Starting /dee2/code/volunteer_pipeline.sh SRR4237574 current disk space = 3049838088192 free memory = 1574154740 SRR4237574 SRAfilesize a06da91da6d91a3b534b161d48454bc5 SRR4237574.sra SRR4237574.sra file validated SRR4237574 is paired end SRR4237574 is conventional basespace SRR4237574 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.04775 33.0 25.0 34.0 2.0 34.0 2 31.53975 33.0 28.0 34.0 27.0 34.0 3 31.92825 33.0 32.0 34.0 27.0 34.0 4 32.532 33.0 33.0 34.0 32.0 34.0 5 32.799 33.0 33.0 34.0 32.0 34.0 6 36.6285 38.0 37.0 38.0 34.0 38.0 7 36.94 38.0 38.0 38.0 35.0 38.0 8 37.00925 38.0 38.0 38.0 36.0 38.0 9 36.90525 38.0 38.0 38.0 35.0 38.0 10-14 37.1424 38.0 38.0 38.0 36.0 38.0 15-19 37.0119 38.0 38.0 38.0 35.6 38.0 20-24 37.145050000000005 38.0 38.0 38.0 36.0 38.0 25-29 37.10095 38.0 38.0 38.0 36.0 38.0 30-34 36.9553 38.0 38.0 38.0 35.6 38.0 35-39 36.83525 38.0 38.0 38.0 35.2 38.0 40-44 36.79065 38.0 38.0 38.0 34.8 38.0 45-49 36.9405 38.0 38.0 38.0 35.4 38.0 50-54 36.6479 38.0 38.0 38.0 34.6 38.0 55-59 34.935199999999995 37.8 34.2 38.0 27.8 38.0 60-64 35.3652 37.8 35.2 38.0 29.2 38.0 65-69 36.60405 38.0 37.8 38.0 34.2 38.0 70-74 36.00735 38.0 37.2 38.0 31.4 38.0 75-79 36.58315 38.0 38.0 38.0 34.2 38.0 80-84 33.75905 37.6 30.6 38.0 23.6 38.0 85-89 35.5137 37.8 35.8 38.0 29.8 38.0 90-94 36.128499999999995 38.0 37.2 38.0 32.8 38.0 95-99 36.3146 38.0 37.6 38.0 33.8 38.0 100-104 36.24155 38.0 37.6 38.0 33.6 38.0 105-109 36.16555 38.0 37.0 38.0 33.6 38.0 110-114 35.90325 38.0 37.0 38.0 32.2 38.0 115-119 35.9209 38.0 37.0 38.0 32.8 38.0 120-124 35.950100000000006 38.0 37.0 38.0 32.4 38.0 125-129 35.55965 38.0 36.2 38.0 31.0 38.0 130-134 34.57005 38.0 34.6 38.0 26.0 38.0 135-139 34.17765000000001 38.0 34.6 38.0 23.0 38.0 140-144 34.8127 38.0 35.4 38.0 28.6 38.0 145-149 33.19025 38.0 33.2 38.0 21.6 38.0 150 27.39775 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 1.0 21 6.0 22 7.0 23 15.0 24 12.0 25 16.0 26 23.0 27 23.0 28 47.0 29 62.0 30 69.0 31 101.0 32 119.0 33 136.0 34 271.0 35 381.0 36 827.0 37 1872.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.28 12.256 8.128 34.336 2 23.025000000000002 15.325 33.475 28.175 3 19.85 21.099999999999998 26.724999999999998 32.324999999999996 4 23.9 28.725 23.525 23.849999999999998 5 22.3 33.5 24.15 20.05 6 18.05 35.175 25.75 21.025 7 14.6 25.7 42.625 17.075000000000003 8 16.7 25.275 33.025 25.0 9 17.224999999999998 23.525 34.275 24.975 10-14 19.785 30.61 26.745 22.86 15-19 19.71 28.754999999999995 27.675 23.86 20-24 19.994999999999997 29.34 26.82 23.845 25-29 18.985 29.74 27.685 23.59 30-34 20.07 28.865000000000002 27.13 23.935000000000002 35-39 19.925 29.365000000000002 26.974999999999998 23.735 40-44 19.535 29.404999999999998 27.750000000000004 23.31 45-49 19.895 28.37 27.639999999999997 24.095 50-54 19.895 29.64 27.165 23.3 55-59 20.775 29.020000000000003 27.235 22.97 60-64 19.88 29.165000000000003 27.384999999999998 23.57 65-69 20.244999999999997 28.485 27.355 23.915 70-74 19.885 28.825 27.500000000000004 23.79 75-79 20.26 