Starting /dee2/code/volunteer_pipeline.sh SRR4237573 current disk space = 3049604616192 free memory = 1430453744 SRR4237573 SRAfilesize b5cff80c3d36ec1c92a57c5e8e729149 SRR4237573.sra SRR4237573.sra file validated SRR4237573 is paired end SRR4237573 is conventional basespace SRR4237573 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237573_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17575 34.0 33.0 34.0 31.0 34.0 2 32.9665 34.0 33.0 34.0 30.0 34.0 3 33.0985 34.0 33.0 34.0 32.0 34.0 4 33.1635 34.0 33.0 34.0 32.0 34.0 5 33.26025 34.0 33.0 34.0 33.0 34.0 6 37.043 38.0 37.0 38.0 36.0 38.0 7 37.36 38.0 38.0 38.0 37.0 38.0 8 37.5055 38.0 38.0 38.0 37.0 38.0 9 37.38325 38.0 38.0 38.0 37.0 38.0 10-14 37.543150000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.51585 38.0 38.0 38.0 37.8 38.0 20-24 37.2934 38.0 38.0 38.0 37.0 38.0 25-29 37.469750000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.265100000000004 38.0 38.0 38.0 36.6 38.0 35-39 37.3682 38.0 38.0 38.0 37.0 38.0 40-44 37.40425 38.0 38.0 38.0 37.0 38.0 45-49 37.117599999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.2668 38.0 38.0 38.0 36.8 38.0 55-59 37.211650000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.201499999999996 38.0 38.0 38.0 36.8 38.0 65-69 37.15745 38.0 38.0 38.0 36.8 38.0 70-74 37.168150000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.13275 38.0 38.0 38.0 36.8 38.0 80-84 37.109249999999996 38.0 38.0 38.0 36.2 38.0 85-89 37.03985 38.0 38.0 38.0 36.0 38.0 90-94 36.9055 38.0 38.0 38.0 36.0 38.0 95-99 36.94335 38.0 38.0 38.0 36.0 38.0 100-104 36.8547 38.0 38.0 38.0 36.0 38.0 105-109 36.7845 38.0 38.0 38.0 35.2 38.0 110-114 36.66725 38.0 38.0 38.0 35.0 38.0 115-119 36.57495 38.0 38.0 38.0 34.6 38.0 120-124 36.55915 38.0 38.0 38.0 34.4 38.0 125-129 36.44185 38.0 38.0 38.0 34.0 38.0 130-134 36.29995 38.0 38.0 38.0 34.0 38.0 135-139 36.199200000000005 38.0 38.0 38.0 34.0 38.0 140-144 36.013999999999996 38.0 38.0 38.0 33.6 38.0 145-149 35.60869999999999 38.0 38.0 38.0 32.2 38.0 150 29.88175 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.0 17 3.0 18 5.0 19 0.0 20 3.0 21 2.0 22 2.0 23 5.0 24 8.0 25 11.0 26 5.0 27 12.0 28 25.0 29 22.0 30 35.0 31 38.0 32 56.0 33 72.0 34 95.0 35 199.0 36 382.0 37 3013.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.62298603651987 13.10418904403867 7.814178302900107 33.45864661654135 2 24.025 16.05 33.175 26.75 3 19.975 21.25 26.924999999999997 31.85 4 22.400000000000002 29.775000000000002 23.625 24.2 5 23.075000000000003 34.075 23.400000000000002 19.45 6 17.5 37.875 24.099999999999998 20.525 7 14.249999999999998 26.85 41.825 17.075000000000003 8 16.650000000000002 26.25 32.05 25.05 9 16.925 25.275 33.300000000000004 24.5 10-14 19.535 30.855 27.075 22.535 15-19 19.115 29.93 27.54 23.415 20-24 19.08 29.5 27.810000000000002 23.61 25-29 19.055 29.909999999999997 27.439999999999998 23.595 30-34 19.25 30.04 27.495000000000005 23.215 35-39 19.63 29.475 27.47 23.425 40-44 19.525000000000002 29.785 27.35 23.34 45-49 19.575 29.375 27.400000000000002 23.65 50-54 19.465 29.975 26.795 23.765 55-59 19.165 29.87 27.0 23.965 60-64 19.535 