.00% 47 183 0.00% 48 199 0.00% 49 197 0.00% 50 272 0.00% 51 321 0.00% 52 290 0.00% 53 299 0.00% 54 338 0.00% 55 383 0.00% 56 434 0.00% 57 488 0.00% 58 551 0.00% 59 650 0.00% 60 689 0.00% 61 789 0.00% 62 907 0.00% 63 1028 0.00% 64 1153 0.00% 65 1315 0.00% 66 1504 0.00% 67 1703 0.00% 68 2127 0.00% 69 2968 0.00% 70 2948 0.00% 71 2748 0.00% 72 3044 0.00% 73 3488 0.00% 74 3948 0.01% 75 4446 0.01% 76 5034 0.01% 77 5487 0.01% 78 6010 0.01% 79 6826 0.01% 80 7739 0.01% 81 8896 0.01% 82 10214 0.01% 83 11996 0.02% 84 18366 0.03% 85 19721 0.03% 86 20967 0.03% 87 22650 0.03% 88 24333 0.03% 89 26155 0.04% 90 28100 0.04% 91 29994 0.04% 92 32423 0.04% 93 35351 0.05% 94 38149 0.05% 95 41531 0.06% 96 45022 0.06% 97 47786 0.07% 98 50654 0.07% 99 54098 0.07% 100 57427 0.08% 101 61175 0.08% 102 65775 0.09% 103 69938 0.10% 104 74658 0.10% 105 79506 0.11% 106 84589 0.12% 107 89257 0.12% 108 93256 0.13% 109 98587 0.13% 110 100833 0.14% 111 106545 0.15% 112 112006 0.15% 113 116532 0.16% 114 122946 0.17% 115 129770 0.18% 116 134880 0.18% 117 141021 0.19% 118 146915 0.20% 119 152243 0.21% 120 156619 0.21% 121 162559 0.22% 122 166756 0.23% 123 174580 0.24% 124 182466 0.25% 125 191607 0.26% 126 196185 0.27% 127 205293 0.28% 128 213082 0.29% 129 220641 0.30% 130 231144 0.32% 131 238189 0.33% 132 246842 0.34% 133 259102 0.35% 134 267589 0.37% 135 280257 0.38% 136 294947 0.40% 137 313048 0.43% 138 330292 0.45% 139 350706 0.48% 140 374560 0.51% 141 403601 0.55% 142 439677 0.60% 143 489448 0.67% 144 561542 0.77% 145 674864 0.92% 146 863514 1.18% 147 1242278 1.70% 148 2225986 3.04% 149 12557471 17.14% 150 46055366 62.88% 73246485 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=401.01 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=19.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=59.15 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR4237572 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:04:19 Started mapping on | Feb 12 10:04:19 Finished on | Feb 12 10:09:38 Mapping speed, Million of reads per hour | 826.61 Number of input reads | 73246485 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 70891406 Uniquely mapped reads % | 96.78% Average mapped length | 292.54 Number of splices: Total | 61928502 Number of splices: Annotated (sjdb) | 60827882 Number of splices: GT/AG | 60992259 Number of splices: GC/AG | 731019 Number of splices: AT/AC | 61642 Number of splices: Non-canonical | 143582 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1372748 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 96736 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1061578 1061578 1061578 N_multimapping 1372748 1372748 1372748 N_noFeature 2029363 69895382 2536107 N_ambiguous 799814 5729 306278 UnstrandedReadsAssigned:68062229 PositiveStrandReadsAssigned:990295 NegativeStrandReadsAssigned:68049021 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237572 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237572-trimmed-pair1.fastq SRR4237572-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 73,246,485 reads, 67,697,464 reads pseudoaligned [quant] estimated average fragment length: 232.312 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR4237572.ke.tsv 34699 SRR4237572.se.tsv 87100 total ==> SRR4237572.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.69 1633 12.689 Potri.005G024800.1.v4.1 1035 803.688 327 5.64871 Potri.004G059700.1.v4.1 961 729.714 83 1.57912 Potri.007G009000.2.v4.1 1416 1184.69 0 0 Potri.003G141000.2.v4.1 2943 2711.69 982.168 5.02847 Potri.016G087400.1.v4.1 270 81.8967 11276 1911.52 Potri.015G069301.1.v4.1 564 336.055 0 0 Potri.010G195200.1.v4.1 1773 1541.69 173 1.5579 Potri.012G127500.1.v4.1 977 745.698 24232 451.144 ==> SRR4237572.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10865 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1420 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR4237572 completed mapping pipeline successfully