29.065 27.235 23.44 80-84 19.950000000000003 28.83 27.544999999999998 23.674999999999997 85-89 20.05 29.104999999999997 27.389999999999997 23.455000000000002 90-94 20.31 29.18 27.11 23.400000000000002 95-99 20.13 29.160000000000004 26.625 24.085 100-104 20.43 28.499999999999996 27.235 23.835 105-109 20.345 28.849999999999998 26.775 24.03 110-114 20.175 28.660000000000004 27.425 23.74 115-119 20.94 28.49 27.0 23.57 120-124 19.705000000000002 28.999999999999996 27.29 24.005000000000003 125-129 20.79 28.335 27.075 23.799999999999997 130-134 21.055 28.794999999999998 26.229999999999997 23.919999999999998 135-139 20.95 28.535 25.83 24.685000000000002 140-144 21.195 28.810000000000002 26.71 23.285 145-149 20.865000000000002 28.875 26.52 23.74 150 20.8 27.650000000000002 27.650000000000002 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.5 22 0.5 23 0.5 24 2.0 25 1.5 26 2.0 27 7.0 28 10.0 29 13.5 30 21.5 31 31.5 32 47.0 33 54.0 34 64.5 35 81.0 36 101.5 37 123.0 38 133.5 39 161.5 40 194.0 41 222.5 42 245.5 43 261.0 44 265.0 45 251.5 46 257.5 47 255.5 48 223.5 49 189.5 50 157.0 51 138.5 52 120.5 53 93.5 54 66.0 55 50.0 56 43.5 57 32.0 58 22.5 59 14.0 60 7.0 61 7.0 62 8.5 63 4.5 64 1.0 65 1.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.85 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.7750000000000004 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.125 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 8.0 0.0 0.0 0.0 0.0 136-137 8.675 0.0 0.0 0.0 0.0 138 9.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCGA 10 0.0070045046 143.7875 8 CATGTCG 10 0.0070045046 143.7875 7 >>END_MODULE SRR4237574 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237574_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1945 33.0 33.0 34.0 31.0 34.0 2 32.30775 33.0 33.0 34.0 31.0 34.0 3 32.3405 33.0 33.0 34.0 31.0 34.0 4 32.18575 33.0 33.0 34.0 31.0 34.0 5 32.25475 33.0 33.0 34.0 31.0 34.0 6 36.283 38.0 38.0 38.0 33.0 38.0 7 36.425 38.0 38.0 38.0 34.0 38.0 8 36.3735 38.0 38.0 38.0 34.0 38.0 9 36.16125 38.0 38.0 38.0 33.0 38.0 10-14 36.30615 38.0 38.0 38.0 33.6 38.0 15-19 36.2605 38.0 38.0 38.0 33.4 38.0 20-24 36.2694 38.0 38.0 38.0 33.6 38.0 25-29 35.768449999999994 38.0 37.2 38.0 30.6 38.0 30-34 36.21894999999999 38.0 38.0 38.0 33.4 38.0 35-39 35.61460000000001 38.0 37.0 38.0 30.2 38.0 40-44 35.9276 38.0 37.4 38.0 31.2 38.0 45-49 36.120850000000004 38.0 38.0 38.0 33.0 38.0 50-54 36.15215 38.0 38.0 38.0 33.4 38.0 55-59 36.062349999999995 38.0 38.0 38.0 33.2 38.0 60-64 35.9754 38.0 38.0 38.0 33.0 38.0 65-69 35.9127 38.0 38.0 38.0 32.0 38.0 70-74 35.83325 38.0 37.4 38.0 31.6 38.0 75-79 35.39455 38.0 36.8 38.0 28.8 38.0 80-84 35.46435 38.0 37.0 38.0 29.2 38.0 85-89 35.42325 38.0 37.0 38.0 29.6 38.0 90-94 35.402249999999995 38.0 37.0 38.0 29.2 38.0 95-99 35.3643 38.0 37.0 38.0 29.4 38.0 100-104 34.99855 38.0 36.6 38.0 27.4 38.0 105-109 32.17954999999999 36.8 28.6 38.0 18.2 38.0 110-114 34.5856 38.0 35.8 38.0 24.8 38.0 115-119 34.63355 38.0 36.0 38.0 24.8 38.0 120-124 34.15855 38.0 35.2 38.0 22.8 38.0 125-129 33.9835 38.0 34.6 38.0 21.8 38.0 130-134 33.53725 38.0 33.6 38.0 20.2 38.0 135-139 33.153949999999995 38.0 33.0 38.0 17.0 38.0 140-144 32.0943 38.0 32.6 38.0 12.8 38.0 145-149 31.12645 38.0 32.6 38.0 3.8 38.0 150 22.7735 29.0 2.