29.885 27.639999999999997 22.939999999999998 65-69 19.78 29.759999999999998 26.93 23.53 70-74 19.580000000000002 29.81 27.22 23.39 75-79 19.99 29.354999999999997 27.065 23.59 80-84 19.370968548427424 29.491474573728688 27.181359067953398 23.956197809890494 85-89 19.68 29.965000000000003 27.165 23.189999999999998 90-94 19.535 29.705 27.02 23.74 95-99 19.62 29.020000000000003 27.779999999999998 23.580000000000002 100-104 20.169999999999998 29.26 27.05 23.52 105-109 19.93 29.959999999999997 26.655 23.455000000000002 110-114 20.064999999999998 29.599999999999998 26.155 24.18 115-119 20.64 29.5 26.645000000000003 23.215 120-124 20.305 29.425 26.540000000000003 23.73 125-129 20.794999999999998 28.92 26.72 23.565 130-134 20.474999999999998 29.110000000000003 26.334999999999997 24.08 135-139 20.549999999999997 28.63 25.990000000000002 24.83 140-144 20.71 28.52 26.51 24.26 145-149 20.525 28.58 26.450000000000003 24.445 150 19.950000000000003 29.125 26.775 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 1.0 21 1.5 22 1.5 23 2.0 24 2.0 25 3.5 26 10.5 27 15.0 28 18.0 29 23.5 30 28.0 31 34.5 32 43.5 33 59.0 34 86.5 35 96.0 36 101.0 37 120.5 38 144.0 39 170.0 40 200.0 41 220.5 42 236.5 43 255.5 44 257.5 45 265.0 46 262.5 47 235.0 48 206.0 49 174.0 50 154.0 51 135.0 52 107.5 53 86.5 54 64.0 55 48.0 56 33.5 57 22.0 58 16.0 59 15.0 60 11.0 61 6.0 62 5.5 63 4.0 64 4.5 65 3.5 66 2.0 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.8499999999999996 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 6.0375 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.4 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.475000000000001 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138 9.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237573 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237573_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.785 33.0 33.0 34.0 32.0 34.0 2 32.862 34.0 33.0 34.0 32.0 34.0 3 32.84475 34.0 33.0 34.0 32.0 34.0 4 32.8885 34.0 33.0 34.0 32.0 34.0 5 32.81175 34.0 33.0 34.0 32.0 34.0 6 37.01225 38.0 38.0 38.0 36.0 38.0 7 37.064 38.0 38.0 38.0 37.0 38.0 8 37.0625 38.0 38.0 38.0 36.0 38.0 9 37.017 38.0 38.0 38.0 36.0 38.0 10-14 36.87585 38.0 38.0 38.0 36.0 38.0 15-19 36.8912 38.0 38.0 38.0 36.0 38.0 20-24 36.96745 38.0 38.0 38.0 36.4 38.0 25-29 36.94734999999999 38.0 38.0 38.0 36.2 38.0 30-34 36.918000000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.8103 38.0 38.0 38.0 36.0 38.0 40-44 36.6192 38.0 38.0 38.0 35.0 38.0 45-49 36.8668 38.0 38.0 38.0 36.0 38.0 50-54 36.8363 38.0 38.0 38.0 36.0 38.0 55-59 36.806799999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.8183 38.0 38.0 38.0 36.0 38.0 65-69 36.74065 38.0 38.0 38.0 36.0 38.0 70-74 36.734500000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.616550000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.5848 38.0 38.0 38.0 35.4 38.0 85-89 36.548899999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.4639 38.0 38.0 38.0 35.0 38.0 95-99 36.42190000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.354049999999994 38.0 38.0 38.0 34.4 38.0 105-109 36.2702 38.0 38.0 