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 0.0 5 0.0 6 2.0 7 3.0 8 6.0 9 4.0 10 3.0 11 5.0 12 6.0 13 4.0 14 4.0 15 9.0 16 6.0 17 6.0 18 14.0 19 12.0 20 11.0 21 12.0 22 17.0 23 19.0 24 27.0 25 27.0 26 50.0 27 43.0 28 58.0 29 73.0 30 94.0 31 100.0 32 109.0 33 187.0 34 202.0 35 341.0 36 624.0 37 1903.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.625 21.475 12.049999999999999 23.849999999999998 2 28.799999999999997 24.45 30.575000000000003 16.175 3 21.675 27.750000000000004 31.75 18.825 4 25.95 34.375 22.225 17.45 5 24.349999999999998 37.925 21.15 16.575 6 19.475 39.050000000000004 24.224999999999998 17.25 7 20.875 20.225 39.925 18.975 8 21.7 24.25 28.825 25.224999999999998 9 22.05 25.5 30.049999999999997 22.400000000000002 10-14 23.925 28.49 26.855 20.73 15-19 23.47 27.474999999999998 28.315 20.74 20-24 23.72 27.55 28.54 20.19 25-29 23.645 28.075 27.91 20.369999999999997 30-34 23.05 27.99 27.689999999999998 21.27 35-39 23.345 27.435 28.360000000000003 20.86 40-44 23.265 27.534999999999997 28.52 20.68 45-49 23.075000000000003 27.474999999999998 28.935 20.515 50-54 22.85 27.6 28.88 20.669999999999998 55-59 23.810000000000002 27.084999999999997 28.935 20.169999999999998 60-64 23.89 27.38 28.17 20.560000000000002 65-69 23.095 27.965 28.01 20.93 70-74 23.225 28.07 28.144999999999996 20.560000000000002 75-79 23.165 28.060000000000002 28.689999999999998 20.085 80-84 23.419999999999998 27.779999999999998 28.294999999999998 20.505000000000003 85-89 23.39 27.595 28.465 20.549999999999997 90-94 23.77 27.339999999999996 28.645 20.244999999999997 95-99 23.799999999999997 27.96 28.22 20.02 100-104 24.035 27.525 28.565 19.875 105-109 23.78 27.389999999999997 28.625 20.205000000000002 110-114 24.654999999999998 27.439999999999998 28.415000000000003 19.49 115-119 23.794999999999998 27.35 28.78 20.075000000000003 120-124 24.075 27.875 27.985 20.064999999999998 125-129 24.115000000000002 27.384999999999998 28.095 20.405 130-134 24.585 27.575 27.765 20.075000000000003 135-139 25.264999999999997 27.49 27.38 19.865 140-144 25.355 27.91 27.04 19.695 145-149 25.965 27.900000000000002 26.88 19.255 150 25.275 29.099999999999998 27.3 18.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 3.5 24 4.5 25 6.0 26 5.5 27 7.5 28 8.0 29 7.0 30 12.5 31 19.0 32 23.0 33 36.0 34 58.0 35 71.5 36 87.0 37 106.5 38 136.5 39 169.0 40 194.0 41 215.5 42 235.5 43 272.5 44 297.0 45 289.0 46 265.5 47 238.5 48 229.0 49 198.5 50 159.5 51 141.0 52 122.0 53 100.0 54 77.5 55 55.5 56 33.0 57 30.5 58 25.5 59 13.5 60 6.5 61 4.0 62 7.0 63 7.5 64 3.0 65 2.0 66 3.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.0 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.3375 0.0 0.0 0.0 0.0 134-135 7.8625 0.0 0.0 0.0 0.0 136-137 8.525 0.0 0.0 0.0 0.0 138 9.