38.0 34.2 38.0 110-114 36.2025 38.0 38.0 38.0 34.0 38.0 115-119 36.05995 38.0 38.0 38.0 33.8 38.0 120-124 35.8077 38.0 38.0 38.0 33.2 38.0 125-129 35.65435 38.0 37.8 38.0 32.8 38.0 130-134 35.4264 38.0 37.6 38.0 31.2 38.0 135-139 35.2861 38.0 37.2 38.0 31.0 38.0 140-144 34.87925 38.0 36.8 38.0 30.0 38.0 145-149 34.0357 38.0 35.8 38.0 24.8 38.0 150 27.2585 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 7.0 4 3.0 5 0.0 6 6.0 7 2.0 8 2.0 9 2.0 10 3.0 11 2.0 12 1.0 13 4.0 14 3.0 15 1.0 16 8.0 17 1.0 18 4.0 19 2.0 20 7.0 21 6.0 22 13.0 23 10.0 24 14.0 25 11.0 26 14.0 27 25.0 28 30.0 29 30.0 30 40.0 31 48.0 32 57.0 33 77.0 34 126.0 35 174.0 36 408.0 37 2851.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.474999999999994 22.15 11.325000000000001 22.05 2 29.049999999999997 24.95 31.125000000000004 14.875 3 21.575 27.625 31.65 19.15 4 23.175 35.05 23.150000000000002 18.625 5 25.25 36.75 22.525000000000002 15.475 6 20.275000000000002 37.325 24.9 17.5 7 19.875 20.525 40.300000000000004 19.3 8 21.3 24.625 29.049999999999997 25.025 9 22.85 24.2 29.049999999999997 23.9 10-14 24.404999999999998 28.749999999999996 26.455000000000002 20.39 15-19 23.78 27.935 28.185 20.1 20-24 23.13 28.205000000000002 27.76 20.905 25-29 23.815 27.55 28.79 19.845 30-34 23.400000000000002 27.63 28.694999999999997 20.275000000000002 35-39 23.064999999999998 28.005000000000003 28.67 20.26 40-44 23.485 27.58 28.335 20.599999999999998 45-49 23.36 27.47 29.15 20.02 50-54 23.77 28.215 28.349999999999998 19.665 55-59 23.61 28.04 28.74 19.61 60-64 23.21 28.4 28.62 19.77 65-69 24.505 28.055000000000003 28.194999999999997 19.245 70-74 23.16 27.900000000000002 28.64 20.3 75-79 23.18 28.000000000000004 28.799999999999997 20.02 80-84 23.715 28.26 28.325 19.7 85-89 23.625 27.560000000000002 29.005 19.81 90-94 23.865 27.22 28.48 20.435 95-99 23.44 28.044999999999998 28.68 19.835 100-104 23.945 28.43 27.98 19.645000000000003 105-109 23.7 27.87 28.725 19.705000000000002 110-114 23.810000000000002 28.139999999999997 28.07 19.98 115-119 24.32 27.66 28.09 19.93 120-124 24.705 27.534999999999997 28.08 19.68 125-129 24.52 27.515 28.485 19.48 130-134 24.73 27.650000000000002 28.33 19.29 135-139 25.615 27.310000000000002 27.925 19.15 140-144 25.080000000000002 27.765 27.83 19.325 145-149 25.669999999999998 28.535 26.685 19.11 150 25.8 27.3 26.85 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.5 19 2.0 20 1.0 21 1.0 22 0.5 23 3.0 24 6.0 25 5.5 26 3.5 27 6.0 28 10.5 29 13.0 30 13.0 31 16.5 32 37.5 33 50.0 34 55.0 35 67.5 36 82.0 37 110.0 38 131.0 39 161.5 40 210.0 41 244.5 42 252.0 43 262.0 44 282.0 45 296.0 46 283.0 47 250.0 48 225.5 49 196.0 50 171.0 51 132.0 52 102.5 53 90.0 54 67.5 55 44.0 56 29.5 57 19.0 58 12.5 59 13.5 60 10.5 61 7.0 62 4.5 63 2.0 64 2.0 65 3.0 66 1.5 67 2.0 68 1.5 69 0.0 70 1.0 71 1.