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452103 spots for SRR4237574.sra Written 3452103 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra Read 3452093 spots for SRR4237574.sra Written 3452093 spots for SRR4237574.sra SRR ids: ['SRR4237574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8bnocbny SRR4237574.sra spots: 69041870 blocks: [[1, 3452093], [3452094, 6904186], [6904187, 10356279], [10356280, 13808372], [13808373, 17260465], [17260466, 20712558], [20712559, 24164651], [24164652, 27616744], [27616745, 31068837], [31068838, 34520930], [34520931, 37973023], [37973024, 41425116], [41425117, 44877209], [44877210, 48329302], [48329303, 51781395], [51781396, 55233488], [55233489, 58685581], [58685582, 62137674], [62137675, 65589767], [65589768, 69041870]] SRR4237574 file size 23239476 SRR4237574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237574 SRR4237574_1.fastq SRR4237574_2.fastq Input file: SRR4237574_1.fastq Paired file: SRR4237574_2.fastq trimmed: SRR4237574-trimmed-pair1.fastq, SRR4237574-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:13:05 2025 >> started Wed Feb 12 10:14:29 2025 >> done (84.473s) 69041870 read pairs processed; of these: 117626 ( 0.17%) short read pairs filtered out after trimming by size control 85176 ( 0.12%) empty read pairs filtered out after trimming by size control 68839068 (99.71%) read pairs available; of these: 29746268 (43.21%) trimmed read pairs available after processing 39092800 (56.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 6 0.00% 21 10 0.00% 22 12 0.00% 23 26 0.00% 24 21 0.00% 25 20 0.00% 26 17 0.00% 27 23 0.00% 28 28 0.00% 29 22 0.00% 30 42 0.00% 31 43 0.00% 32 47 0.00% 33 41 0.00% 34 40 0.00% 35 49 0.00% 36 55 0.00% 37 59 0.00% 38 73 0.00% 39 78 0.00% 40 95 0.00% 41 88 0.00% 42 110 0.00% 43 103 0.00% 44 124 0.00% 45 138 0.00% 46 141 0.00% 47 148 0.00% 48 210 0.00% 49 198 0.00% 50 264 0.00% 51 277 0.00% 52 300 0.00% 53 338 0.00% 54 364 0.00% 55 458 0.00% 56 480 0.00% 57 549 0.00% 58 608 0.00% 59 687 0.00% 60 811 0.00% 61 875 0.00% 62 1020 0.00% 63 1103 0.00% 64 1208 0.00% 65 1376 0.00% 66 1570 0.00% 67 1803 0.00% 68 2204 0.00% 69 3073 0.00% 70 3319 0.00% 71 3184 0.00% 72 3629 0.01% 73 4081 0.01% 74 4428 0.01% 75 5018 0.01% 76 5653 0.01% 77 6277 0.01% 78 7218 0.01% 79 8105 0.01% 80 9170 0.01% 81 10693 0.02% 82 12014 0.02% 83 14645 0.02% 84 24068 0.03% 85 24576 0.04% 86 26205 0.04% 87 27696 0.04% 88 29829 0.04% 89 31963 0.05% 90 34520 0.05% 91 36921 0.05% 92 40528 0.06% 93 44119 0.06% 94 47712 0.07% 95 51213 0.07% 96 54964 0.08% 97 59172 0.09% 98 61970 0.09% 99 66828 0.10% 100 72101 0.10% 101 75906 0.11% 102 83012 0.12% 103 88849 0.13% 104 94800 0.14% 105 101279 0.15% 106 107243 0.16% 107 112401 0.16% 108 118170 0.17% 109 123768 0.18% 110 128575 0.19% 111 137044 0.20% 112 144595 0.21% 113 150825 0.22% 114 160099 0.23% 115 168712 0.25% 116 172758 0.25% 117 182082 0.26% 118 187301 0.27% 119 192315 0.28% 120 200440 0.29% 121 207859 0.30% 122 215279 0.31% 123 223753 0.33% 124 234543 0.34% 125 242259 0.35% 126 251613 0.37% 127 258181 0.38% 128 266540 0.39% 129 277858 0.40% 130 286796 0.42% 131 294637 0.43% 132 306729 0.45% 133 319660 0.46% 134 333524 0.48% 135 346607 0.50% 136 362116 0.53% 137 380971 0.55% 138 401160 0.58% 139 421567 0.61% 140 445381 0.65% 141 478826 0.70% 142 518431 0.75% 143 574755 0.83% 144 648805 0.94% 145 768449 1.12% 146 953456 1.39% 147 1325070 1.92% 148 2343388 3.40% 149 12474607 18.12% 150 39092800 56.79% 68839068 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=186.38 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.9 sequence=AAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=25.86 fanout-score-rank=6 prefix-density=0.39 prefix-fanout=9.8 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=79.22 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=16.7 sequence=TGCTGCTGAAATT SRR4237574 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:15:13 Started mapping on | Feb 12 10:15:13 Finished on | Feb 12 10:21:58 Mapping speed, Million of reads per hour | 611.90 Number of input reads | 68839068 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 65412820 Uniquely mapped reads % | 95.02% Average mapped length | 290.39 Number of splices: Total | 57202683 Number of splices: Annotated (sjdb) | 56249504 Number of splices: GT/AG | 56348049 Number of splices: GC/AG | 663483 Number of splices: AT/AC | 53000 Number of splices: Non-canonical | 138151 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1254295 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 92926 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2291808 2291808 2291808 N_multimapping 1254295 1254295 1254295 N_noFeature 1736521 64680750 2110324 N_ambiguous 640041 4901 277894 UnstrandedReadsAssigned:63036258 PositiveStrandReadsAssigned:727169 NegativeStrandReadsAssigned:63024602 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4237574 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237574-trimmed-pair1.fastq SRR4237574-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 68,839,068 reads, 62,837,500 reads pseudoaligned [quant] estimated average fragment length: 218.933 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,344 rounds 52401 SRR4237574.ke.tsv 34699 SRR4237574.se.tsv 87100 total ==> SRR4237574.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.07 1423 13.674 Potri.005G024800.1.v4.1 1035 817.067 162 3.42955 Potri.004G059700.1.v4.1 961 743.081 27 0.628504 Potri.007G009000.2.v4.1 1416 1198.07 0 0 Potri.003G141000.2.v4.1 2943 2725.07 1150.16 7.30063 Potri.016G087400.1.v4.1 270 89.2064 8027.66 1556.59 Potri.015G069301.1.v4.1 564 348.934 0 0 Potri.010G195200.1.v4.1 1773 1555.07 268 2.98103 Potri.012G127500.1.v4.1 977 759.067 15012 342.088 ==> SRR4237574.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9169 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 970 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 53 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237574 completed mapping pipeline successfully