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2258469259723965 0.44999999999999996 3 0.0752823086574655 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.7125000000000004 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.675 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.95 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.25 0.0 0.0 0.0 0.0 132-133 7.6375 0.0 0.0 0.0 0.0 134-135 8.350000000000001 0.0 0.0 0.0 0.0 136-137 8.9375 0.0 0.0 0.0 0.0 138 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398090 spots for SRR4237573.sra Written 1398090 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra Read 1398075 spots for SRR4237573.sra Written 1398075 spots for SRR4237573.sra SRR ids: ['SRR4237573.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6nha3eg2 SRR4237573.sra spots: 27961515 blocks: [[1, 1398075], [1398076, 2796150], [2796151, 4194225], [4194226, 5592300], [5592301, 6990375], [6990376, 8388450], [8388451, 9786525], [9786526, 11184600], [11184601, 12582675], [12582676, 13980750], [13980751, 15378825], [15378826, 16776900], [16776901, 18174975], [18174976, 19573050], [19573051, 20971125], [20971126, 22369200], [22369201, 23767275], [23767276, 25165350], [25165351, 26563425], [26563426, 27961515]] SRR4237573 file size 9398927 SRR4237573 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237573 SRR4237573_1.fastq SRR4237573_2.fastq Input file: SRR4237573_1.fastq Paired file: SRR4237573_2.fastq trimmed: SRR4237573-trimmed-pair1.fastq, SRR4237573-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:30:49 2025 >> started Wed Feb 12 09:31:17 2025 >> done (28.676s) 27961515 read pairs processed; of these: 35347 ( 0.13%) short read pairs filtered out after trimming by size control 28276 ( 0.10%) empty read pairs filtered out after trimming by size control 27897892 (99.77%) read pairs available; of these: 10441779 (37.43%) trimmed read pairs available after processing 17456113 (62.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 9 0.00% 21 9 0.00% 22 7 0.00% 23 6 0.00% 24 9 0.00% 25 12 0.00% 26 5 0.00% 27 12 0.00% 28 14 0.00% 29 9 0.00% 30 16 0.00% 31 13 0.00% 32 23 0.00% 33 15 0.00% 34 18 0.00% 35 19 0.00% 36 20 0.00% 37 35 0.00% 38 35 0.00% 39 44 0.00% 40 62 0.00% 41 54 0.00% 42 67 0.00% 43 54 0.00% 44 91 0.00% 45 90 0.00% 46 108 0.00% 47 116 0.00% 48 133 0.00% 49 161 0.00% 50 154 0.00% 51 188 0.00% 52 215 0.00% 53 229 0.00% 54 246 0.00% 55 287 0.00% 56 349 0.00% 57 395 0.00% 58 402 0.00% 59 465 0.00% 60 510 0.00% 61 660 0.00% 62 687 0.00% 63 760 0.00% 64 850 0.00% 65 996 0.00% 66 1209 0.00% 67 1302 0.00% 68 1547 0.01% 69 2778 0.01% 70 2459 0.01% 71 2076 0.01% 72 2239 0.01% 73 2598 0.01% 74 3073 0.01% 75 3354 0.01% 76 3537 0.01% 77 3952 0.01% 78 4417 0.02% 79 5042 0.02% 80 5556 0.02% 81 6264 0.02% 82 6987 0.03% 83 7883 0.03% 84 11322 0.04% 85 12047 0.04% 86 12800 0.05% 87 13690 0.05% 88 14791 0.05% 89 15826 0.06% 90 17066 0.06% 91 18173 0.07% 92 19779 0.07% 93 21069 0.08% 94 23095 0.08% 95 24393 0.09% 96 26311 0.09% 97 27633 0.10% 98 28926 0.10% 99 30946 0.11% 100 32400 0.12% 101 34294 0.12% 102 36192 0.13% 103 38337 0.14% 104 40580 0.15% 105 42682 0.15% 106 44886 0.16% 107 46510 0.17% 108 48152 0.17% 109 49917 0.18% 110 51575 0.18% 111 54127 0.19% 112 55990 0.20% 113 57736 0.21% 114 60699 0.22% 115 62698 0.22% 116 64271 0.23% 117 66913 0.24% 118 69126 0.25% 119 69673 0.25% 120 70961 0.25% 121 73857 0.26% 122 75004 0.27% 123 77920 0.28% 124 80481 0.29% 125 82125 0.29% 126 85061 0.30% 127 86843 0.31% 128 88759 0.32% 129 91609 0.33% 130 93803 0.34% 131 95958 0.34% 132 99363 0.36% 133 102436 0.37% 134 106050 0.38% 135 109570 0.39% 136 113419 0.41% 137 118278 0.42% 138 122323 0.44% 139 127494 0.46% 140 134952 0.48% 141 142955 0.51% 142 152230 0.55% 143 165395 0.59% 144 189046 0.68% 145 221239 0.79% 146 267818 0.96% 147 373122 1.34% 148 697112 2.50% 149 4777026 17.12% 150 17456113 62.57% 27897892 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.0 sequence=GCTAGACATGCAAGATTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=447.38 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=18.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=3.3 sequence=TCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCGAACTCACCGCATGGATGCATTTGATCTTTGATTTGGAGCAGAGATGCCTTGTGGGATGTTCTTGTTGGTTCCAAGTAGGTTGATGAATTTTATATTAATGGTTTGGTATGTAATAAAATA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=281.09 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.5 sequence=AAGAAGAAGAAA SRR4237573 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:31:57 Started mapping on | Feb 12 09:31:57 Finished on | Feb 12 09:34:05 Mapping speed, Million of reads per hour | 784.63 Number of input reads | 27897892 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 26850406 Uniquely mapped reads % | 96.25% Average mapped length | 290.94 Number of splices: Total | 22692610 Number of splices: Annotated (sjdb) | 22256427 Number of splices: GT/AG | 22333896 Number of splices: GC/AG | 275206 Number of splices: AT/AC | 21331 Number of splices: Non-canonical | 62177 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 523042 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 50769 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 562627 562627 562627 N_multimapping 523042 523042 523042 N_noFeature 832238 26528654 991855 N_ambiguous 279071 1787 115627 UnstrandedReadsAssigned:25739097 PositiveStrandReadsAssigned:319965 NegativeStrandReadsAssigned:25742924 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237573 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237573-trimmed-pair1.fastq SRR4237573-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,897,892 reads, 25,606,863 reads pseudoaligned [quant] estimated average fragment length: 226.432 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR4237573.ke.tsv 34699 SRR4237573.se.tsv 87100 total ==> SRR4237573.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.57 550 11.996 Potri.005G024800.1.v4.1 1035 809.568 81 3.91183 Potri.004G059700.1.v4.1 961 735.594 31 1.64768 Potri.007G009000.2.v4.1 1416 1190.57 0 0 Potri.003G141000.2.v4.1 2943 2717.57 386.131 5.55524 Potri.016G087400.1.v4.1 270 87.166 3994 1791.47 Potri.015G069301.1.v4.1 564 341.912 0 0 Potri.010G195200.1.v4.1 1773 1547.57 117.836 2.97699 Potri.012G127500.1.v4.1 977 751.579 8289 431.197 ==> SRR4237573.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3373 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 475 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237573 completed mapping pipeline successfully